CN102367490A

CN102367490A - Method for detecting viruses

Info

Publication number: CN102367490A
Application number: CN2011103259599A
Authority: CN
Inventors: 高扬; 李晶晶; 喻爽; 杨玲; 张俊青; 吴平; 王威
Original assignee: BGI Shenzhen Co Ltd
Current assignee: BGI Shenzhen Co Ltd
Priority date: 2008-12-12
Filing date: 2008-12-12
Publication date: 2012-03-07

Abstract

The invention provides a method for detecting genotypes of human papilloma viruses (HPV). Genes to be detected are one or more selected from HPV type 17, and the method comprises the following steps: (1) designing amplimers directed at each HPV genotype according to variable sites of a universal primer sequence of selected HPV genotypes to be detected; (2) carrying out PCR amplification; (3) carrying out SAP enzyme treatment; (4) carrying out an extension reaction, wherein, difference between the molecular weight of extension resultants and that of extension primers and among the molecular weight of extension resultants of different types is no less than 9D; (5) purifying the extension resultants by using a resin; (6) carrying out mass spectrometry and determining HPV genotypes to be detected. The method provided in the invention overcomes such problems in some conventional detection methods as incapability of detecting according to different types and detecting multiple infection, limited accuracy, low flux and high cost and proneness to affection of reaction stability due to utilization of RNA as probes.

Description

A kind of method that detects virus

The application be the application people for Shenzhen Huada Genetic Technology Co., Ltd, the applying date be that December 12, application number in 2008 are 200810218334.0, denomination of invention is divided an application for " a kind of method that detects human papilloma virogene type ".

Technical field

The present invention relates to a kind of method that detects virus.

Background technology

HPV is a kind of small-sized no coating dna virus, the DNA genome with double-stranded closed loop, 7.2-8kb, relative molecular weight 5 * 10 ⁶, the HPV genome can be divided into 3 zones: noncoding upstream regulation district, and early stage opening code-reading frame comprises E6, E7, E1, E2, E4, E5, late period, the open sign indicating number of reading was distinguished L1 (main capsid protein) and L2 (little capsid protein).Opening code-reading frame (ORF) gene order difference according to the coding capsid protein L 1 is carried out somatotype, and the difference of L1 district ORF is divided into different genus less than 60%, between 60-70%, is divided into different kinds; Difference is positioned at 71-89% and then is divided into different types, and it is 130 many types of that the HPV that has identified at present has approximately, according to viral virulence size; Be divided into high-risk-type,, can cause cervical intraepithelial neoplasia pathology (cervical intraepithelial like HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 etc.; CN), be more common in the women at advanced age, be difficult for natural remission; With being related closely of cervical cancer; Low risk HPV has HPV6, HPV11, HPV42, HPV43, HPV44 etc., is more common in young woman, and the natural remission rate is high.

Through to the HPV genotype tests, can different HPV types be infected and study more deeply with the relation of cervical lesions, very high research value is arranged.At present HPV detects and mostly is to adopt the s-generation hybrid capture method (HC2) through food and drug administration's authentication, 13 kinds of high-risk HPVs of this kind method detection, but can not somatotype, can not detect multiple infection.Existing testing product based on the HPV nucleic acid hybridization technique, accuracy rate is limited, and flux is low, and cost is high, and most probes is RNA, may influence the stability of reaction.

Summary of the invention

Embodiment of the invention technical problem to be solved is to provide a kind of method that detects human papilloma virogene type; Being intended to solve existing detection method can not somatotype, can not detect multiple infection, accuracy rate is limited; And flux is low; Cost is high, and because probe is RNA, may influence the problem of the stability of reaction.

According to a first aspect of the invention; The present invention proposes a kind of method that detects virus; Comprise the steps: to use the virus-specific amplimer that the nucleic acid of said virus is carried out pcr amplification,, comprise the variant sites of said virus in the said amplified production so that obtain amplified production; With said amplified production is template, uses the extension primer to carry out extension, so that obtain to connect at 3 ' end of said extension primer the extension products of a base, wherein, 3 ' end of said extension primer is close to said variant sites; And said extension products is carried out ground substance assistant laser absorption/ionization time of flight mass spectrometry system detect, so that confirm the type of said virus.Utilize this method, can confirm the type of virus effectively.

