CN103898238A - Plasmid standard molecule for hepatitis a virus quantitative detection - Google Patents

Plasmid standard molecule for hepatitis a virus quantitative detection Download PDF

Info

Publication number
CN103898238A
CN103898238A CN201410037809.1A CN201410037809A CN103898238A CN 103898238 A CN103898238 A CN 103898238A CN 201410037809 A CN201410037809 A CN 201410037809A CN 103898238 A CN103898238 A CN 103898238A
Authority
CN
China
Prior art keywords
hepatitis
virus
hav
detection
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410037809.1A
Other languages
Chinese (zh)
Inventor
隋志伟
乔煜婷
傅博强
张玲
王晶
刘瑛颖
董莲华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Institute of Metrology
Original Assignee
National Institute of Metrology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Institute of Metrology filed Critical National Institute of Metrology
Priority to CN201410037809.1A priority Critical patent/CN103898238A/en
Publication of CN103898238A publication Critical patent/CN103898238A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/706—Specific hybridization probes for hepatitis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a plasmid standard molecule for hepatitis a virus quantitative detection. The plasmid standard molecule contains a sequence as shown in SEQ ID NO: 1, wherein the sequence contains a 247bp conserved domain gene segment for coding VP1-VP3 capsid proteins in a hepatitis a virus genome; and the 247bp conserved domain gene segment is applied to specific and quantitative detection of the hepatitis a virus and a sample containing the hepatitis a virus. Real-time fluorescent quantitative PCR (polymerase chain reaction) amplification experiment proves that the plasmid standard molecule provided by the invention can substitute hepatitis a virus genome as a positive standard substance for hepatitis a virus nucleic acid quantitative detection; and the standard substance does not need any treatment, only needs to be used with a to-be-detected sample in a detection process, so that content of the hepatitis a virus in the to-be-detected sample can be provided.

