CN103849584A - Triethylamine degrading bacterium and application thereof - Google Patents
Triethylamine degrading bacterium and application thereof Download PDFInfo
- Publication number
- CN103849584A CN103849584A CN201410018679.7A CN201410018679A CN103849584A CN 103849584 A CN103849584 A CN 103849584A CN 201410018679 A CN201410018679 A CN 201410018679A CN 103849584 A CN103849584 A CN 103849584A
- Authority
- CN
- China
- Prior art keywords
- triethylamine
- application
- waste water
- concentration
- bacterial strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to a strain of triethylamine degrading bacterium and application thereof. The triethylamine degrading bacterium T-5 belongs to bacillus, and is collected in the China Center for Type Culture Collection on 21 November, 2013 with the collection number CCTCC NO:M2013588. The bacterial strain can grow and breed by taking triethylamine as a carbon source as well as a nitrogen source, and can grow and breed in a shake flask containing 4,000mg/L triethylamine, and the degrading rate of 1,500mg/L triethylamine within 72 hours is 100 percent. During treatment of industrial waste water containing high-concentration triethylamine, when the concentration of triethylamine is lower than 2,000mg/L, the removing rate of triethylamine is up to 100 percent, and the COD (Chemical Oxygen Demand) removing rate is increased by 30-40 percent. The bacterial strain can be applied to biological enhancement treatment of pharmaceutical waste water and pesticide processing waste water, and is wide in application prospect.
Description
Technical field
The invention belongs to biological technical field, be specifically related to strain triethylamine degradation bacteria and an application thereof.
Background technology
Triethylamine is the synthetic important source material of organic solvent and chemical industry, the catalyzer of the poly-carbonic acid vinegar phosgene of conduct in synthetic resins is manufactured, the stopper of tetrafluoroethylene and thiofide; Also can be used as food preservatives, emulsifying agent; Still manufacture the raw material of fuel, sterilant simultaneously.Triethylamine is a kind of fatty amine, molecular formula (C2H5)
3n, has strong degree ammonia stink, irritant, inflammable, volatile.
Triethylamine is extensively present in the factory effluents such as organic synthesis, agricultural chemicals, pharmacy, fuel, adopts physico-chemical process at present for the processing containing triethylamine waste water more.Compared with physico-chemical process, it is large that biological treatment has treatment capacity, and cost is low, and mild condition does not produce the features such as secondary pollution, more meets the requirement of the friendly type of constructing environment and conservation-minded society.But traditional biologic treating technique is difficult to meet the environmental requirement of increasingly stringent.In recent years, biological reinforcing technology, not changing on the basis of existing treatment facility, by the interpolation of microorganisms with specific functions, improves the removal efficiency of original biological treatment system to target contaminant, has greatly improved sewage treatment capacity.Chinese invention patent CN101935625A discloses the microbial inoculum of a kind of triethylamine degradation bacteria and production thereof, and this bacterium only, for laboratory shaking flask, does not relate to practical application in industry.Therefore in the processing that, screening obtains can removing the efficient bacterium of triethylamine and being applied to trade effluent from physical environment, be significant.
Summary of the invention
For the triethylamine of effectively degrading, the invention discloses a strain triethylamine degradation bacteria, and in the trade effluent that is successfully applied to contain triethylamine.
One of object of the present invention is to disclose the bacterial strain T-5 of a high-efficiency degradation triethylamine.
Triethylamine degradation bacteria T-5 of the present invention belongs to bacillus cereus (Bacillus cereus.Frankland T-5) and is preserved in Chinese Typical Representative culture collection center (China Center for Type Culture Collection, be called for short CCTCC), deposit number CCTCC No:M2013588 preservation date on November 21st, 2013.