According to concrete example of the present invention; Said virus is the human papillomavirus; Wherein, Detect through said extension products being carried out ground substance assistant laser absorption/ionization time of flight mass spectrometry system, so that confirm said human papillomavirus's genotype, said genotype is preferably one or more among HPV6, HPV11, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68 and the HPV73.

Thus; According to a second aspect of the invention; The present invention proposes a kind of method that detects human papilloma virogene type; Human papillomavirus's gene to be detected is one or more among HPV6, HPV11, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68 and the HPV73, comprises the steps:

(1) according to the variant sites of selected HPV gene type universal primer sequence to be detected; Revise the GP5+/GP6+ universal primer; Design amplimer to every type; The coupling fully that 12 bases are arranged in other amplimer 3 ' position of each Idiotype, and this amplimer is all with the sequence label of 10 base acgttggatg; Design extension primer, the length of this extension primer are the 17-28 base, comprise in 4 bases of extending base in the position, 3 ' end end of extending primer, comprise a special polymorphic site mark of type; The position of extending the primer selection is zone conservative relatively in the GP5+/GP6+ sequence;

(2), obtain to contain the target sequence amplified production in said mutational site through pcr amplification;

(3) handle through the SAP enzyme, remove the dNTPs that contains in the said amplified production;

(4) through extension, connect a base at the 3 ' end that extends primer, molecular weight difference is not less than 9D between extension products that obtains and the said extension primer, and the molecular weight difference between the extension products of each type is not less than 9D;

(5) adopt resin purification extension product;

(6) adopt matrix-assisted laser desorption/ionization flight time mass spectrum system to carry out mass spectrometric detection the product behind the purifying, confirm selected HPV gene type to be detected.

Compared with prior art; Technique scheme adopts matrix-assisted laser desorption/ionization flight time mass spectrum (MALDI-TOF-MS) system to detect; The reagent consumptive material that in mass-spectrometric technique, uses is simple relatively and relatively stable; Do not need optical dye, special expensive reagent such as enzyme, reaction can be carried out in micro-system, reduces the use of sample and various running stores.Because mass-spectrometric technique directly detects the molecular weight (mass-to-charge ratio) of DNA, directly confirm the type of base, need not pass through any type of conversion of signals, as long as there is the SNP segment of a copy to be increased and can discern in theory, stopped the possibility that false positive takes place.Mass-spectrometric technique also has robotization, high throughput testing characteristics in addition; Mass-spectrometric technique combines with many primer extensions technology; Can in a reaction system, detect multitype hpv simultaneously, the PCR reaction can be carried out in micro-system, extracts equipment, multiple PCR primer design software and DAS automatically in conjunction with DNA; Alleviate workload greatly, improved the detection flux.

In addition, the mass spectrum classification system is fit to carry out the HPV detection from the angle of design of primers.The product of PCR be best in the scope of 100-180bp before mass spectrometer system required, and HPV is the universal primer GP5+/GP6+ fragment product of 140bp that approximately increases in the L1 district, and the validity that increases is confirmed.The product length of amended primer GP5+/GP6+ amplification satisfies the requirement of mass spectrum to preceding PCR product sheet segment length in this method.Require in the mass spectrometer system extension to extend between primer and the extension products; Molecular weight difference between the extension products of each type is not less than 9D; And the special extension primer of above-mentioned 17 type HPV that designs in this method can be distinguished from each other in mass spectrometer system; Also can satisfy the requirement of mass spectrometer system, therefore, can detect above-mentioned 17 type HPV genes simultaneously.

Description of drawings

Fig. 1 representes that the HPV of HPV6, HPV11, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68 and HPV73 type extends primer peak figure;

Fig. 2 representes HPV6 analytical results figure;

Fig. 3 representes HPV11 analytical results figure;

Fig. 4 representes HPV16 analytical results figure;

Fig. 5 representes HPV18 analytical results figure;

Fig. 6 representes HPV31 analytical results figure;

Fig. 7 representes HPV33 analytical results figure;

Fig. 8 representes HPV35 analytical results figure;

Fig. 9 representes HPV39 analytical results figure;

Figure 10 representes HPV45 analytical results figure;

Figure 11 representes HPV51 analytical results figure;

Figure 12 representes HPV52 analytical results figure;

Figure 13 representes HPV56 analytical results figure;

Figure 14 representes HPV58 analytical results figure;

Figure 15 representes HPV59 analytical results figure;

Figure 16 representes HPV66 analytical results figure;

Figure 17 representes HPV68 analytical results figure;

Figure 18 representes HPV73 analytical results figure;

Figure 19 representes HBB analytical results figure.

