CN103834666B - A kind of cotton GhHSFA7 gene coded sequence and application thereof - Google Patents
A kind of cotton GhHSFA7 gene coded sequence and application thereof Download PDFInfo
- Publication number
- CN103834666B CN103834666B CN201310642386.1A CN201310642386A CN103834666B CN 103834666 B CN103834666 B CN 103834666B CN 201310642386 A CN201310642386 A CN 201310642386A CN 103834666 B CN103834666 B CN 103834666B
- Authority
- CN
- China
- Prior art keywords
- cotton
- ghhsfa7
- sequence
- polypeptide
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to a kind of at cotton (Gossypium? the nucleotide sequence of the GhHSFA7 transcription factor expressed in spp.) and protein polypeptide. This cotton GhHSFA7 nucleotide sequence and SEQ? ID? NO.3 has at least the homology of 70% from the nucleotide sequence of 1-1794 position DNA molecular. Does this cotton GhHSFA7 protein polypeptide, comprise and has SEQ? ID? the polypeptide of NO.4 aminoacid sequence or its conservative property variation polypeptide or its active fragments, or its reactive derivative. The method strengthening stress resistance of plant is obtained by the present invention, the nucleotide sequence that coding has cotton GhHSFA7 gene is transformed into plant, it is possible to improve the resistance of plant, especially salt tolerance, contribute to expanding the planting range of plant especially cotton, and can be used for the exploitation in saline and alkaline soil.
Description
Technical field
The present invention relates to the fields such as molecular biology, zymetology, physiology and genetically engineered. Specifically, the present invention relates to GhHSFA7 transcription factor protein and the nucleotide sequence thereof of a kind of expression in cotton. The present invention also relates to preparation method and the purposes of this albumen and nucleotide sequence.
Background technology
Cotton is important cash crop, and the long-term sown areas of cotton of China are at about 7,500 ten thousand mu. About 1,150 hundred million dollars of China's textile clothing industry export amount in 2005,2,570,000 tons, import cotton. According to current Cotton in China demand trend and supply capacity analysis, the cotton having 1/3 is needed to rely on import by China in period every year quite long from now on, and the pressure that cotton is ensured supply increases the weight of day by day. When currently guaranteeing grain security, it is more outstanding that ground contradiction striven by grain and cotton. Therefore, the area of the Cotton Production that stabilizes and increases must make full use of existing cultivated land resource. Growth and development of plants is produced serious impact by the soil salinization, is the important factor affecting agriculture production and ecotope. The long-term area suffered from drought of China's agriculture production reaches 200-270 ten thousand hectares, salinization cultivated area about 7,630,000 hectares (Li Zhijie etc., 2005). Therefore, it is to increase the salt resistance ability of the resistance of cotton particularly cotton for expanding the planting range of cotton, the tool of developing saline and alkaline soil is of great significance.
Transcription factor (transcriptionfactor) refers to can with the cis-acting elements generation specificity interaction of eukaryotic gene and to the DBP transcribing activation or restraining effect, and transcription factor regulates and controls the interaction network between complicated albumen. Existing research finds: the regulation and control of the abiotic stresses such as transcription factor wide participation plant drought, salt tolerant such as MYB, WRKY, bZIP, AP2/EREBP, but research about abiotic stresses such as HSF transcription factor involved in plant salt tolerants is very few.
HSF(heatshocktranscriptionfactor) it is a kind of transcription factor with transcripting regulating activity, all may being activated under many adverse environmental factors, such as plant can Enhanced expressing when high temperature, salt evil, oxidative stress and pathogenic bacterial infection. HSF after activation mediates the expression regulation of heat shock gene, and then the expression amount of control heat shock protein, to reach the object resisting adverse circumstance, thus maintains the stability in plant materials, makes plant can carry out normal growth and development process.
It has been separated since obtaining first HSF gene from yeast from nineteen ninety, from multiple unifacial leaf and dicotyledons, it is cloned into corresponding HSF gene at present, but the HSF gene in cotton rare people research, particularly HSF rare report in participation raising plant salt tolerance ability.
In the present invention, we are cloned into transcription factor GhHSFA7 gene from cotton (Gossypiumspp.), and have been analyzed by its express spectra, prove that this gene has the ability improving plant salt tolerance by transgenic approach.
Before the present invention is announced, not yet have any open or reported the cotton GhHSFA7 protein sequence and nucleotide sequence thereof mentioned in present patent application.