The 16S rDNA sequence of bacterial strain T-5 of the present invention is:
GATGGATTAAGAGCTTGCTCTTATGAAGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCCATAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATAACATTTTGAACCGCATGGTTCGAAATTGAAAGGCGGCTTCGGCTGTCACTTATGGATGGACCCGCGTCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAACAAGTGCTAGTTGAATAAGCTGGCACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACT?ACGTGCCAGCAGCCGCGGTAATACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGAGATATGGAGGAACACCAGTGGCGAAAGCGACTTTCTGGTCTGTAACTGACACTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTAAAGGGTTTCCTGCCTTTAGTGCTGAAGTTAACGCATTAAGCACTCCGCTGGGGAGTACGGCCGCAAGGCTGAAACTCAAAGGAATTGACGGGGCCCGCACAAGCGTGAG
Above-mentioned 16SrDNA portion gene sequence (being SEQ ID NO.1) and GenBank accession number are that the 16SrDNA sequence of the bacillus cereus (Bacillus cereus) delivered in KF877717 is carried out homology comparison, and similarity reaches 99%.
Triethylamine degradation bacteria T-5 of the present invention also has following character:
Described bacterial strain T-5 is gram-positive microorganism;
Described bacterial strain T-5 is pink through cultivating the bacterium colony of gained, and neat in edge is rounded, smooth moistening, central protuberance;
The optimal temperature of described bacterial strain T-5 growth is that 25～35 ℃, appropriate pH are 5.5～7.5.
Those skilled in the art can cultivate triethylamine degradation bacteria T-5 of the present invention according to ordinary method, but more preferred cultural method is: bacterial strain T-5 is inoculated in certain volume proliferated culture medium, shaking table vibration 3 days under the condition that 25～35 ℃, pH are 5.5～7.5, obtain T-5 bacteria suspension, thalline quantity is 10
9individual/mL; T-5 bacterial suspension inoculation is carried out to enlarged culturing in proliferated culture medium, and culture condition is the same; T-5 bacteria suspension is coated to solid medium flat board, after bacterium colony grows, be placed under 4 ℃ of conditions and preserve as bacterial classification.Proliferated culture medium composition described above is: KH
2pO
4, 0.09; K
2hPO
4, 0.22; NaH
2pO
4, 0.26; MgSO
47H
2o, 0.23; CaCl
2, 0.28; FeCl
3, 0.003; Triethylamine, 1.5(unit: g/L).Described solid medium composition is: KH
2pO
4, 0.09; K
2hPO
4, 0.22; NaH
2pO
4, 0.26; MgSO
47H
2o, 0.23; CaCl
2, 0.28; FeCl
3, 0.003; Triethylamine, 1.0; Agar, 15～20.(unit: g/L).
Bacterial strain T-5 of the present invention can carry out using triethylamine as Carbon and nitrogen sources growth and breeding and by its degraded:
In solid medium, KH
2pO
4, K
2hPO
4, NaH
2pO
4, MgSO
47H
2o, CaCl
2, FeCl
3deng inorganic salt composition, for maintaining the required osmotic pressure of strain growth, agar is only as the carrier of strain growth, and triethylamine is bred Carbon and nitrogen sources is provided for strain growth.
T-5 bacteria suspension is coated to the solid medium flat board that triethylamine concentration is 4000mg/L, visible colony growth breeding.See Fig. 1.T-5 bacteria suspension is inoculated in the proliferated culture medium that 200mL triethylamine concentration is 1500mg/L by 1% inoculum size, 25～35 ℃ of constant temperature culture, pH is 5.5～7.5, and rotating speed is 150rpm, and this bacterium is degradable by it in 72h.Detected result is shown in Fig. 2 and Fig. 3.
Two of object of the present invention is this bacterial strain T-5 for the treatment of the trade effluent that contains triethylamine.
In the present invention, the measuring method of triethylamine is vapor-phase chromatography (GB/T23964-2009), and described COD measuring method is potassium dichromate process (GB11914-89).
T-5 bacteria suspension is inoculated in the waste water that 200mL triethylamine concentration is 1500mg/L by 1% inoculum size, 25～35 ℃ of constant temperature culture, pH is 5.5～7.5, and rotating speed is 150rpm, and this bacterium is degradable by it in 72h.
