CN101892326A - Method for preparing standard substance suitable for virus PCR detection - Google Patents
Method for preparing standard substance suitable for virus PCR detection Download PDFInfo
- Publication number
- CN101892326A CN101892326A CN 201010229583 CN201010229583A CN101892326A CN 101892326 A CN101892326 A CN 101892326A CN 201010229583 CN201010229583 CN 201010229583 CN 201010229583 A CN201010229583 A CN 201010229583A CN 101892326 A CN101892326 A CN 101892326A
- Authority
- CN
- China
- Prior art keywords
- primer
- virus
- seq
- standard substance
- viral
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biological detection, in particular relates to a method for preparing a standard substance suitable for virus PCR detection. The method comprises the following steps of: screening and multiplying Escherichia coli primers of a segment in a specific length; designing merged primers comprising virus-specific primers and the Escherichia coli primers; multiplying an Escherichia coli genome by using the merged primers; and constructing quantitative standard substance plasmids comprising the virus-specific primers, wherein viruses of the constructed standard substance plasmids comprise enteric viruses, hepatitis A viruses, hand-foot-and-mouth viruses, Norwalk virus, rotaviruses, human astroviruses, hepatitis E viruses and the like. The method for preparing the standard substance suitable for the virus PCR detection has the advantages of capacity of avoiding the process of constructing related virus standard substance by using various virus strains, reducing the potential risk in the preparation process, and quickly and simultaneously preparing the standard substance comprising different virus plasmids. The method can be applied to the detection of causative viruses and other pathogens in a water body.
Description
Technical field
The invention belongs to technical field of biological, be specifically related to a kind of preparation method who is used for the standard substance of viral detection by quantitative.
Background technology
The virus that fecal-oral route is propagated can enter in the environment by the ight soil that organism is discharged, and again by tap water and food transmission infection host, mainly causes gastroenteritis and relevant complication.In recent years, infection and the large-scale outbreak of this viroid take place again and again, and the detection and the control of the virus that fecal-oral route is propagated have become the research emphasis in public health field.The main viral monoid relevant with water pollution comprises: Pironavirus section, Caliciviridae, Adenoviridae, Reoviridae, viral hepatitis type E Viraceae etc.They can cause chronic enteritis, hepatitis, even can cause serious diseases such as meningitis.
Traditional method for detecting virus comprises cell cultures and virus antigen-antibody response, yet the sense cycle of these two kinds of methods is long, complex steps, and sensitivity is on the low side, occurs false positive or false negative sometimes easily.From early 1990s, PCR method becomes the main means that virus detects in the environmental sample, and it is simple to have the sample preparation step, and sense cycle is short, the advantage of high specificity.PCR can detect the sample with certain virus concentration exactly, as soil, and ight soil, sewage.But for tap water or the very low sample of this viroid content of tap water, the sensitivity of PCR still has much room for improvement.
The virus of conventional PCR result in can only the qualitatively analyze sample still can not satisfy the requirement of Causative virus in the environment being carried out Quantitative Monitoring.In recent years, more and more researchers began to use real-time fluorescence quantitative PCR detection method.The viral level of quantitative PCR in can the quantitative analysis sample compared regular-PCR and had higher sensitivity and specificity, thereby reached the requirement of real-time test sample virus concentration changing conditions.The quantitative PCR detection of special virus at first need be set up the amplification typical curve of this virus, mainly based on after the viral pure culture nucleic acid extraction, be prepared into viral standard substance after will going into plasmid vector with the fragment cloning of virus-specific primer amplification, again according to the fluorescent quantitation of the plasmid standard of gradient dilution drawing standard curve as a result.
The establishment method of this typical curve has three drawbacks: 1) cell cultures of human disease's virus wastes time and energy, can be very long if will set up the quantitative PCR condition cycle of multiple virus simultaneously; 2) country is for the preservation of human disease's virus, and transportation and purposes have very strict requirement and regulations, and general laboratory is difficult to satisfy the requirement of these Causative virus of operation, thereby has limited the correlative study of common laboratory.3) in the potential safety hazard that exists of Causative virus use, if improper use, operator may infect relative disease.4) owing to similarity between the virus kind is very low, the detection of multiple virus need design different primers; In the environmental sample that has the PCR inhibitor, need assess the inhibition situation of pcr amplification with the positive control of multiple virus, these need be to the standard of every kind of virus, thereby has brought difficulty for the optimization of PCR condition.
