CN108588078B - Tomato late blight-resistant exon circular RNA-EcircRNA45 and cloning, detection and application methods thereof - Google Patents

Abstract

The invention provides tomato late blight resistant exon circular RNA-EcircRNA45 and a cloning method of the gene; the invention also provides an application method of the tomato late blight resistant exon circular RNA-EcircRNA45, which is used for tomato to resist pathogen infection, namely, the tomato late blight resistant exon circular RNA-EcircRNA45 is overexpressed in tomato. The invention firstly designs a specific circular RNA primer to carry out PCR and a first-generation sequencing experiment to confirm the objective existence of tomato late blight resistant exon circular RNA-EcircRNA 45; also provides a specific qRT-PCR primer for effectively detecting the tomato late blight resistant exon circular RNA-EcircRNA45, and reduces the existence of false positive. By means of the overexpression of the exon circular RNA-EcircRNA45, the tomato late blight resistance gene can be regulated.

Description

Tomato late blight-resistant exon circular RNA-EcircRNA45 and cloning, detection and application methods thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to tomato late blight resistant exon circRNA45, a cloning method and an application method thereof.

Background

Tomato is a horticultural crop that is widely grown worldwide and is a dicotyledonous model of the solanaceae family. Late blight caused by late blight pathogen infection causes huge economic losses to tomato production worldwide. Although the use of chemical pesticides can slow down the occurrence and spread of diseases, the problems of pesticide residue, environmental pollution, pathogenic bacteria resistance and the like are increasingly severe. Although suitable cultivars researched for late blight pathogen resistance genes exist, late blight pathogen virulence structures are complex, known tomato disease resistance genes easily lose resistance, and therefore, a new way for resisting pathogen infection is urgently sought.

Circular RNA (circRNA) is a new member of the non-coding RNA family that is distinct from traditional linear RNA, and is an endogenous RNA molecule that is covalently bonded to form a circular structure. The Sanger team in 1976 proposed that the viroid in higher plants was a single-stranded circular closed RNA virus and called this RNA circular RNA, whereby the concept of circular RNA was first proposed (Sang et al, 1976). In addition, Nigro et al discovered in 1991 that circRNA products can be produced by significant trans-splicing of human oncogenes (Nigro et al, 1991). Although circRNA is conserved in many species, it has previously been regarded as a mis-spliced product and is not appreciated (Qian et al, 1992). And the research of circRNA has been in a relatively rare state due to technical limitations.

With the progress of sequencing technology in recent years, research on circRNA has become possible. It was first demonstrated in 2012 that the presence of circRNA molecules was found to be more prevalent in gene expression programs in human cells than linear RNA (Salzman et al, 2012). Over time, the presence of 1950, 1903, 724 circrnas was again demonstrated in humans, mice and nematodes using high throughput sequencing techniques (Memczak et al, 2013), respectively. In addition, circrnas often appear tissue or developmental stage specific in vivo (Szabo et al, 2015). In recent years, research shows that the circRNA can adsorb miRNA, so that a corresponding biological function exists, and the function causes the circRNA to attract the extensive attention of researchers (Hansen et al, 2013).

The circrnas are mainly generated by atypical variable-splicing processing, and currently found circrnas are mainly derived from gene exons, but various studies show that the types of the circrnas are more complicated than thought, and the circrnas can be divided into Exon circular RNAs (Exon circular RNAs, ecircrnas), Intron circular RNAs (Intron circular RNAs, icircrnas) and Exon-Intron circular RNAs (Exon-Intron circular RNAs, eicrnas) according to the composition, and the ecircrnas are found most frequently. At present, the identification of circular RNA is mainly to determine the reverse splicing site of circular RNA, to design a primer to carry out PCR amplification across the reverse splicing site, to sequence the PCR amplification product, and to prove that the sequence is circRNA if the amplified sequence contains a reverse splicing sequence. However, the main key point of the method is to determine the accurate cyclization position of the circRNA and then design the primer. The reverse splice sites obtained by data analysis are usually wide in range, so that how to select the proper splice sites becomes important.