T-5 bacteria suspension is added to and in Sludge System, carries out biological reinforcedly by different dosages, and operational conditions: pH is 5.5～7.5, and temperature is 25～35 ℃, dissolved oxygen is 3.0～4.0mg/L, triethylamine concentration is 1400～2000mg/L, operation scheme: water inlet, aeration, stop aeration and sedimentation, draining is a cycle of operation, and hydraulic detention time 2～3 days adds bacteria suspension 1 time in every 2 days, add 2 months and after stable effluent quality, stop adding, system continuous service.Control group is set simultaneously, and control group does not add bacteria suspension, and other operation scheme are identical with biological reinforced group, results of regular determination water outlet triethylamine content and COD.
The present invention compared with prior art, has following outstanding technique effect:
Bacterial strain of the present invention can utilize triethylamine to carry out growth and breeding as Carbon and nitrogen sources, can be in the laboratory shaking flask that contains 4000mg/L triethylamine growth and breeding, under the shaking flask condition of laboratory, be 100% to degradation rate in 1500mg/L triethylamine 72h.To containing in the processing of high density triethylamine trade effluent, in the time that triethylamine concentration is less than 2000mg/L, the clearance of triethylamine is reached to 100%, COD clearance and improve 30～40%.
Described bacterial strain can be applicable to the biological reinforced processing of pharmacy waste water, pesticide processing waste water, checking by the embodiment of the present invention is known: the detection of biological strengthening group system continuous service water outlet detected result of 4 months is the clearance of triethylamine to be reached to 100%, COD clearance reach 90%.
Described bacterial strain is added in Sludge System can reach Screening of high efficient paracetamolum, and in Industrial Wastewater Treatment, most widely used Sludge System operation process is sequencing batch active sludge (being called for short SBR) and Cyclic Activated Sludge System (being called for short CASS) at present.SBR technique has that sludge settling is effective, output is few, does not need to arrange second pond, adapts to the advantages such as water quality and quantity variation, and cyclic activated sludge system has increased biological selecting area, has strengthened the hydrolytic action to hardly degraded organic substance.Described bacterial strain is added to and in above-mentioned two kinds of Sludge System, has that bacterial classification is adding less, tolerance triethylamine concentration advantages of higher, be applicable to the processing containing the trade effluent of triethylamine.
In addition, it is large that biological treatment of the present invention has treatment capacity, and cost is low, and mild condition does not produce the features such as secondary pollution, is especially applicable to the requirement of the friendly type of constructing environment and conservation-minded society, and application prospect is boundless.
Accompanying drawing explanation
Fig. 1 .T-5 is at the solid medium colonial morphology of 4000mg/L triethylamine concentration;
Fig. 2. triethylamine content in original proliferated culture medium;
Fig. 3. triethylamine content in proliferated culture medium after T-5 processes 72h.
Embodiment
Now further describe beneficial effect of the present invention by following examples, embodiment is only for the object of illustration, do not limit the scope of the invention, within the apparent change that those of ordinary skills make according to the present invention simultaneously and modification are also contained in the scope of the invention.
Embodiment 1: the cultural method of triethylamine degradation bacteria T-5
Bacterium T-5 of the present invention is inoculated in 10mL proliferated culture medium, under the condition that is 7.5, is placed in constant temperature oscillation shaking table and vibrates 3 days at 25 ℃, pH, obtain T-5 bacteria suspension, thalline quantity is 10
9individual/mL.T-5 bacteria suspension is coated to solid medium flat board, after bacterium colony grows, be placed under 4 ℃ of conditions and preserve as bacterial classification.
Wherein, described proliferated culture medium composition is: KH
2pO
4, 0.09; K
2hPO
4, 0.22; NaH
2pO
4, 0.26; MgSO
47H
2o, 0.23; CaCl
2, 0.28; FeCl
3, 0.003; Triethylamine, 1.5(unit: g/L).