The present invention prepares the escherichia coli plasmid that comprises viral primer by the molecular biology method of routine, and this method is safe, and operating process is simple, is applicable to that common laboratory carries out that virus PCR in the environment detects and the detection of quantitative PCR.
Summary of the invention
The object of the present invention is to provide a kind of safe and simplely, be used for the preparation method of the viral standard substance of quantitative PCR typical curve and PCR condition optimizing.
The preparation method of the virus particle standard substance that provide of the present invention is meant the cell cultures that does not need to use correlated virus, only uses to merge the method that the primer preparation has the plasmid standard of this virus upstream and downstream primer.
The concrete steps of the inventive method are as follows:
1) screens suitable intestinal bacteria 16S rRNA gene primer according to the amplified fragments size of viral primer;
2) design comprises the merging primer of virus-specific primer and intestinal bacteria primer;
3) with merging primer amplification intestinal bacteria 16S rRNA gene fragment;
4) preparation virus PCR examination criteria product plasmid.
In the aforesaid method, the primer of described screening intestinal bacteria 16S rRNA gene, be not limited to intestinal bacteria or 16S rRNA gene, can seek the suitable primer of the close fragment length of amplification in intestinal bacteria 16S rRNA gene by software according to the primer of known viruse size to this viral genome amplified fragments.
In the aforesaid method, described design merges primer, is virus and colibacillary upstream primer and both downstream primers are merged respectively, filters out the merging primer of amplification efficiency the best by software.
In the aforesaid method, described amplification intestinal bacteria 16S rRNA gene fragment is to be template with the bacillus coli gene group, and the merging primer amplification intestinal bacteria 16S rRNA gene with design must arrive the 16S rRNA gene fragment that two ends have viral primer.
In the aforesaid method, the viral standard substance plasmid of described preparation is to utilize 16S rRNA gene fragment clone that the DNA recombinant technology will have viral primer in carrier, and the recombinant plasmid of structure is as detecting the standard substance that this viral PCR detects.
In the aforesaid method, described viral standard substance plasmid, the standard substance plasmid that comprises Causative virus such as enterovirus, hepatitis A virus (HAV), hand foot mouth disease poison, norwalk virus, rotavirus, people's Astrovirus, viral hepatitis type E virus, but be not limited to these virus, also comprise the standard substance of other malignant bacteria and fungi.
Detail content further describes as follows in the aforesaid method:
1. design the intestinal bacteria 16S rRNA gene upstream and downstream primer of specific clip size.
According to known viral primer amplification fragment, use the several of close fragment length that can increase on the primer premier 5.0 screening coli strain 16S rRNA genes to candidate's upstream and downstream primer, comprising:
Upstream primer: (5 ' → 3 ')
13F：CTGGCTCAGATTGAACGC （SEQ ID?NO.1）
27F：AGAGTTTGATCCTGGCTCAG （SEQ ID?NO.2）
797F：AGTCCACGCCGTAAACGA （SEQ ID?NO.3）
936F：GGTGGAGCATGTGGTTTAA （SEQ ID?NO.4）
Downstream primer: (5 ' → 3 ')
130R：GGCAGTTTCCCAGACATTAC （SEQ ID?NO.5）
222R：TAATCCCATCTGGGCACAT （SEQ ID?NO.6）
957R：GAATTAAACCACATGCTCCA （SEQ ID?NO.7）
1025R：AAGGCACCAATCCATCTC （SEQ ID?NO.8）
1052R：CATGCAGCACCTGTCTCAC （SEQ ID?NO.9）
1126R：TGGCAACAAAGGATAAGG （SEQ ID?NO.10）
1299R：CGGACTACGACGCACTT （SEQ ID?NO.11） ；
2. the design upstream and downstream merges primer.