Description

A kind of hepatitis A virus (HAV) detection by quantitative plasmid control molecule
Technical field
The invention belongs to bioanalysis test, clinical medical inspection and environmental monitoring technology field, be specifically related to a kind of hepatitis A virus (HAV) detection by quantitative plasmid control molecule.
Background technology
Hepatitis A virus (Hepatitis A virus, HAV) infection can cause acute viral hepatitis, it is a kind of important food source property enterovirus, be under the jurisdiction of Picornaviridae hepatovirus, virion, without cyst membrane, is icosahedron symmetrical structure, and diameter is 27nm-32nm, wherein comprise a positive chain RNA genome, length is about 7.5kb.Hepatitis A virus is mainly broadcast by excrement oral instructions, and taking in the food and the water that are polluted by hepatitis A virus (HAV) is the main reason that causes hepatitis A to propagate.
Hepatitis A virus extensively exists in food and environment, though be difficult for causing chronic infection, often can cause outbreak of epidemic, causes heavy losses to the country and people's lives and properties.Food before results, after results, each stage from farm to dining table all may be polluted by hepatitis A virus (HAV).Relating to the modal food that hepatitis A breaks out is mainly fresh agricultural products and instant food, and these all do not pass through heat treatment step before edible.2005, there is hepatitis A virus (HAV) infection accident in a Pennsylvanian dining room, is due to the edible shallot being polluted by hepatitis A virus (HAV), causes people more than 600 ill, wherein 3 people's death.In addition, along with environmental pollution is more and more serious, propagating by water body the pathogenicity bo disease causing has become one of problem that in world wide, people pay close attention to.At present, many countries comprise that China all adopts fecal pollution indicator for example excrement colibacillus group, total coli group, faecalis to evaluate the pollution situation of water body, and the viral detection of paddling are not included.But research is found, obviously relevant (Tree of nothing between bacteria levels and virus concentration in water surrounding, Adams et al.2003), and some virus to external world resistibility of environment and disinfection is stronger, the use of bacterium instruction is not enough to the pollution situation of processed water quality or water body to detect or evaluate, and virus still can be detected in the time meeting water body bacterium Hygienic Standard.In China, popular the happening occasionally of hepatitis A of causing because of water pollution.1988, Shanghai was broken out largest hepatitis A in a medical history and has been very popular, and was ediblely to be caused by the blood clam cultivating in hepatitis A virus (HAV) polluted-water.2003, Dianjiang County, Chongqing City long queue chief of township village school of a specified duration was learned and is occurred hepatitis A epidemic situation, and 53 students are diagnosed as hepatitis A patient, and the reason of hepatitis A outburst is that student drinks the water source being polluted by hepatitis A virus (HAV).2008 there are 2 hepatitis A epidemic situations in Guangxi in succession, cause approximately 200 students infected, and through disease control officer investigation, the drinking water source that causes the reason Dou Shi school of epidemic situation has been subject to pollution.Food and water surrounding and people's life, produce closely relatedly, therefore the detection of hepatitis A virus (HAV) and the research of tracing to the source are very important, should cause the great attention of educational circles and relevant department.
Directly virus is detected more reliable hepatitis A virus (HAV) polluted information can be provided, further guarantee food and water safe.But, not yet formulate both at home and abroad so far the detection method of unified feasible hepatitis A virus (HAV), and not yet report for the standard plasmid that hepatitis A virus (HAV) is carried out detection by quantitative.Therefore the plasmid control molecule, building for hepatitis A virus (HAV) being carried out to specificity detection by quantitative is badly in need of very much.
Summary of the invention
The object of the invention is to build a plasmid control molecule that is applied to hepatitis A virus (HAV) specificity detection by quantitative, in the time utilizing real time fluorescence quantifying PCR method to carry out specificity detection by quantitative to hepatitis A virus (HAV), this hepatitis A virus (HAV) plasmid control molecule is used as positive criteria product.
The present invention solves its technical problem and adopts following technical scheme:
Hepatitis A virus (HAV) specificity detection by quantitative plasmid control molecule provided by the invention, it contains sequence shown in SEQ ID NO:1, the 247bp conservative region gene fragment that this sequence contains the VP1-VP3 capsid protein of encoding in hepatitis A virus gene group.
Described SEQ ID NO:1 fragment is implemented in pGEM-T(promega) on carrier.
Described SEQ ID NO:1 fragment forms primer pair by SEQ ID NO:2 and SEQ ID NO:3, and hepatitis A virus (HAV) is carried out to specific amplification, obtains 247bp amplicon.