Studies have shown that circRNA can adsorb miRNA as a "sponge" blocking the inhibitory effect of miRNA on its target gene (Wang et al, 2016). An essential means for the study of the function and regulatory mechanisms of circRNA is the overexpression of circRNA in vivo. In order to express the cloned circRNA in a large amount in the body, an expression frame of the circRNA needs to be constructed. The methods of gene technology for over-expression linearity are well established, but problems exist with over-expression of circular RNA molecules, such as: how to precisely circularize an RNA molecule at a specific site can then produce circular RNA in vivo. Studies have shown in animals that overexpression of circRNA can be performed by means of suitable artificial vectors or injection, but no specific vectors exist in plants that mediate in vivo circularization of circRNA.

Disclosure of Invention

In view of the harm degree of the tomato late blight, a new way for improving the disease resistance of the tomato is urgently needed to be found, and the invention aims to provide a method for effectively overexpressing circRNA related to the tomato late blight, so that the disease resistance of the tomato is improved.

In order to achieve the aim, the invention provides tomato late blight resistant exon circular RNA-EcircRNA45, the sequence of which is shown as SEQ ID NO. 1.

The invention also provides a cloning method of the tomato late blight-resistant exon circular RNA-EcircRNA45, which takes EcircRNA45-C-FP, EcircRNA45-C-RP, EcircRNA45-D-FP and EcircRNA45-D-RP as specific primers, wherein DNA sequences shown by EcircRNA45-C-FP and EcircRNA45-C-RP form a forward primer pair, and DNA sequences shown by EcircRNA45-D-FP and EcircRNA45-D-RP form a reverse primer pair;

the sequences of the specific primers EcircRNA45-C-FP, EcircRNA45-C-RP, EcircRNA45-D-FP and EcircRNA45-D-RP are respectively shown as SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

Preferably, the tomato late blight-resistant exon circular RNA-EcircRNA45 is obtained by performing PCR amplification by using gDNA and cDNA of tomato L3708 as templates and EcircRNA45-C-FP, EcircRNA45-C-RP, EcircRNA45-D-FP and EcircRNA45-D-RP as specific primers respectively.

In addition, the invention also provides a method for effectively detecting the expression quantity of the tomato late blight-resistant exon circular RNA-EcircRNA45, namely qRT-PCR primer design is carried out at two ends of the reverse splice site of the tomato late blight-resistant exon circular RNA-EcircRNA45, and the designed primers are qRT-EcircRNA45-FP and qRT-EcircRNA45-RP respectively;

the designed primer qRT-EcircRNA45-FP and qRT-EcircRNA45-RP sequences are respectively shown as SEQ ID NO. 6 and SEQ ID NO. 7.

The design and detection method can effectively reduce false positive, and the expression quantity of tomato late blight resistant exon circular RNA-EcircRNA45 can be accurately obtained by using the pair of primers to carry out qRT-PCR experiments.

The invention also provides an application method of the tomato late blight resistant exon circular RNA-EcircRNA45, which is used for tomato to resist pathogen infection.

In a preferable mode, the tomato resistance to pathogen infection is realized by regulating and controlling the expression of tomato late blight resistance genes, namely, the tomato late blight resistance exon circular RNA-EcircRNA45 is overexpressed in tomatoes.

Further optimization, the specific method comprises the following steps:

s1, extending two ends of a tomato late blight resistant exon circular RNA-EcircRNA45 sequence, and finally introducing reverse splicing sites at the upstream and downstream of the sequence;

s2, designing a primer according to the new sequence, and adding Bam H I and Sac I enzyme cutting sites and protective bases at two ends of the primer respectively to obtain a final primer, wherein the final primer is EcircRNA45-FP and EcircRNA 45-RP;

the sequence of EcircRNA45-FP is shown as SEQ ID NO. 12, and the sequence of EcircRNA45-RP is shown as SEQ ID NO. 13;

s3, carrying out tomato late blight resistant exon circular RNA-EcircRNA45 sequence amplification by using the final primer obtained in the step S2 and connecting the sequence to a pBI121 vector to obtain a final expression vector pBI121-EcircRNA 45;

s4, introducing the final expression vector pBI121-EcircRNA45 prepared in the step S3 into competent cells of Agrobacterium tumefaciens GV3101, and performing shake culture to obtain a pBI121-EcircRNA45 overexpression vector bacterial liquid;

s5, introducing the six-leaf stage tomato into the six-leaf stage tomato leaves in an injection mode to obtain pBI121-EcircRNA45 overexpression vector bacterial liquid prepared in the step S4, and further realizing overexpression of tomato late blight resistant exon circular RNA-EcircRNA 45.