Wherein, the 5 ' end that the upstream merges primer is viral upstream primer, and 3 ' end is intestinal bacteria 16S upstream primer; 5 ' the end that the downstream merges primer is viral downstream primer, and 3 ' end is intestinal bacteria 16S downstream primer.With this to viral primer and several intestinal bacteria 16S primer is made up respectively, by primer premier 5.0 parameter that analytically the downstream hairpin structure, primer self dimer that merge primer forms, dimer forms between primer, selecting the merging primer of best merging primer as this virus, comprising:
(primer direction 5 ' → 3 ')
Phage phiX174:(+)
GCTTCCATGACGCAGAAGTTAGTCCACGCCGTAAACGA
（-）
GCGAAAGGTCGCAAAGTAAGGAATTAAACCACATGCTCCA
（SEQ ID?NO.12）
Enterovirus: (+)
CAAGCACTTCTGTTTCCCCGGTCCACGCCGTAAACGA
（-）
GATTCATTCAGGGGCCGGAGGAAGGCACCAATCCATCTC
（SEQ ID?NO.13）
Hepatitis A virus (HAV): (+)
GTTTGCTCCTCTTTATCATGCTATGAGAGTTTGATCCTGGCTCAG
（-）
TCCTCAATTGTTGTGATAGCTAATCCCATCTGGGCACAT
（SEQ ID?NO.14）
Hand foot mouth disease poison: (+)
ACTGGGTTTTAYAAACCTGTGATGAGTCCACGCCGTAAACGA
（-）
TCAACTTCTCCTGKATGGTCCCAGAATTAAACCACATGCTCCA
（SEQ ID?NO.15）
Norwalk virus: (+)
ATACCACTATGATGCAGAYTATGGTAGTCCACGCCGTAA
（-）
TCATCATCACCATAGAAIGAGCATGCAGCACCTGTCTCAC
（SEQ ID?NO.16）
Rotavirus: (+)
GCTTTAAAACGAAGTCTTCAACCTGGCTCAGATTGAACGC
（-）
GGTAAATTACCAATTCCTCCAGGGCAGTTTCCCAGACATTAC
（SEQ ID?NO.17）
People's Astrovirus: (+)
ATGGCTAGCAAGTCTGACAAGGGTGGAGCATGTGGTTTAA
（-）
GGTTTTGGTCCTGTGACACCCTGGCAACAAAGGATAAGG
（SEQ ID?NO.18）
Viral hepatitis type E virus: (+)
CATCCATGGTGTTTGAGAATGACTCCACGCCGTAAACGA
（-）
CATCTGAGCTACATTCGTGAGCTCGGACTACGACGCACTT
（SEQ ID?NO.19）
Annotate: have the viral primer part that is of underscore, with underscore is bacterium primer part;
3. carry out pcr amplification with the merging primer.
Utilize special merging primer that the bacillus coli gene group is increased.Can be combined in primer on the template strand this moment for merging the intestinal bacteria primer in the primer, and viral primer is in conjunction with template strand, the PCR product is the intestinal bacteria fragment (Fig. 1) that two ends have viral primer;
4. make up the virus particle standard substance.
Utilize the DNA recombinant technology with gained fragment cloning in the step 3 to carrier PMD-18T(Takara company) in, the recombinant plasmid of structure is as detecting these viral standard substance.
The present invention proposes a kind of new method for preparing the virus particle standard substance, can be widely used in the PCR of multiple virus, the PCR detection means such as quantitative, the present invention has following advantage and effect:
(1) the present invention does not need to obtain virus strain and comes the preparation standard product, need not to have avoided the cell cultures in the viral preparation, virus pollution and safety problem through strict virus strain application process;
(2) the present invention is simple to operate, quick, has saved the viral nucleic acid extracting in the viral standard substance preparation, steps such as reverse transcription;
(3) the present invention can the multiple viral standard substance of disposable preparation, thereby can use the more fully viral detection case in the simulated environment of these standard substance simultaneously.
Description of drawings
Fig. 1 is for making up the schema that contains viral primer carrier.
Fig. 2 is the quantitative PCR typical curve that does not contain three kinds of different phiX 174 standard substance of inhibitor.
Fig. 3 is the quantitative PCR typical curve that contains three kinds of different phiX 174 standard substance of inhibitor.
Embodiment
Embodiment one: phage phiX 174 merges plasmid standard and makes up the application that reaches in PCR and quantitative PCR.