Embodiment

Clearer for technical problem, technical scheme and beneficial effect that the present invention will be solved, below in conjunction with embodiment, the present invention is further elaborated.Should be appreciated that specific embodiment described herein only in order to explanation the present invention, and be not used in qualification the present invention.

The method of the detection human papilloma virogene type that the embodiment of the invention provides; Human papillomavirus's gene to be detected is one or more among HPV6, HPV11, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68 and the HPV73, comprises the steps:

(1) according to the variant sites of selected HPV gene type universal primer sequence to be detected; Revise the GP5+/GP6+ universal primer; Design amplimer to every type; The coupling fully that 12 bases are arranged in other amplimer 3 ' position of each Idiotype, and this amplimer is all with the sequence label of 10 base acgttggatg; The design extension primer, the length of extending primer is the 17-28 base, comprises in 4 bases of extending base in the position, 3 ' end end of extending primer, comprises a special polymorphic site mark of type; The position of extending the primer selection is zone conservative relatively in the GP5+/GP6+ sequence; Between said extension primer and the extension products, the molecular weight difference between the extension products of each type is not less than 9D.Various HPV amplimer sequence is seen table 1.Corresponding HPV extends primer sequence and quality is seen table 2.Amplimer is the PAGE purifying, and extending primer is the HPLC purifying.

Table 1

Table 2

Sequence numbering	The HPV type	Extend primer sequence	Extend base
				SEQ?ID?NO.25	HPV16	TTATAGTAAGTTTAATTATATTTGGT	T
SEQ?ID?NO.26	HPV18	TAGTACTTTATGATTAAGCTGCA	T
				SEQ?ID?NO.27	HPV31	ATCACATCTCTGAACTTA	T
SEQ?ID?NO.28	HPV33	CTATAAGTCTGCTAGTT	A
				SEQ?ID?NO.29	HPV35	CTGTGGTGGATTATTATCCTAAG	G
SEQ?ID?NO.30	HPV39	TACTCATCTAACCCTTATAGAATTCT	C
				SEQ?ID?NO.31	HPV45	ATTAGTATCACTACTCTCATAG	G
SEQ?ID?NO.32	HPV51	GGGTGAACCCACAGC	A
				SEQ?ID?NO.33	HPV52	TTTATATTTGCTTTCGCCCCTAG	C
SEQ?IDNO.34	HPV56	TTCAATTCTCCGTGTTCTAATGAACTT	T
				SEQ?ID?NO.35	HPV58	TGGAAGTCTAACTTTTCTCTTCC	T
SEQ?ID?NO.36	HPV59	ACCGATTTCCCACAGT	C
				SEQ?ID?NO.37	HPV66	GGATGTGTTAGACTGTAATTG	C
SEQ?ID?NO.38	HPV68	CTACCTCGCAAAATCTCTAAT	C
				SEQ?ID?NO.39	HPV73	GCTGTAAAGCTAGCGTGTA	T
SEQ?ID?NO.40	HPV6	TCACACTTACCTGAATGCGC	T
				SEQ?ID?NO.41	HPV11	AACATCTACTCTGCTA	A

(2), obtain to contain the target sequence amplified production in said mutational site through pcr amplification.Table 3 is seen in the configuration of pcr amplification reaction reagent.

Table 3

Reaction conditions is 94 ℃, 15min; 94 ℃ of sex change 20s, 56 ℃ of annealing 30s, 72 ℃ are extended 1min, coamplification 45 circulations; Final 72 ℃ are extended 3min.

(3) handle through SAP digestive ferment (shrimp alkaline phosphotase), remove the dNTPs that contains in the said amplified production.SAP digestive ferment reaction system is seen table 4.

Table 4

Reagent	Volume/reaction
		H2O (HPLE level)	1.53ul
SAP enzyme buffer liquid	0.17ul
		The SAP enzyme	0.30ul
Volume	2.0ul

Reaction conditions is 37 ℃ hatched 40 minutes, removed remaining dNTP in the reaction; 85 ℃ made the SAP enzyme deactivation in 5 minutes.