Overexpression of tomato late blight resistant exon circular RNA-EcircRNA45 can effectively reduce expression levels of miR477-3p and miR9478-5p, and target genes of miR477-3p and miR9478-5p are plant NBS-LRR disease-resistant genes, so that the reduction of the expression levels of miR477-3p and miR9478-5p can improve the expression levels of the plant NBS-LRR disease-resistant genes, and thus the disease resistance of plants is improved.

The technical innovation of the invention is as follows:

(1) the invention firstly designs a specific circular RNA primer to carry out PCR and a first-generation sequencing experiment to confirm the objective existence of tomato late blight resistant exon circular RNA-EcircRNA 45;

(2) the invention also provides a specific qRT-PCR primer for effectively detecting the tomato late blight resistant exon circular RNA-EcircRNA45, and the existence of false positive is reduced.

(3) By means of the overexpression of the exon circular RNA-EcircRNA45, the tomato late blight resistance gene can be regulated. Specifically, the overexpression of the exon circular RNA-EcircRNA45 can inhibit the expression of miR477-3p and miR9478-5p in a plant body, and target genes of miR477-3p and miR9478-5p are plant NBS-LRR disease-resistant genes, so that the overexpression of the exon circular RNA-EcircRNA45 can indirectly improve the expression amount of resistance genes, and thus the resistance of the plant is improved. In addition, the exon circular RNA-EcircRNA45 is stable in plants, so that genetic regulation is facilitated compared with other linear RNAs.

Drawings

FIG. 1 is a schematic diagram showing the principle of designing two pairs of primers for circRNA in example 1 of the present invention, wherein the direction indicated by the arrow is the direction of primer design.

FIG. 2 shows the result of identifying exon circular RNA-EcircRNA45 in example 1 of the present invention.

FIG. 3 shows the difference in expression characteristics of exon circular RNA-EcircRNA45 in the treatment of late blight bacterium in example 1 of the present invention.

FIG. 4 is an agarose gel electrophoresis image of the product of gradient PCR amplification of exonic circular RNA-EcircRNA45 in example 1 of the present invention.

FIG. 5 is an agarose gel electrophoresis diagram of the double restriction products of the pBI121-EcircRNA45 overexpression vector constructed successfully.

FIG. 6 shows the expression level changes of exon circular RNA-EcircRNA45 at different times in the pBI121-EcircRNA45 transient expression system successfully established in example 1 of the present invention.

FIG. 7 shows the expression level changes of mirmriR 477-3p at different times in the transient expression system pBI121-EcircRNA45 successfully established in example 1 of the present invention.

FIG. 8 shows the expression level changes of miR9478-5p at different times under the treatment of late blight bacteria in the pBI121-EcircRNA45 transient expression system successfully established in example 1 of the present invention.

FIG. 9 shows the leaf lesion area expression of pBI121-EcircRNA45(TG) and pBI121 no-load (CG) transient expression systems successfully established in example 1 of the present invention at different times of late blight bacterium inoculation.

Detailed Description

As mentioned above, the current research on circRNA is very limited, and basically, it is the identification of the bioinformatics and molecular biology aspects of circRNA. The research on circRNA is mainly focused on human and animals at present, and as mentioned above, tomato late blight causes huge economic loss on tomato production, so that the research on circRNA related to late blight has important application significance. In addition, the research on the function of the circRNA is just started at present, and the research on the biological function of the circRNA is beneficial to the subsequent application.

Exemplary embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The description of the exemplary embodiments is for purposes of illustration only and is not intended to limit the invention, its application, or uses.

Example 1

1. Excavation and identification of exon circular RNA-EcircRNA45

1.1 bioinformatics and molecular biology identification of exon circular RNA-EcircRNA45

Deep sequencing of circRNA in tomato fruits: total RNA from leaves of untreated and late blight bacterium-treated wild type tomato (Solanum lycopersicum) varieties (L3708) was extracted using Trizol (Life technologies), and then digested with DNase I (Fermentas) to remove residual genomic DNA. Then, ribosomal RNA was removed using Ribo-Zero Magnetic Kit-plant leaf (Epicentre). Finally, each sample of the circRNA is analyzed to obtain an effective data amount of more than 6G.