Concrete steps are as follows:
(1) the intestinal bacteria 16S rRNA primer of the specific clip size of design
According to the primer phi-181F (GCTTCCATGACGCAGAAGTT) of phiX 174 and phi-181R(GCGAAAGGTCGCAAAGTAAG) size of (SEQ ID NO.20) amplification is the clip size of 181bp, the amplified fragments size is candidate's primer of 160-180bp size in the application primer premier 5.0 softwares screening intestinal bacteria 16S rRNA gene, and the candidate's primer that obtains is to being: (primer direction 5 ' → 3 ')
Candidate 1:797F(AGTCCACGCCGTAAACGA) (SEQ ID NO.21)
957R（GAATTAAACCACATGCTCCA） （SEQ ID?NO.22）
Candidate 2:934F(GCGGTGGAGCATGTGGTT) (SEQ ID NO.23)
1103R（CGCTCGTTGCGGGACTTA） （SEQ ID?NO.24）
Candidate 3:54F(AGTCGAACGGTAACAGGAA) (SEQ ID NO.25)
226R（CACATCCGATGGCAAGAG） （SEQ ID?NO.26）
(2) phiX174 merges primer design.
The upstream primer and the downstream primer of above-mentioned three pairs of candidate's primers and phiX 174 primers are merged respectively, produce 5 ' end and be viral primer, 3 ' end is the merging primer of intestinal bacteria primer, use 5.0 pairs of several primers that are combined of primer premier to carrying out the analysis of primer quality, the significant parameter scope of primer the best is: hairpin structure (△
G〉-5), self dimer (△
G〉-9) and heterodimer structure (△
G〉-12).The final phiX174 of determining merges primer and synthetic:
phi181F-797F：
GCTTCCATGACGCAGAAGTTAGTCCACGCCGTAAACGA
（SEQ ID?NO.27）
phi181R-957R：
GCGAAAGGTCGCAAAGTAAGGAATTAAACCACATGCTCCA
（SEQ ID?NO.28）
(3) phiX 174 merges the preparation of plasmid
1. use PCR test kit PreMix Ex Taq Version 2.0 (TaKaRa);
Pcr amplification adopts 50 μ L systems, comprising: PreMix Ex Taq 25 μ L, primer phi181F-797F and phi181R-957R(final concentration 0.2 μ M), bacillus coli gene group DNA 20ng;
The PCR cycling condition is:
2. use Axygen glue to reclaim test kit to PCR product rubber tapping recovery;
3. use Takara pMD-18T Vector connection test kit that the PCR product of purifying is connected among the carrier pMD-18T screening positive clone;
4. use Axygen plasmid extraction test kit extracting recombinant plasmid, electrophoresis detection;
5. use Axygen glue to reclaim test kit plasmid DNA is reclaimed, to remove the pollution of bacillus coli gene group;
6. use the Nanodrop instrument to carry out quantitatively, and calculate plasmid copy number according to concentration to reclaiming plasmid.
Embodiment two: the standard plasmid that contains viral primer is made the quantitative PCR typical curve
The virus particle standard substance that make up for assessment are being set up the quantitative PCR typical curve and whether virus genomic typical curve exists deviation, the present invention's standard substance of three kinds of phiX 174, be respectively: 1) phiX 174 merges plasmids, promptly utilizes phiX 174 to merge the primer amplification bacterial genomes with the inventive method and through the plasmid of DNA reorganization gained; 2) phiX 174 plasmids are promptly with directly increase phiX 174 genomes and through the plasmid of DNA reorganization gained of phi-181F and phi-181R; 3) phiX 174 genomes (0.5 μ g/ μ L, the worker is given birth in Shanghai)
1. the establishment of quantitative PCR condition.
The quantitative PCR instrument that the present invention uses is MX 3000P, and SYBR Green fluoroscopic examination program is arranged on when second reaction of every circulation finishes and collects fluorescent signal, detects wavelength and is: 510nm.
Three-step approach is adopted in the quantitative PCR circulation.
Cycling condition is:
Reaction system is:
2. do not contain the foundation of the phiX 174 quantitative criterion curves of inhibitor.
10 times of gradient dilution phiX174 merge plasmid standard, phiX174 plasmid standard, phiX 174 genome standard substance with the sterilization distilled water.Plasmid concentration after three kinds of standard substance dilute is 10
3, 10
4, 10
5, 10
6, 10
7Copies/ μ L adopts system and reaction conditions in the step 1 to react.Utilize quantitative fluorescent PCR to carry software (MX Pro after detecting end
TMQPCR Software), adjusts baseline and threshold value, draw the typical curve (Fig. 2) of three kinds of standard substance according to noise situations.Do not having under the situation of inhibitor, three typical curves do not have difference substantially.