According to described SEQ ID NO:1 fragment design SEQ ID NO:4 and SEQ ID NO:5 composition primer pair, 112bp gene fragment in the 247bp conservative region gene fragment of VP1-VP3 capsid protein in hepatitis A virus gene group is carried out to specific detection.
Above-mentioned hepatitis A virus (HAV) specificity detection by quantitative plasmid control molecule provided by the invention, in its specificity and detection by quantitative that is applied to hepatitis A virus (HAV) and contains this viral sample.
This hepatitis A virus (HAV) specificity detection by quantitative substitutes hepatitis A virus gene group with plasmid control molecule, as the positive criteria product of hepatitis A virus (HAV) specificity detection by quantitative.
The present invention compared with prior art mainly contains following effect:
The invention provides the hepatitis A virus (HAV) plasmid control molecule that value can be traced to the source, not only can detection by quantitative hepatitis A virus (HAV), and can improve accuracy, the reliability of detection.Plasmid control molecule of the present invention, without carrying out any processing, only need to use in testing process together with testing sample, can provide the content of hepatitis A virus (HAV) in testing sample.
Brief description of the drawings
Fig. 1 is the 247bp fragment amplification electrophoresis result of hepatitis A virus (HAV) VP1-VP3 conservative region, and wherein left side band 1 and 2 is hepatitis A virus (HAV) 247bp fragment, and 3 is DL2000DNA maker, 4 negative contrasts;
Fig. 2 is that hepatitis A virus (HAV) specificity detection by quantitative plasmid control molecule builds physical map, and in figure, VP1-VP3 mark represents the 247bp conservative region gene fragment of VP1-VP3 capsid protein in hepatitis A virus gene group;
Fig. 3 is the fluorescent quantitative PCR graphic representation of hepatitis A virus (HAV) plasmid control molecule specificity checking, and wherein, HAV is hepatitis A virus (HAV), and HIV is virus of AIDS, and AIV is influenza virus, and HCV is hepatitis C virus;
Fig. 4 is the substituting test-results of hepatitis A virus (HAV) specific gene typical curve; In figure, X-coordinate is the logarithm of the initial copy number of template (concentration), and ordinate zou is the real-time fluorescence quantitative PCR cycle index that threshold value is that increases, i.e. Ct value.
Embodiment:
Below in conjunction with embodiment and accompanying drawing, the invention will be further described, but do not limit the present invention.
Embodiment 1: standard molecule builds
1. target gene sequence is searched and design of primers:
By consulting the related data of hepatitis A virus (HAV), choose 247bp mono-copy conservative region (SEQ ID NO:1) of the VP1-VP3 capsid protein of encoding in hepatitis A virus gene group as the specificity target fragment of hepatitis A virus (HAV) plasmid control molecule.
According to the pertinent literature (Brooks that consults hepatitis A virus (HAV), Gersberg et al.2005), encode in the design amplification hepatitis A virus gene group primer pair (synthetic by Shanghai Ying Weijie base Bioisystech Co., Ltd) of 247bp conservative region gene fragment of VP1-VP3 capsid protein, sequence is shown in SEQ ID NO:2, SEQ ID NO:3(table 1).
2. the amplification standard molecule of target dna fragment builds:
Extract viral RNA: in the EP pipe that hepatitis A virus (HAV) is housed, add Trizol and chloroform (volume ratio that each composition adds is: virus liquid: Trizol: chloroform=1: 2: 1), shake 30 seconds, leaving standstill after 5min 12000r/min, 4 DEG C of centrifugal 15min on ice; Gentle aspiration upper strata water, is placed in new EP pipe, and remaining part abandons.In the EP of splendid attire aqueous phase liquid pipe, add isopyknic Virahol and 1 μ L Glyco Blue Coprecip (Invitrogen), after mixing, in-20 DEG C of refrigerators, place after 2min, 12000r/min, 4 DEG C of centrifugal 10min; Abandoning supernatant, 200ml75% ethanol (Rnase-free water preparation) washing for precipitation, 12000r/min, 4 DEG C of centrifugal 10min; Abandoning supernatant again, allow precipitation at room temperature seasoning of RNA; With 20 μ L Rnase-free water dissolving RNA.
The system of reverse transcription and condition are: the RNA template(of 125ng supplies 12 μ L with Rnase-free water), the Random hexamer primer(20 μ M of 0.5 μ L), the Oligo(dt of 0.5 μ L) (20 μ M).After mixing, reaction tubes is placed in to PCR instrument, 70 DEG C, after 5min, ice bath 5min at once, continues to add in reaction tubes: the dNTP mix(2.5mM of 5 × reaction buffer (Promega) of 5 μ L, the Ribolockribo nuclease inhibitor of 1 μ L (20U/ μ L, TaKaRa), 5 μ L, TaKaRa), the M-MLV Reverse transcriptase of 1 μ L (200U/ μ L, Promega).Mix, be placed in PCR instrument, 42 DEG C, 60min; 95 DEG C, 5min, after having reacted is placed in product-20 DEG C and stores for future use.
According to table 1 primer, taking hepatitis A virus gene group cDNA as template, VP1-VP3 conservative region SEQ ID NO:1 gene fragment is carried out to pcr amplification subsequently, the band that amplification is obtained reclaims purifying, with agarose gel electrophoresis checking, sees Fig. 1.
The SEQ ID NO:1 fragment that recovery is obtained is connected into pGEM-T carrier, obtains plasmid control molecule, and physical map is shown in Fig. 2.
3. the purifying of plasmid control molecule:
The plasmid that structure obtains enters in intestinal bacteria recipient bacterium through transforming, and culture presevation is at-70 DEG C of refrigerators, taking carrier amicillin resistance as selection markers.A large amount of preparations of plasmid are started by the bacterial classification of preservation, first make rejuvenation of spawn, draw dull and stereotyped picking mono-clonal bacterium colony and cultivate in a large number in LB liquid nutrient medium, then adopt plasmid extraction kit PureYield tMplasmid Midiprep System (Promega company) extracts and purifying.
Embodiment 2: specificity checking and substitutability research
1. the specificity of hepatitis A virus (HAV) checking:
For the specificity of validation criteria molecule, adopt different virus to detect primer and respectively plasmid molecule is increased.
Three kinds of viruses choosing commercialization or experiment use, comprising: the specific detection primer of virus of AIDS, influenza virus, hepatitis C virus increases to plasmid molecule, and result is as Fig. 3.
As seen from the figure, only have hepatitis A virus (HAV) to detect primer and can carry out specific amplification, positive;
And the detected result of other viral primer does not have amplification curve, identical with blank.
Prove that thus hepatitis A virus (HAV) VP1-VP3 conservative region fragment gene is good for other primer specificity, therefore plasmid molecule has detection specificity.
2. real-time fluorescence quantitative PCR design of primers, system and program:
Choose gene fragment that in the conservative region of the VP1-VP3 capsid protein of encoding in hepatitis A virus gene group, a segment length is 112bp as specific detection fragment.According to target gene fragment sequence (SEQ ID NO:1), with Beacon Designer7 software design SYBR Green real-time PCR primer (synthetic by Shanghai Ying Weijie base Bioisystech Co., Ltd), sequence is shown in SEQ ID NO:4, SEQ ID NO:5(table 2).Real-time fluorescence quantitative PCR amplification adopts Bio-Rad CFX Manager instrument, pcr amplification reaction system: cDNA template 1 μ L, the each 0.5 μ L of the forward and reverse primer of 20 μ M hepatitis A virus (HAV), 2 × SsoFast EvaGreen Supermix(Bio-Rad) 10 μ L, supply 20 μ L with ddH2O.Reaction conditions: 95 DEG C of 3min, with 95 DEG C of 10s, 40 circulations of 55 DEG C of 30s amplifications.
3. plasmid control molecule and genomic alternative research:
Respectively hepatitis A virus (HAV) plasmid control molecule and hepatitis A virus gene group are carried out to serial dilution as template, by Real-Time Fluorescent Quantitative PCR Technique drawing standard curve, to determine whether plasmid control molecule can substitute genome in detection by quantitative process.Carry out fluorescent quantitative PCR taking the plasmid control molecule of serial dilution and genome as template and obtain typical curve and see Fig. 4, result shows that plasmid control molecule can substitute genome.T assay slope and intercept does not have significant difference in 95% confidence level.
Result shows, plasmid control molecule and genome typical curve are substituting good, prove that the alternative genome of this plasmid molecule is for hepatitis A virus (HAV) detection by quantitative.
Embodiment 3: the definite value result of plasmid control molecule
The definite value mode of plasmid control molecule: definite value result of the present invention show that by the methods analyst of digital pcr the asserting value of plasmid control molecule is 1.24 × 10 11copy number.Through Evaluation of Uncertainty, the expanded uncertainty of this plasmid molecule reference material (U) is 1.4 × 10 10.
This plasmid control molecule definite value result draws its asserting value, i.e. copy number by the methods analyst of digital pcr.
Asserting value is to have split hair caccuracy, all known or suspicious bias sources all through abundant research or consider.The asserting value of plasmid molecule obtains by digital pcr analysis, and result shows that the asserting value of this plasmid control molecule is 1.24 × 10 11copy, relative standard deviation RSD(or variation coefficient CV) be 0.054.In table 3.
The present invention, for hepatitis A virus (HAV) plasmid control molecule provides asserting value, can, using this plasmid control molecule as reference material, detect its asserting value result for actual quantification.
Subordinate list
Table 1 hepatitis A virus (HAV) VP1-VP3 conservative region gene fragment primer sequence
Figure DEST_PATH_GDA0000485127250000041
Table 2 hepatitis A virus (HAV) VP1-VP3 capsid protein fluorescence quantification PCR primer sequence
Figure DEST_PATH_GDA0000485127250000051
Table 3 asserting value result
Figure DEST_PATH_GDA0000485127250000052
<110> China National Measuring Science Research Inst.
<120> hepatitis A virus (HAV) detection by quantitative plasmid control molecule
<140>
<141>
<160> 1
<170>
<210> 1
<211> 26
<212> DNA
<213> artificial sequence (SEQ ID NO:2-F)
<220>
<221>
<222>
<223>
<400> 1
GTTTTGCTCCTCTTTATCATGCTATG
<210> 2
<211> 25
<212> DNA
<213> artificial sequence (SEQ ID NO:3-R)
<220>
<221>
<222>
<223>
<400> 2
GGAAATGTCTCAGGTACTTTCTTTG
<210> 3
<211> 18
<212> DNA
<213> artificial sequence (SEQ ID NO:4-F)
<220>
<221>
<222>
<223>
<400> 3
TGCTATGGATGTTACTAC
<210> 4
<211> 20
<212> DNA
<213> artificial sequence (SEQ ID NO:5-R)
<220>
<221>
<222>
<223>
<400> 4
ATCTTTCATGGTTGTTATAC