Extraction and analysis of circRNA sites: after removing the joint and low-quality data from the deep sequencing data, the reverse splice site information of exon circular RNA-EcircRNA45 is extracted respectively.

1.2 primer design of EcircRNA

Before the circRNA is identified, two pairs of primers need to be designed, and forward primers need to be designed at two ends of a circRNA sequence; the reverse primer needs to be designed across the splice sites, namely, a 3 'end downstream splice site of the circRNA is connected with a 5' end upstream splice site of the circRNA to form a new sequence, and AG and GT sites are respectively arranged at two ends of the 5 'end upstream splice site and the 3' end downstream splice site, and the distance between the AG site and the GT site is not more than 300 bp. The reverse primer of circRNA will be obtained by primer design of the new sequence satisfying the above conditions, and the specific primer design process is shown in FIG. 1.

1.3 identification of exon circular RNA-EcircRNA45

The exon circular RNA-EcircRNA45 was identified in gDNA and cDNA using two primers, respectively, and if the amplification products were obtained in both gDNA and cDNA using the forward primer and only in cDNA using the reverse primer, the circRNA was successfully identified.

As a result: the present inventors identified a part of circRNA through the above-mentioned experiment, thereby proving that circRNA detected by bioinformatics means does exist and that the selection of the hopping site thereof when reverse primer design is performed is also reasonable. The results of identifying exon circular RNA-EcircRNA45 are shown in FIG. 2. Exon circular RNA-EcircRNA45 was specifically PCR amplified using the forward primers SEQ ID NO 2(5 '-3': TTTCCCTTTTGCTCAATCGGTA), SEQ ID NO 3(5 '-3': ATGAAGCCGGGGTCCTCT) and the reverse primers SEQ ID NO 4(5 '-3': TGAACGACTTGGACTAAATGGG), SEQ ID NO 5(5 '-3': AGAAATACAGCAAAAAAGGGTT), and sequenced to show the sequence:

TACAAGTGTTTATGAAGAAGGTGATGCTCGTTCTGCTCTTATTACTATG CTTCAGTCACTTCATCATGCCAAAAATGGTGTAGACATTGTTTCTGGCACG AGAGTTAAGTCACACTTTGCTAAGCCTAATTGGAGAAACGTCTACAAACG CATTGCTCTCAACCACCCAGAGGCTAAAGTTGG*GCATCCATTTTCCATGCA TCCATTTTCCATTACTTCGGCCCCAGGAGATGACTATCTCAGTGTCCATATT AGAACTCTTGGTGATTGGACCAGACAACTTAAAACTGTTTTCTCCGAGGTT TGCCAGCCACCACCTAATGGGAAAAGTGGACTCCTTAGAGCTGACTACTT GCAAGGAGAGAATAATCCTAATTTCCCAAGAGTGTTAATTGATGGACCATA CGGAGCACCAGCACAAGACTACAAGCAGTATGAGGTGGTTTTATTGGTGG GTCTTGGAATTGGAGCTACACCAATGATCAGTATCGTTAAAGACATTGTCA ACAACATGAAGGCCATGGACGAAGAAGAAAATTCCTTGGAAAATGGGCAC GGGATGTCCAATGCAGCACAAAATGCTAGCCCAAATATGGCACAGAAGAG GGGTAAATCAGGTTCAGCAAGTGGAAGAAATAGCTTCAATACAAGGAGGG CATATTTCTATTGGGTCACAAGAGAACAAGGTTCATTTGACTGGTTCAAAG GTATAATGAATGAAGCTGCTGAAATGGATCATAAGGGAGTAATTGAAATGC ACAATTATTG

the sequence denoted herein as SEQ ID NO 1 is a linear version of this sequence, wherein between the positions indicated by the symbol "+" are reverse splice sites, and the exon circular RNA-EcircRNA45 is 768 bases in total.

Analysis of the expression characteristics of circRNA and its silencing miRNA

Due to the existence of the selective cyclization phenomenon, a special real-time quantitative primer of the circRNA needs to be designed across the reverse splice sites to ensure the specificity of amplification, and the rest design concept is the same as that of the common real-time quantitative PCR. In addition, the real-time quantitative primer design concept of miR477-3p and miR9478-5p adsorbed by circRNA is the same as that of common real-time quantitative PCR.