3. contain the foundation of the phiX 174 quantitative criterion curves of inhibitor.
10 times of gradient dilution phiX174 merge plasmid standard, phiX174 plasmid standard, phiX 174 genome standard substance with former aqueous extract.Plasmid concentration after three kinds of standard substance dilute is 10
3, 10
4, 10
5, 10
6, 10
7Copies/ μ L adopts system and reaction conditions in the step 1 to react.Utilize quantitative fluorescent PCR to be with software (MX Pro again after detecting end
TMQPCR Software), adjusts baseline and threshold value, draw the typical curve (Fig. 3) of three kinds of standard substance according to noise situations.Compare with the situation of unrestraint agent, exist under the situation of inhibitor the raising relatively of the quantitative Ct value of same copy number.Article three, difference to some extent between the typical curve, but the Ct difference between the different methods is less than 1.Because the focus of virus when detecting is the affirmation at the qualitative detection and the virus concentration order of magnitude in to environment, therefore utilize when merging virus particle standard substance that primer makes up and being suitable for practical application to virus in the environmental sample quantitatively.
Embodiment three: utilize of the influence of virus particle standard substance assessment inhibitor to the PCR reaction:
The former concentrated liquid of tap water is extracted nucleic acid.With this extracting solution the virus particle standard substance are carried out gradient dilution and assess the influence that the inhibitor in the former water reacts PCR.
1. merge plasmid standard with 10 times of gradient dilution phiX174 of sterilization distilled water.The concentration of dilution back plasmid is respectively 10
1, 10
2, 10
3, 10
4, 10
5Copies/ μ L, pcr amplification adopt 25 μ L systems, comprising: PreMix Ex Taq 12.5 μ L, primer phi181F and phi181R(final concentration 0.25 μ M), plasmid 1 μ L, electrophoresis detection; Be limited to 10 under detecting
2Copies/ μ L.
2. raw water of waterworks concentrates.The concentration method of former water is according to Karim MR et.al(Appl Environ Microb.2009; 75(8) 2393-2399) described, use the also final enrichment of the former water of NanoCeram collection 50L and become the 5mL concentrated solution.
3. get concentrated solution 280 μ L, extract former water with QIAamp Viral RNA MiniKit and collect viral nucleic acid in the liquid, obtain having the viral nucleic acid extracting solution 120 μ L of inhibitor.
4. with phi181F and phi181R 3 gained samples are carried out PCR and detect (system is with 1), confirm wherein not contain phiX 174 phages.
5. merge plasmid standard with 10 times of gradient dilution phiX174 of former aqueous extract.The concentration of dilution back plasmid is respectively 10
1, 10
2, 10
3, 10
4, 10
5Copies/ μ L, the PCR system is with step 1, electrophoresis detection; Be limited to 10 under detecting
3Copies/ μ L needs a high order of magnitude than distilled water.