Claims (6)

1. a hepatitis A virus (HAV) detection by quantitative plasmid control molecule, is characterized in that containing sequence shown in SEQ ID NO:1, the 247bp conservative region gene fragment that this sequence contains the VP1-VP3 capsid protein of encoding in hepatitis A virus gene group.
2. hepatitis A virus (HAV) detection by quantitative plasmid control molecule as claimed in claim 1, is characterized in that described SEQ ID NO:1 fragment to be implemented on pGEM-T carrier.
3. hepatitis A virus (HAV) detection by quantitative plasmid control molecule as claimed in claim 2, it is characterized in that the primer pair that described SEQ ID NO:1 fragment is made up of SEQ ID NO:2 and SEQ ID NO:3, hepatitis A virus (HAV) is carried out to specific amplification, obtain the amplicon of 247bp.
4. hepatitis A virus (HAV) detection by quantitative plasmid control molecule as claimed in claim 2, it is characterized in that, according to described SEQ ID NO:1 gene fragment order design SEQ ID NO:4 and the primer pair of SEQ ID NO:5 composition, 112bp gene fragment in the 247bp conservative region gene fragment of VP1-VP3 capsid protein in hepatitis A virus gene group being carried out to specific detection.
5. the purposes of plasmid control molecule for hepatitis A virus (HAV) detection by quantitative described in arbitrary claim in claim 1 to 4, in the specificity and detection by quantitative that it is characterized in that being applied to hepatitis A virus (HAV) and contain this viral sample.
6. purposes as claimed in claim 5, is characterized in that substituting hepatitis A virus gene group, as the positive criteria product of hepatitis A virus (HAV) specificity detection by quantitative.
CN201410037809.1A 2014-01-26 2014-01-26 Plasmid standard molecule for hepatitis a virus quantitative detection Pending CN103898238A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410037809.1A CN103898238A (en) 2014-01-26 2014-01-26 Plasmid standard molecule for hepatitis a virus quantitative detection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410037809.1A CN103898238A (en) 2014-01-26 2014-01-26 Plasmid standard molecule for hepatitis a virus quantitative detection

Publications (1)

Publication Number Publication Date
CN103898238A true CN103898238A (en) 2014-07-02

Family

ID=50989803

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410037809.1A Pending CN103898238A (en) 2014-01-26 2014-01-26 Plasmid standard molecule for hepatitis a virus quantitative detection

Country Status (1)

Country Link
CN (1) CN103898238A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110487923A (en) * 2019-03-22 2019-11-22 中国计量科学研究院 A kind of detection method based on linear plasmid DNA content associated with molecular-exclusion chromatography-inductivity coupled plasma mass spectrometry