The qRT-PCR primers of exon circular RNA-EcircRNA45(5 '-3': GGTGGTATAGATGATGTGAA, SEQ ID NO: 6; 5 '-3': CCTAAGACTAGCTGAAGA, SEQ ID NO:7), miR477-3p (5 '-3': GGTGGTATAGATGATGTG, SEQ ID NO: 8; 5 '-3': CCTAAGACTAGCTGAATA, SEQ ID NO:9) and miR9478-5p (5 '-3': GCTATGCTAGTAGTCTGTAGAAT, SEQ ID NO: 10; 5 '-3': GTCTTATATTACGTTGAAT, SEQ ID NO:11) obtained from this design concept were used in subsequent experiments.

Analysis of expression characteristics: extracting total RNA of wild tomato (L3708) leaves treated by late blight bacteria, removing genome DNA residues, performing reverse transcription of the RNA into cDNA by using Random Hexamer Primer (Fermentas), and analyzing relative expression of exon circular RNA-EcircRNA45 and miRNA adsorbed by the exon circular RNA-EcircRNA45 by using qRT-PCR (SYBR Green), wherein the primers used in the real-time PCR are as described above.

As a result: the results of the analysis of the expression characteristics of exonic circular RNA-EcircRNA45 and its adsorbed miRNA in each treatment period are shown in FIG. 3. As can be seen from the figure, the expression trend of exon circular RNA-EcircRNA45 is opposite to that of miR9478-5p and miR477-3p adsorbed by the exon circular RNA-EcircRNA 45.

Construction of overexpression vector of circRNA and establishment of transient infection system

3.1 cloning vector construction of exon circular RNA-EcircRNA45

The sequence of SEQ ID NO.1 was extended at both ends to the next AG/GT, i.e., by the artificial addition of reverse splice sites mediating cyclization, and then primer design was performed on the new sequence. Then adding Bam H I enzyme cutting sites and Sac I enzyme cutting sites and protective bases at two ends of the primer respectively to obtain a final primer:

exon circular RNA-EcircRNA 45:

upstream primers (5 '-3'): CGGGATCCCTTCAAGTCCCAA (SEQ ID NO: 12);

the downstream primer (5 '-3') CGAGCTCTAATTCATCTTCCC (SEQ ID NO: 13).

As a result: the results of electrophoresis of the PCR products of exon circular RNA-EcircRNA45 are shown in FIG. 4, indicating that these two sequences were successfully cloned. Then, the cloning sequences of the exon circular RNA-EcircRNA45 are respectively connected to a pMD19-T (simple) vector, the sequencing feedback result shows that the base sequence shown in the sequence 1 exists, and the plasmid with correct sequencing is named as pMD19-T-EcircRNA 45.

3.2 construction of pBI-circRNA vector

pMD19-T-EcircRNA45 from step 3.1 was used for subsequent experiments with Bam H I and Sac I restriction endonucleasesEnzyme cutting, wherein the enzyme cutting system is as follows: plasmid 10ul, 10 Xdigestion buffer 1ul, Sac I1 ul (10U/ul), Bam H I1 ul (10U/ul), plus ddH₂O replenishes the reaction system to 20ul, and the enzyme is cleaved at 37 ℃ for 12 hours. The cleavage products were separated by agarose gel electrophoresis, and the exon circular RNA-EcircRNA45 small fragment was recovered.

Meanwhile, the plasmid pBI121 is subjected to double enzyme digestion by using restriction enzymes Sac I and Bam H I, wherein the enzyme digestion system is as follows: plasmid 15ul, 10 Xdigestion buffer 1ul, Sac I1 ul (10U/ul), Bam H I1 ul (10U/ul), add ddH2O to supplement the reaction system to 20ul, and digest overnight at 37 ℃. Separating the enzyme digestion products by agarose gel electrophoresis, then recovering pBI121 large fragment by DNA gel recovery kit of Dalibao biology company, dissolving in 30ul ddH₂And (4) in O.