Described solid medium composition is: KH
2pO
4, 0.09; K
2hPO
4, 0.22; NaH
2pO
4, 0.26; MgSO
47H
2o, 0.23; CaCl
2, 0.28; FeCl
3, 0.003; Triethylamine, 1.0; Agar, 15～20.(unit: g/L).
Embodiment 2: the enlarged culturing method of triethylamine degradation bacteria T-5
The T-5 bacteria suspension 2mL getting in embodiment 1 is inoculated in enlarged culturing in 200mL proliferated culture medium, under the condition that is 5.5, is placed in constant temperature oscillation shaking table and vibrates 3 days at 35 ℃, pH, obtains T-5 bacteria suspension, and thalline quantity is 10
9individual/mL.Get above-mentioned T-5 bacteria suspension 20mL and be inoculated in enlarged culturing in 2000mL proliferated culture medium, under the condition that is 7.0, be placed in constant temperature oscillation shaking table and vibrate 3 days at 30 ℃, pH, obtain T-5 bacteria suspension, thalline quantity reaches 10
9individual/mL.
The shake flat experiment of embodiment 3:T-5 to 1500mg/L waste water
Get the cultured T-5 bacteria suspension of embodiment 1 2mL and be inoculated in the waste water that 200mL triethylamine concentration is 1500mg/L, 30 ℃ of constant temperature culture, pH is 7.0, reacts 72 hours.After getting the centrifugal 5min of 10mL bacteria suspension 3000rpm, get supernatant liquor mensuration, do not detect triethylamine.
Embodiment 4:T-5 is biological reinforced to agricultural chemicals waste water
Get Shandong insecticide factory factory effluent, waste water quality is: triethylamine 96354mg/L, COD84432mg/L.Be after 1400mg/L, COD concentration are 1200mg/L by above-mentioned wastewater dilution to triethylamine concentration, get 30L and join in the Sludge System with SBR process operation of 40L, get the cultured T-5 bacteria suspension of embodiment 2 150mL be added in above-mentioned Sludge System, carry out biological reinforced.Operational conditions: pH is 5.5, and temperature is 35 ℃, and dissolved oxygen is 3.0mg/L, operation scheme: water inlet, 1h, aeration 12h, precipitation 4h, draining 1h is one-period, hydraulic detention time 2 days, adds bacteria suspension 1 time in every 2 days, adds 150mL at every turn, after 2 months, stops adding.Control group is set simultaneously, does not add bacteria suspension, other operation scheme are identical with biological reinforced group, the clearance of detection of biological strengthening group and control group triethylamine and COD, and the system continuous service water outlet detected result of 4 months is as table 1.
Table 1 adopts biological reinforcing method to the dense triethylamine water treatment effect of height
Embodiment 5:T-5 is biological reinforced to pharmacy waste water
Get Shandong pharmaceutical factory factory effluent, waste water quality is: triethylamine 68316mg/L, COD51432mg/L.Be after 2000mg/L, COD concentration are 1500mg/L by above-mentioned wastewater dilution to triethylamine concentration, get 500L and join in the Sludge System with cyclic activated sludge system operation of 550L, get the cultured T-5 bacteria suspension of embodiment 2 1500mL be added in above-mentioned Sludge System, carry out biological reinforced.Operational conditions: pH is 7.5, and temperature is 25 ℃, and dissolved oxygen is 4.0mg/L, operation scheme: water inlet aeration 2h, aeration 12h, sedimentation and drawing 4h is one-period, hydraulic detention time 3 days, within every 2 days, add bacteria suspension 1 time, add 1500mL at every turn, after 2 months, stop adding.Control group is set simultaneously, does not add bacteria suspension, other operation scheme are identical with biological reinforced group, the clearance of detection of biological strengthening group and control group triethylamine and COD, and the system continuous service water outlet detected result of 4 months is as table 2.
Table 2 adopts biological reinforcing method to the dense triethylamine water treatment effect of height
Claims (10)
1. strain triethylamine degradation bacteria (Bacillus) bacterial strain T-5, its deposit number is CCTCC NO:M2013588.