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991011534A1 (en) * 1990-01-24 1991-08-08 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce A rapid and sensitive test for detecting hepatitis a virus
CN101892326A (en) * 2010-07-19 2010-11-24 复旦大学 Method for preparing standard substance suitable for virus PCR detection
CN102367490A (en) * 2008-12-12 2012-03-07 深圳华大基因科技有限公司 Method for detecting viruses

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991011534A1 (en) * 1990-01-24 1991-08-08 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce A rapid and sensitive test for detecting hepatitis a virus
CN102367490A (en) * 2008-12-12 2012-03-07 深圳华大基因科技有限公司 Method for detecting viruses
CN101892326A (en) * 2010-07-19 2010-11-24 复旦大学 Method for preparing standard substance suitable for virus PCR detection

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DALE W. GRIFFIN,ET AL: "Pathogenic Human Viruses in Coastal Waters", 《CLINICAL MICROBIOLOGY REVIEWS》, vol. 16, no. 1, 31 December 2003 (2003-12-31), pages 129 - 143 *
常平等: "用多聚酶链反应检测环境样品中甲型肝炎病毒RNA的实验研究", 《卫生研究》, vol. 26, no. 1, 31 December 1997 (1997-12-31), pages 33 - 36 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110487923A (en) * 2019-03-22 2019-11-22 中国计量科学研究院 A kind of detection method based on linear plasmid DNA content associated with molecular-exclusion chromatography-inductivity coupled plasma mass spectrometry

Similar Documents

Publication Publication Date Title
Pyrc et al. Identification of new human coronaviruses
Bourgarel et al. Circulation of Alphacoronavirus, Betacoronavirus and Paramyxovirus in Hipposideros bat species in Zimbabwe
Bakhshesh et al. Bovine ephemeral fever in Iran: Diagnosis, isolation and molecular characterization
Cecchinato et al. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B
Zhao et al. Detection of astrovirus infection in pigeons (Columbia livia) during an outbreak of diarrhoea
Andrés et al. A year living with SARS-CoV-2: an epidemiological overview of viral lineage circulation by whole-genome sequencing in Barcelona city (Catalonia, Spain)
Elia et al. Identification and genetic characterization of equine hepaciviruses in Italy
Desdouits et al. Use of human intestinal enteroids to evaluate persistence of infectious human norovirus in seawater
CN104328222A (en) Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit
Saïd et al. Molecular characterisation of hepatitis A virus strains from water sources in South Africa
CN104513857A (en) Loop-mediated isothermal amplification detection primer group, detection method and kit of vibrio parahaemolyticus
Listorti et al. Rapid detection of subtype B avian metapneumoviruses using RT-PCR restriction endonuclease digestion indicates field circulation of vaccine-derived viruses in older turkeys
CN103333903A (en) Target sequence, primer and probe for detecting helicobacter pylori and kit thereof
CN103173568B (en) Primer group, kit and method for rapidly identifying 1 type dengue fever virus
CN113846185A (en) Primer composition and kit for rapid detection of new coronavirus E484K/Q, K417N/T variation
CN104561383A (en) Influenza A virus and B virus joint detection primer, probe, kit and application
CN103898238A (en) Plasmid standard molecule for hepatitis a virus quantitative detection
Zhang et al. Simultaneous detection of enteroviruses from surface waters by real-time RT-PCR with universal primers
CN102888469A (en) Method for detecting content of human enteroviruses and non-human enteroviruses in environmental water
Chalmers et al. A method to detect Escherichia coli carrying the colistin-resistance genes mcr-1 and mcr-2 using a single real-time polymerase chain reaction and its application to chicken cecal and porcine fecal samples
CN113249503B (en) LAMP primer group and method for detecting haemolytic mannheimia
CN103805716A (en) Quantitative detection kit of hepatitis A virus
CN103602727A (en) Detection primer set, detection kit and detection method for rapidly detecting Ralstonia solanacearum
Miura et al. Temporal variations of human and animal Rotavirus A genotypes in surface water used for drinking water production
CN109628643B (en) Rapid detection method for H5 subtype avian influenza virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20140702