6ul of the recovered small fragment solution, 2ul of the recovered pBI121 large fragment, 1ul (350U/ul) of T4 ligase, 2ul of 10 Xligation buffer, and ddH₂And (3) supplementing the reaction system to 20ul, connecting overnight at 16 ℃, transforming the obtained connecting product into escherichia coli DH5 alpha competent cells, screening by using a resistance plate to obtain positive clones, extracting recombinant plasmids in the positive clones, and performing sequencing verification.

As a result: as can be seen from the agarose gel electrophoresis chart of the double digestion product of FIG. 5, the pBI121-EcircRNA45 overexpression vector was successfully constructed.

3.3 establishment of transient infection System and related assays

Single colonies of pBI121-EcircRNA45 Agrobacterium tumefaciens were picked up to 5ml of YEB liquid medium (containing 100mg/l rifampicin and 50mg/l kanamycin), respectively, and cultured overnight at 28 ℃ with shaking at 180 rpm. 1ml of the above-mentioned bacterial suspension was aspirated into 100ml of YEB liquid medium (containing 100mg/l rifampicin, 50mg/l kanamycin, 10mmol/l morpholinoethanesulfonic acid monohydrate, 20. mu. mol/l acetosyringone and 2mmol/l magnesium sulfate, pH 5.6), and cultured overnight at 28 ℃ under shaking at 180 rpm. Then, the cells were centrifuged at 4000r/min at 4 ℃ for 10min to collect Agrobacterium tumefaciens cells, which were resuspended in MMA suspension (containing 10mmol/l of morpholinoethanesulfonic acid monohydrate, 20. mu. mol/l of acetosyringone and 10mmol/l of magnesium chloride, pH 5.6) and OD was adjusted to 1.0, followed by shaking culture at 25 ℃ and 180rpm for 3 hours or more.

Before transformation, placing the six-leaf stage tomatoes under a low-light condition, polishing the surface of the back of the leaf by using fine sand paper, enabling the bacterial liquid to permeate the leaf, taking the over-expressed leaf after 4d, and spraying the treated living body of the late blight bacterial liquid on the treated tomato leaf to reach a state under the condition of dripping. Taking the leaf blade detection related indexes of 0h, 12h, 24h, 36h, 48h, 72h and 96h after treatment.

As a result: FIG. 6 shows that exon circular RNA-EcircRNA45 is highly expressed at different periods of tomato leaf after transient infection compared with the control group, i.e. 0h of late blight pathogen treatment, which indicates that the inventors successfully constructed pBI121-EcircRNA45 overexpression vector and successfully overexpressed circRNA in tomato, and from FIG. 7 and FIG. 8, it can be seen that the expression levels of miR9478-5p and miR477-3p are in a descending trend, indicating that exon circular RNA-EcircRNA45 is likely to act by adsorbing miRNA. Fig. 9 shows that tomato leaf lesion area is significantly improved, and overexpression of exon circular RNA-EcircRNA45 significantly reduces plant pathogenicity compared to control group.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be able to cover the technical solutions and the inventive concepts of the present invention within the technical scope of the present invention.

Sequence listing

<110> university of Large Community

<120> tomato late blight-resistant exon circular RNA-EcircRNA45 and cloning, detection and application methods thereof