SEQ?IDNO.1 13F：CTGGCTCAGATTGAACGC
SEQ?IDNO.2 27F：AGAGTTTGATCCTGGCTCAG
SEQ?IDNO.3 797F：AGTCCACGCCGTAAACGA
SEQ?IDNO.4 936F：GGTGGAGCATGTGGTTTAA
SEQ?IDNO.5 130R：GGCAGTTTCCCAGACATTAC
SEQ?IDNO.6 222R：TAATCCCATCTGGGCACAT
SEQ?IDNO.7 957R：GAATTAAACCACATGCTCCA
SEQ?IDNO.8 1025R：AAGGCACCAATCCATCTC
SEQ?IDNO.9 1052R：CATGCAGCACCTGTCTCAC
SEQ?IDNO.10?1126R：TGGCAACAAAGGATAAGG
SEQ?IDNO.11?1299R：CGGACTACGACGCACTT
SEQ?IDNO.12
（+）
GCTTCCATGACGCAGAAGTTAGTCCACGCCGTAAACGA
（-）
GCGAAAGGTCGCAAAGTAAGGAATTAAACCACATGCTCCA
SEQ?IDNO.13
（+）
CAAGCACTTCTGTTTCCCCGGTCCACGCCGTAAACGA
（-）
GATTCATTCAGGGGCCGGAGGAAGGCACCAATCCATCTC
SEQ?IDNO.14
（+）
GTTTGCTCCTCTTTATCATGCTATGAGAGTTTGATCCTGGCTCAG
（-）
TCCTCAATTGTTGTGATAGCTAATCCCATCTGGGCACAT
SEQ?IDNO.15
（+）
ACTGGGTTTTAYAAACCTGTGATGAGTCCACGCCGTAAACGA
（-）
TCAACTTCTCCTGKATGGTCCCAGAATTAAACCACATGCTCCA
SEQ?IDNO.16
（+）
ATACCACTATGATGCAGAYTATGGTAGTCCACGCCGTAA
（-）
TCATCATCACCATAGAAIGAGCATGCAGCACCTGTCTCAC
SEQ?IDNO.17
（+）
GCTTTAAAACGAAGTCTTCAACCTGGCTCAGATTGAACGC
（-）
GGTAAATTACCAATTCCTCCAGGGCAGTTTCCCAGACATTAC
SEQ?IDNO.18
（+）
ATGGCTAGCAAGTCTGACAAGGGTGGAGCATGTGGTTTAA
（-）
GGTTTTGGTCCTGTGACACCCTGGCAACAAAGGATAAGG
SEQ?IDNO.19
（+）
CATCCATGGTGTTTGAGAATGACTCCACGCCGTAAACGA
（-）
CATCTGAGCTACATTCGTGAGCTCGGACTACGACGCACTT
SEQ?IDNO.20
phi-181F：GCTTCCATGACGCAGAAGTT
phi-181R：GCGAAAGGTCGCAAAGTAAG
SEQ?IDNO.21
797F:AGTCCACGCCGTAAACGA
SEQ?IDNO.22
957R:GAATTAAACCACATGCTCCA
SEQ?IDNO.23
934F:GCGGTGGAGCATGTGGTT
SEQ?IDNO.24
1103R:CGCTCGTTGCGGGACTTA
SEQ?IDNO.25
54F:AGTCGAACGGTAACAGGAA
SEQ?IDNO.26?
?226R:CACATCCGATGGCAAGAG
SEQ?IDNO.27
GCTTCCATGACGCAGAAGTTAGTCCACGCCGTAAACGA
SEQ?IDNO.28
GCGAAAGGTCGCAAAGTAAGGAATTAAACCACATGCTCCA
Claims (3)
1. preparation method who is used for the standard substance that virus PCR detects is characterized in that concrete steps are as follows:
1), screens suitable intestinal bacteria 16S rRNA gene primer according to the amplified fragments size of viral primer;
2) design comprises the merging primer of virus-specific primer and intestinal bacteria primer;
3) with merging primer amplification intestinal bacteria 16S rRNA gene fragment;
4) preparation virus PCR examination criteria product plasmid;
Described step 1) is according to the primer of the known viruse size to this viral genome amplified fragments, seeks the suitable primer of the close fragment length of amplification in intestinal bacteria 16S rRNA gene by software;
Described rapid 2), be that the downstream primer with virus and colibacillary upstream primer and both merges respectively, filter out the merging primer of amplification efficiency the best by software;
Described rapid 3), be to be template with the bacillus coli gene group, the merging primer amplification intestinal bacteria 16S rRNA gene with design must arrive the 16S rRNA gene fragment that two ends have viral primer;
Described rapid 4), be to utilize 16S rRNA gene fragment clone that the DNA recombinant technology will have viral primer in carrier, the recombinant plasmid of structure is as detecting the standard substance that this viral PCR detects;
Described viral standard substance plasmid comprises the standard substance plasmid of enterovirus, hepatitis A virus (HAV), hand foot mouth disease poison, norwalk virus, rotavirus, people's Astrovirus, viral hepatitis type E virus, also comprises the standard substance of other malignant bacteria and fungi.