(4) through extension, connect a base at the 3 ' end that extends primer, molecular weight difference is not less than 9D between extension products that obtains and the said extension primer, and the molecular weight difference between the extension products of each type is not less than 9D.The extension system is seen table 5.

Table 5

* wherein extension mix carries out the linear relationship adjustment according to the molecular weight size of various primer.

Reaction conditions is 94 ℃, 30s; 94 ℃ of sex change 5s, 52 ℃ of annealing 5s, 80 ℃ are extended 5s, coamplification 40 circulations, 5 partial circulatings are carried out in annealing and extension in each circulation; Final 72 ℃ are extended 3min.

(5) adopt resin purification extension product.

(6) adopt matrix-assisted laser desorption/ionization flight time mass spectrum system to carry out mass spectrometric detection the product behind the purifying, confirm HPV gene type to be detected.Among Fig. 1-19; X-coordinate is represented the molecular weight size of various extension primer and product among the figure, and wherein the dotted line on the left side representes to extend primer molecule amount position (owing to completely consumed, so there is not the peak type); The right dotted line is represented extension products molecular weight position (because extension is arranged, all have the peak type); Ordinate zou is represented the strength of signal of primer.Read peak figure and derived data with TYPE4.0 software.Do not having under the situation about infecting, each type HPV has the peak figure that the extension primer is arranged at the different quality place of mass spectrum with confidential reference items HBB; Under the situation that has HPV to infect, relative HPV has the peak figure of extension products.In a sample, can detect multiple infection.Peak figure reports that the result is divided into 4 kinds: A: reliable results; B: moderate is reliable; C: generally reliable; D: low reliable.It is effective that first three is regarded as this extension, has corresponding HPV to infect, and the 4th kind because mass spectra peak figure baseline is uneven causes, and is regarded as not having the HPV infection.Will be in the concrete sample according to sample information and mass spectra peak figure concrete analysis.

Also comprise the preparation of HPV plasmid standard in the present embodiment.

After using L1 district special primer will comprise the amplified production purifying of L1 district gene fragment of HPV6,11,16,18,31,33,35,39,45,51,52,56,58,59,66,68,73 types; Be connected respectively to PMD-T carrier (TakaraPMD-T connects test kit); Be converted into bacillus coli DH 5 alpha again; The dull and stereotyped coating of LB solid medium was cultivated 12～14 hours; Select mono-clonal secondary enlarged culturing through blue hickie screening, use plasmid extraction kit (AXYGEN) to extract and plasmid purification, be accredited as the male plasmid through dna sequencing.

With the HPV6 for preparing, 11,16,18,31,33,35,39,45,51,52,56,58,59,68,66,73 plasmids are measured the OD value respectively, according to the OD value plasmid are diluted 500pg again, 5pg, the storage liquid of three kinds of concentration of 0.5pg.Then according to the mole formula: the copy number ≈ [1ng*10 of 1ng plasmid ^-9/ 2*330* (carrier molecule amount+insertion fragmental molecule amount)] * 6.02*10 ²³Calculating the copy number of 1ng, is 10 according to this value with the plasmid gradient dilution ⁵, 10 ⁴, 5000,10 ³, 10 ², 10 ¹6 concentration gradients of copies/ul are carried out the sensitivity checking.

The sensitivity of HPV standard substance detects.The dilution of HPV standard substance is 10 ⁵, 10 ⁴, 5000,10 ³, 10 ², 6 concentration gradients of 10copies/ul are carried out the sensitivity checking.HPV11,33,35,45,51,52,58,66,68 sensitivity are 50copies/ul; HPV16,18,31 sensitivity are 50copies/ul; HPV6,39,56,59,73 sensitivity are 100copies/ul.

Comprise also in the present embodiment that the HPV reference substance is selected and preparation.

The positive contrast of HPV18 recombinant plasmid (250copies/ul), and the no HPV infected person genomic dna background of warp detection of mixing 10ng/ul.The HPV negative control is aseptic double-distilled water and mouse liver.The positive control and the negative control that in reaction, add design.Quality control standard is referring to table 6.