<130> 2018

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 768

<212> DNA

<213> Solanum lycopersicum

<400> 1

tacaagtgtt tatgaagaag gtgatgctcg ttctgctctt attactatgc ttcagtcact 60

tcatcatgcc aaaaatggtg tagacattgt ttctggcacg agagttaagt cacactttgc 120

taagcctaat tggagaaacg tctacaaacg cattgctctc aaccacccag aggctaaagt 180

tgggcatcca ttttccatgc atccattttc cattacttcg gccccaggag atgactatct 240

cagtgtccat attagaactc ttggtgattg gaccagacaa cttaaaactg ttttctccga 300

ggtttgccag ccaccaccta atgggaaaag tggactcctt agagctgact acttgcaagg 360

agagaataat cctaatttcc caagagtgtt aattgatgga ccatacggag caccagcaca 420

agactacaag cagtatgagg tggttttatt ggtgggtctt ggaattggag ctacaccaat 480

gatcagtatc gttaaagaca ttgtcaacaa catgaaggcc atggacgaag aagaaaattc 540

cttggaaaat gggcacggga tgtccaatgc agcacaaaat gctagcccaa atatggcaca 600

gaagaggggt aaatcaggtt cagcaagtgg aagaaatagc ttcaatacaa ggagggcata 660

tttctattgg gtcacaagag aacaaggttc atttgactgg ttcaaaggta taatgaatga 720

agctgctgaa atggatcata agggagtaat tgaaatgcac aattattg 768

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 2

tttccctttt gctcaatcgg ta 22

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 3

atgaagccgg ggtcctct 18

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 4

tgaacgactt ggactaaatg gg 22

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 5

agaaatacag caaaaaaggg tt 22

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 6

ggtggtatag atgatgtgaa 20

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 7

cctaagacta gctgaaga 18

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 8

atgctacgag ctagctagt 19

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 9

gctgactagt cgtaatagtc g 21

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 10

gctatgctag tagtctgtag aat 23

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 11

gtcttatatt acgttgaat 19

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 12

cgggatccct tcaagtccca a 21

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (Synthetic sequence)

<400> 13

cgagctctaa ttcatcttcc c 21

Claims (5)

1. A tomato late blight resistant exon circular RNA-EcircRNA45 is characterized in that the sequence is shown as SEQ ID NO. 1.

2. The cloning method of tomato late blight exon-EcircRNA 45 as claimed in claim 1, wherein EcircRNA45-C-FP, EcircRNA45-C-RP, EcircRNA45-D-FP and EcircRNA45-D-RP are used as specific primers, wherein the DNA sequences shown by EcircRNA45-C-FP and EcircRNA45-C-RP constitute a forward primer pair, and the DNA sequences shown by EcircRNA45-D-FP and EcircRNA45-D-RP constitute a reverse primer pair;

the sequences of the specific primers EcircRNA45-C-FP, EcircRNA45-C-RP, EcircRNA45-D-FP and EcircRNA45-D-RP are respectively shown as SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

3. The cloning method of the tomato late blight exon circular RNA-EcircRNA45 as claimed in claim 2, wherein the tomato late blight exon circular RNA-EcircRNA45 can be obtained by performing PCR amplification with the gDNA and cDNA of tomato L3708 as templates and with EcircRNA45-C-FP, EcircRNA45-C-RP, EcircRNA45-D-FP and EcircRNA45-D-RP as specific primers.

4. The method for detecting the expression quantity of the tomato late blight-resistant exon circular RNA-EcircRNA45 as claimed in claim 1, wherein qRT-PCR primers are designed at two ends of the reverse splice site of the tomato late blight-resistant exon circular RNA-EcircRNA45, and the designed primers are qRT-EcircRNA45-FP and qRT-EcircRNA45-RP respectively;

the designed primer qRT-EcircRNA45-FP and qRT-EcircRNA45-RP sequences are respectively shown as SEQ ID NO. 6 and SEQ ID NO. 7.

5. The method for applying the tomato late blight-resistant exon circular RNA-EcircRNA45 in claim 1 is characterized by comprising the following steps of:

s1, extending two ends of a tomato late blight resistant exon circular RNA-EcircRNA45 sequence, and finally introducing reverse splicing sites at the upstream and downstream of the sequence;

s2, designing a primer according to the new sequence, and adding Bam H I and Sac I enzyme cutting sites and protective bases at two ends of the primer respectively to obtain a final primer, wherein the final primer is EcircRNA45-FP and EcircRNA 45-RP;

the sequence of EcircRNA45-FP is shown as SEQ ID NO. 12, and the sequence of EcircRNA45-RP is shown as SEQ ID NO. 13;

s3, carrying out tomato late blight resistant exon circular RNA-EcircRNA45 sequence amplification by using the final primer obtained in the step S2 and connecting the sequence to a pBI121 vector to obtain a final expression vector pBI121-EcircRNA 45;

s4, introducing the final expression vector pBI121-EcircRNA45 prepared in the step S3 into competent cells of Agrobacterium tumefaciens GV3101, and performing shake culture to obtain a pBI121-EcircRNA45 overexpression vector bacterial liquid;

s5, introducing the six-leaf stage tomato into the six-leaf stage tomato leaves in an injection mode to obtain pBI121-EcircRNA45 overexpression vector bacterial liquid prepared in the step S4, and further realizing overexpression of tomato late blight resistant exon circular RNA-EcircRNA 45.

Images