2. the preparation method who is used for the standard substance of virus PCR detection according to claim 1 is characterized in that the suitable primer of the described close fragment length that increases is as follows in intestinal bacteria 16S rRNA gene:
Upstream primer: (5 ' → 3 ')
13F：CTGGCTCAGATTGAACGC （SEQ ID?NO.1）
27F：AGAGTTTGATCCTGGCTCAG （SEQ ID?NO.2）
797F：AGTCCACGCCGTAAACGA （SEQ ID?NO.3）
936F：GGTGGAGCATGTGGTTTAA （SEQ ID?NO.4）
Downstream primer: (5 ' → 3 ')
130R：GGCAGTTTCCCAGACATTAC （SEQ ID?NO.5）
222R：TAATCCCATCTGGGCACAT （SEQ ID?NO.6）
957R：GAATTAAACCACATGCTCCA （SEQ ID?NO.7）
1025R：AAGGCACCAATCCATCTC （SEQ ID?NO.8）
1052R：CATGCAGCACCTGTCTCAC （SEQ ID?NO.9）
1126R：TGGCAACAAAGGATAAGG （SEQ ID?NO.10）
1299R：CGGACTACGACGCACTT （SEQ ID?NO.11）。
3. the preparation method who is used for the standard substance of virus PCR detection according to claim 2, it is characterized in that described design comprises the merging primer of virus-specific primer and intestinal bacteria primer, 5 ' the end that is upstream merging primer is viral upstream primer, and 3 ' end is intestinal bacteria 16S upstream primer; 5 ' the end that the downstream merges primer is viral downstream primer, and 3 ' end is intestinal bacteria 16S downstream primer; With this to viral primer and several intestinal bacteria 16S primer is made up respectively, by primer premier 5.0 parameter that analytically the downstream hairpin structure, primer self dimer that merge primer forms, dimer forms between primer, selecting the merging primer of best merging primer, specific as follows as this virus:
(primer direction 5 ' → 3 ')
Phage phiX174:(+)
GCTTCCATGACGCAGAAGTTAGTCCACGCCGTAAACGA
（-）
GCGAAAGGTCGCAAAGTAAGGAATTAAACCACATGCTCCA
（SEQ ID?NO.12）
Enterovirus: (+)
CAAGCACTTCTGTTTCCCCGGTCCACGCCGTAAACGA
（-）
GATTCATTCAGGGGCCGGAGGAAGGCACCAATCCATCTC
（SEQ ID?NO.13）
Hepatitis A virus (HAV): (+)
GTTTGCTCCTCTTTATCATGCTATGAGAGTTTGATCCTGGCTCAG
（-）
TCCTCAATTGTTGTGATAGCTAATCCCATCTGGGCACAT
（SEQ ID?NO.14）
Hand foot mouth disease poison: (+)
ACTGGGTTTTAYAAACCTGTGATGAGTCCACGCCGTAAACGA
（-）
TCAACTTCTCCTGKATGGTCCCAGAATTAAACCACATGCTCCA
（SEQ ID?NO.15）
Norwalk virus: (+)
ATACCACTATGATGCAGAYTATGGTAGTCCACGCCGTAA
（-）
TCATCATCACCATAGAAIGAGCATGCAGCACCTGTCTCAC
（SEQ ID?NO.16）
Rotavirus: (+)
GCTTTAAAACGAAGTCTTCAACCTGGCTCAGATTGAACGC
（-）
GGTAAATTACCAATTCCTCCAGGGCAGTTTCCCAGACATTAC
（SEQ ID?NO.17）
People's Astrovirus: (+)
ATGGCTAGCAAGTCTGACAAGGGTGGAGCATGTGGTTTAA
（-）
GGTTTTGGTCCTGTGACACCCTGGCAACAAAGGATAAGG
（SEQ ID?NO.18）
Viral hepatitis type E virus: (+)
CATCCATGGTGTTTGAGAATGACTCCACGCCGTAAACGA
（-）
CATCTGAGCTACATTCGTGAGCTCGGACTACGACGCACTT
（SEQ ID?NO.19）
Annotate: have the viral primer part that is of underscore, with underscore is bacterium primer part.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102295837A CN101892326B (en) | 2010-07-19 | 2010-07-19 | Method for preparing standard substance suitable for virus PCR detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102295837A CN101892326B (en) | 2010-07-19 | 2010-07-19 | Method for preparing standard substance suitable for virus PCR detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101892326A true CN101892326A (en) | 2010-11-24 |
| CN101892326B CN101892326B (en) | 2012-08-22 |
Family
ID=43101670
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102295837A Expired - Fee Related CN101892326B (en) | 2010-07-19 | 2010-07-19 | Method for preparing standard substance suitable for virus PCR detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101892326B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898238A (en) * | 2014-01-26 | 2014-07-02 | 中国计量科学研究院 | Plasmid standard molecule for hepatitis a virus quantitative detection |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418286A (en) * | 2008-12-05 | 2009-04-29 | 上海之江生物科技有限公司 | Artificial pseudotype virus of human immunodeficiency virus I type as well as preparation and application thereof |
-
2010