Table 6

Quality control product	The result
		The HPV18 positive control	Only HPV18 has the extension peak
Distilled water	There is not the peak of extension
		The mouse liver	There is not the peak of extension

Three Quality Control projects are just often in all detections, and it is effective to look the result, otherwise invalid.

In the present embodiment HPV genotype detection confidential reference items with betaglobulin gene (HBB) as the internal reference gene, the quality of monitoring of DNA template and the quality of pcr amplification reaction.The universal primer sequence is:

SEQ?ID?NO.11acgttggatgACACAACTGTGTTCACTAG

SEQ?ID?NO.24acgttggatgCAACTTCACCCACGTTCACC，

Extending primer sequence is:

SEQ?ID?NO.42GGTAGGGCAGATTTCC。

Matrix-assisted laser desorption/ionization flight time mass spectrum of the present invention has highly sensitive, high specific and high-throughout characteristics, and low with respect to other detection method cost.The present invention is adapted to: HPV infects the research of genotype and cancer-related, the monitoring that large-scale epidemiology survey that HPV infects and cervical disease take place and develop.

The above is merely preferred embodiment of the present invention, not in order to restriction the present invention, all any modifications of within spirit of the present invention and principle, being done, is equal to and replaces and improvement etc., all should be included within protection scope of the present invention.

Claims

1. a method that detects virus is characterized in that, comprises the steps:

Use the virus-specific amplimer that the nucleic acid of said virus is carried out pcr amplification,, comprise the variant sites of said virus in the said amplified production so that obtain amplified production;

With said amplified production is template, uses the extension primer to carry out extension, so that obtain to connect at 3 ' end of said extension primer the extension products of a base, wherein, 3 ' end of said extension primer is close to said variant sites; And

Said extension products is carried out ground substance assistant laser absorption/ionization time of flight mass spectrometry system detect, so that confirm the type of said virus.

2. method according to claim 1; It is characterized in that; Said virus is the human papillomavirus; Wherein, Detect through said extension products being carried out ground substance assistant laser absorption/ionization time of flight mass spectrometry system, so that confirm said human papillomavirus's genotype, said genotype is preferably one or more among HPV6, HPV11, HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68 and the HPV73.

3. method according to claim 2 is characterized in that, comprises the steps:

(1) according to the variant sites of selected HPV gene type universal primer sequence to be detected; Revise the GP5+/GP6+ universal primer; Design amplimer to every type; The coupling fully that 12 bases are arranged in other amplimer 3 ' position of each Idiotype, and this amplimer is all with the sequence label of 10 base acgttggatg; The design extension primer, the length of extending primer is the 17-28 base, comprises in 4 bases of extending base in the position, 3 ' end end of extending primer, comprises a special polymorphic site mark of type; The position of extending the primer selection is zone conservative relatively in the GP5+/GP6+ sequence;

(5) adopt resin purification extension product;

(6) adopt matrix-assisted laser desorption/ionization flight time mass spectrum system to carry out mass spectrometric detection the product behind the purifying, confirm HPV gene type to be detected.

4. like the method for the said detection human papilloma virogene type of claim 3, it is characterized in that the sequence of other corresponding amplimer of HPV genotype to be detected is in the said step (1):

Extending primer sequence is:

。

5. like the method for the said detection human papilloma virogene type of claim 3; It is characterized in that; In the said step (1) with the betaglobulin gene as the internal reference gene, the amplimer sequence of employing is SEQ ID NO.11 and SEQ IDNO.24, extending primer sequence is SEQ ID NO.42.

6. like the method for claim 3 or 4 said detection human papilloma virogene types, it is characterized in that said amplimer is the PAGE purifying, said extension primer is the HPLC purifying.

7. like the method for the said detection human papilloma virogene type of claim 3; It is characterized in that; Also be included in and add positive control and negative control in the reaction; Said positive control HPV18 recombinant plasmid, and mix through detecting no HPV infected person genomic dna background, said negative control is aseptic double-distilled water and mouse liver DNA.

8. like the method for the said detection human papilloma virogene type of claim 3; It is characterized in that; The preparation process that also comprises the HPV plasmid standard; And the step that adopts these standard substance that primer specificity and sensitivity are tested, said HPV plasmid standard is for inserting the PMD plasmid of human papillomavirus MY09/MY11 sequence.