2. triethylamine degradation bacteria T-5 as claimed in claim 1, is characterized in that, described bacterial strain T-5 can utilize triethylamine to carry out growth and breeding as Carbon and nitrogen sources.
3. the application of triethylamine degradation bacteria T-5 in triethylamine degraded as claimed in claim 1 or 2.
4. the application of triethylamine degradation bacteria T-5 in the trade effluent that contains triethylamine as claimed in claim 1 or 2.
5. application as claimed in claim 4, is characterized in that, described trade effluent is pharmacy waste water or pesticide processing waste water.
6. application as claimed in claim 5, is characterized in that, the triethylamine concentration in described trade effluent is less than 4000mg/L, and preferably, the triethylamine concentration in described trade effluent is less than 2000mg/L.
7. application as claimed in claim 5, is characterized in that, the trade effluent that adopts biological reinforcing method processing to contain triethylamine.
8. application as claimed in claim 7, is characterized in that, described biological reinforcing method for to add described t bacteria-5 in Sludge System.
9. application as claimed in claim 8, is characterized in that, described dosing method is to add once for every two days, adds continuously two months.
10. application as claimed in claim 8, is characterized in that, described Sludge System is CASS system or SBR system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410018679.7A CN103849584B (en) | 2014-01-15 | 2014-01-15 | One strain triethylamine degradation bacteria and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410018679.7A CN103849584B (en) | 2014-01-15 | 2014-01-15 | One strain triethylamine degradation bacteria and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103849584A true CN103849584A (en) | 2014-06-11 |
| CN103849584B CN103849584B (en) | 2016-05-25 |
Family
ID=50857709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410018679.7A Active CN103849584B (en) | 2014-01-15 | 2014-01-15 | One strain triethylamine degradation bacteria and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103849584B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106976963A (en) * | 2017-04-05 | 2017-07-25 | 新宇药业股份有限公司 | Black Liquor with Efficient Bacteria strengthens the biochemical processing method of dimethylamine waste water |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781024A (en) * | 2009-12-01 | 2010-07-21 | 吉林大学 | Composite microbial inoculum for quickly degrading nitrobenzene and phenylamine, and preparation method and application thereof |
| CN101935625A (en) * | 2010-06-12 | 2011-01-05 | 南京农业大学 | Triethylamine degrading bacterium and microbial agent produced therefrom |
| CN103243057A (en) * | 2013-05-27 | 2013-08-14 | 江苏南资环保科技有限公司 | Pseudomonas SYA-1 for degrading triethylamine and application of pseudomonas SYA-1 |
-
2014
- 2014-01-15 CN CN201410018679.7A patent/CN103849584B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781024A (en) * | 2009-12-01 | 2010-07-21 | 吉林大学 | Composite microbial inoculum for quickly degrading nitrobenzene and phenylamine, and preparation method and application thereof |
| CN101935625A (en) * | 2010-06-12 | 2011-01-05 | 南京农业大学 | Triethylamine degrading bacterium and microbial agent produced therefrom |
| CN103243057A (en) * | 2013-05-27 | 2013-08-14 | 江苏南资环保科技有限公司 | Pseudomonas SYA-1 for degrading triethylamine and application of pseudomonas SYA-1 |
Non-Patent Citations (3)
| Title |
|---|
| YOU YINGCAI ET AL: "STUDIES ON GRAFT COPOLYMERIZATION OF DL-LACTIDE ON CORN STARCH AND BIODEGRADABILITY OF THE COPOLYMERS", 《CHINESE JOURNAL OF REACTIVE POLYMERS》 * |
| 官雪芳等: "农药厂不同生境中甲胺磷降解细菌的分离、筛选与鉴定", 《福建农业学报》 * |
| 殷峻等: "三甲胺降解细菌的分离、降解特性及其系统发育分析", 《环境科学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106976963A (en) * | 2017-04-05 | 2017-07-25 | 新宇药业股份有限公司 | Black Liquor with Efficient Bacteria strengthens the biochemical processing method of dimethylamine waste water |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103849584B (en) | 2016-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Luo et al. | Isolation, identification, and optimization of culture conditions of a bioflocculant‐producing bacterium Bacillus megaterium sp1 and its application in aquaculture wastewater treatment | |