- 2010-07-19 CN CN2010102295837A patent/CN101892326B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418286A (en) * | 2008-12-05 | 2009-04-29 | 上海之江生物科技有限公司 | Artificial pseudotype virus of human immunodeficiency virus I type as well as preparation and application thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103898238A (en) * | 2014-01-26 | 2014-07-02 | 中国计量科学研究院 | Plasmid standard molecule for hepatitis a virus quantitative detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101892326B (en) | 2012-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104195266B (en) | Detect the quadruple PCR kit for fluorescence quantitative of infantile pneumonia three kinds of pathogenic agent | |
| CN107338330A (en) | Detect real-time fluorescence quantitative PCR primer, kit and the detection method of the type of pig circular ring virus 3 | |
| CN104561377A (en) | Real-time fluorescent multiplex PCR (polymerase chain reaction) based kit for rapidly detecting common respiratory pathogens | |
| CN107475456A (en) | PEDV quick determination methods and its kit based on isothermal reverse transcription recombinase polymeric enzymatic amplification method | |
| CN105112564A (en) | Method and kit for detecting high-risk HPV (human papillomavirus) E6/E7 mRNA (messenger ribonucleic acid) by ligase | |
| CN101613764B (en) | High-risk type HPV fluorescence PCR screening method and primer, probe and kit thereof | |
| CN102329888A (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) testing method for cccDNA (covalently closed circular deoxyribonucleic acid) of hepatitis B virus and kit thereof | |
| Van den Bosch et al. | Development of reverse transcriptase PCR assays for detection of active human herpesvirus 6 infection | |
| CN111534642A (en) | Reverse transcription-real-time fluorescence quantitative PCR kit for specifically detecting TWI (TWI-infectious bronchitis Virus) and application thereof | |
| CN103205512B (en) | Primer for detecting porcine sapelo virus, Taqman-MGB probe and kit | |
| CN102676700A (en) | Qualitative detection method for simultaneously detecting three types of main hand-foot-and -mouth disease viruses in water environment | |
| CN106498054A (en) | The GeXP analysis methods of vibrio cholera and vibrio parahaemolyticus in a kind of synchronous detecting food | |
| CN114350848A (en) | Dual fluorescent probe primer combination and kit for identifying African swine fever type I strain and type II strain and application of dual fluorescent probe primer combination and kit | |
| CN113718064A (en) | Probe primer combination, kit and application for identifying PCV2 and PCV3 | |
| CN104611324A (en) | Whole blood sample fast pyrolysis kit and detection method thereof | |
| CN102134612B (en) | Rapid PCR (Polymerase Chain Reaction) testing method of silkworm densovirus BmDNV | |
| CN107326099B (en) | Five-porcine diarrhea virus enrichment multiplex PCR (polymerase chain reaction) rapid detection kit and application thereof | |
| CN101892326B (en) | Method for preparing standard substance suitable for virus PCR detection | |
| CN113174446A (en) | One-step double RT-PCR detection method for bovine viral diarrhea virus typing | |
| CN105671209A (en) | Primers, probe, kit and method for detecting bovine coronavirus | |
| CN102605103B (en) | Primer, probe and method for detecting Norwalk virus nucleotide | |
| CN115896316A (en) | Tuberculosis detection method | |
| CN111235315A (en) | Method for simultaneously detecting multiple genotypes of hepatitis E virus | |
| CN101407847A (en) | Nucleic acid fluorescent quantitative RT-PCR detection kit and detection method for enterovirus Cox A16 | |
| CN103014180A (en) | Detection primer, probe and detection method of human astrovirus nucleotide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120822 Termination date: 20150719 |
|
| EXPY | Termination of patent right or utility model |