| CN109055282B (en) | Novel Klebsiella pneumoniae strain and separation method and application thereof | |
| CN107400650A (en) | One kind deformation pseudomonad and its application | |
| CN102586160B (en) | Stenotrophomonas maltophilia DS4 | |
| CN108753662B (en) | Low-temperature dimethyl phthalate high-efficiency degrading bacterium and fermentation method thereof | |
| CN103923867B (en) | Mixed bacterial microbial preparation and in process containing the application in nitric nitrogen waste water | |
| CN111733113B (en) | COD (chemical oxygen demand) degrading strain and application thereof | |
| CN105713862A (en) | Bacterial strain capable of degrading pyridine and ammonia nitrogen, preparation method and application of bacterial strain | |
| CN107603907B (en) | Bacillus aryabhattai GH-9 and application thereof | |
| CN102583780A (en) | Application of Stenotrophomonas maltophilia DS4 for degrading organic pollutants in saponin waste water | |
| CN109337832A (en) | A kind of anthropi of resistance to high ammonia nitrogen heterotrophic nitrification-aerobic denitrification and its application | |
| CN109337825B (en) | Paecilomyces beijing strain LYZ7 and application thereof | |
| CN109609404B (en) | Bacillus HY-1 and application thereof in degrading organic pollutants | |
| CN105112317A (en) | High-efficiency atrazine degrading bacterium and screening method thereof, and application of high-efficiency atrazine degrading bacterium in biodegradation of atrazine in farmland waste water | |
| CN104560777A (en) | High-tolerance phenylamine degrading bacterium and application thereof | |
| CN102250776A (en) | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure | |
| CN102093970A (en) | Low-temperature aniline-degrading strain | |
| CN104560728B (en) | One plant of trichoderma viride with ethyl acetate degradation capability and its application | |
| CN110699287B (en) | Bacterial strain with function of degrading organic amine substances and application thereof | |
| CN116426443B (en) | Bacterial strain with quorum sensing behavior and application thereof in promotion of anaerobic ammonia oxidation denitrification | |
| CN105154350B (en) | A kind of salt tolerant denitrification compound bacteria agent and its preparation method and application | |
| CN102070283B (en) | Technique for efficiently treating livestock/poultry culture wastewater | |
| CN109052624B (en) | Mobile method and device for purifying sewage and black and odorous water | |
| CN103849584B (en) | One strain triethylamine degradation bacteria and application thereof | |
| CN103243057B (en) | Pseudomonas SYA-1 for degrading triethylamine and application of pseudomonas SYA-1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: A triethylamine degrading bacterium and its application Effective date of registration: 20211224 Granted publication date: 20160525 Pledgee: Industrial and Commercial Bank of China Limited Feixian sub branch Pledgor: SHANDONG NEW TIME PHARMACEUTICAL Co.,Ltd. Registration number: Y2021980016193 |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right | ||
| PC01 | Cancellation of the registration of the contract for pledge of patent right |
Date of cancellation: 20221028 Granted publication date: 20160525 Pledgee: Industrial and Commercial Bank of China Limited Feixian sub branch Pledgor: SHANDONG NEW TIME PHARMACEUTICAL Co.,Ltd. Registration number: Y2021980016193 |
|
| PC01 | Cancellation of the registration of the contract for pledge of patent right | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: A strain of triethylamine degrading bacteria and its application Effective date of registration: 20221103 Granted publication date: 20160525 Pledgee: Industrial and Commercial Bank of China Limited Feixian sub branch Pledgor: SHANDONG NEW TIME PHARMACEUTICAL Co.,Ltd. Registration number: Y2022980020531 |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right |