Summary of the invention
First object of the present invention is just to provide a kind of new cotton transcription factor gene, and this gene is cotton GhHSFA7 gene.
2nd object of the present invention is to provide a kind of new cotton Protein G hHSFA7.
3rd object of the present invention is to provide and a kind of utilizes recombinant technology to express above-mentioned new cotton GhHSFA7 albumen and the method for nucleotide sequence.
Present invention also offers the application that this kind of cotton GhHSFA7 protein polypeptide and encoding sequence are utilizing transgenic technology to increase stress resistance of plant.
In one aspect of the invention, provide a kind of DNA molecular isolated, this molecule comprises: have at least the homology of 70% in the nucleotide sequence encoding the polypeptide with cotton GhHSFA7 protein active, described nucleotide sequence and SEQIDNO.3 from the nucleotide sequence of 1-1794 position DNA molecular; Or described nucleotide sequence can under moderate stringency conditions with SEQIDNO.3 in from the nucleotide sequence hybridization of Nucleotide 1-1794 position. Goodly, described sequence encoding has the polypeptide of the aminoacid sequence shown in SEQIDNO.4. More preferably, described sequence has in SEQIDNO.3 the nucleotide sequence from Nucleotide 1-1794 position.
In the another aspect of the present invention, it provides a kind of cotton GhHSFA7 protein and peptide isolated, it comprises: have the polypeptide of SEQIDNO.4 aminoacid sequence or its conservative property variation polypeptide or its active fragments, or its reactive derivative. Goodly, this polypeptide is the polypeptide with SEQIDNO.4 sequence.
In the another aspect of the present invention, additionally providing a kind of carrier, it comprises above-mentioned DNA molecular.
In the another aspect of the present invention, additionally provide a kind of host cell with above-mentioned vector. This host cell is cotton cells in instances.
In another aspect of the present invention, additionally providing a kind of method that generation has the polypeptide of cotton GhHSFA7 protein active, its step is as follows:
(1) what the nucleotide sequence that coding has cotton GhHSFA7 gene can operate is connected in expression regulation sequence, formation cotton GhHSFA7 expression vector, described nucleotide sequence and SEQIDNO.3 show the homology of at least 70% from the nucleotides sequence of Nucleotide 1-1794 position;
(2) expression vector in step (1) is proceeded to prokaryotic host cell, form the reconstitution cell of cotton GhHSFA7 gene;
(3) when applicable expression cotton GhHSFA7 polypeptide, the reconstitution cell in culturing step (2);
(4) polypeptide with cotton GhHSFA7 protein-active is isolated.
Goodly, the nucleotide sequence used in the method has the sequence of 1-1794 position in SEQIDNO.3.
In the another aspect of the present invention, additionally providing and a kind of utilize transgenic technology that the nucleotide sequence that coding has a cotton GhHSFA7 gene is transformed into Arabidopis thaliana to improve stress resistance of plant, its step is as follows:
(1) what the sequence that coding has cotton GhHSFA7 Nucleotide can operate is connected in expression of plants regulating and controlling sequence, formation is containing the homology showing at least 70% in the plant expression vector of cotton GhHSFA7 gene, described nucleotide sequence and SEQIDNO.3 from the nucleotides sequence of Nucleotide 1-1794 position;
(2) expression vector in step (1) is proceeded to agriculture bacillus, by the agriculture bacillus containing expression vector with eukaryotic host cell Dual culture, under 28 DEG C of conditions, light culture, after 1-2 days, obtains the transgenic Arabidopsis plants containing cotton GhHSFA7 gene and offspring by screening. Cotton GhHSFA7 gene has the effect increasing transgenic Arabidopsis plants salt tolerance.
Goodly, the nucleotide sequence used in the method has the sequence of 1-1794 position in SEQIDNO.3.
In the present invention, " separation ", " purifying " or " substantially pure " DNA refer to, the sequence that this DNA or fragment have been arranged in its both sides from native state is separated, also refer to that this DNA or fragment with under native state are separated with group part of nucleic acid, and separate with protein adjoint in cell.
In the present invention, term " encoding sequence of cotton GhHSFA7 protein " refers to that coding has cotton GhHSFA7 protein active polypeptide sequence, such as 1-1794 position nucleotide sequence and degenerate sequence thereof in SEQIDNO.3. This degenerate sequence refers to, is arranged in the 1-1794 position Nucleotide of SEQIDNO.3 sequence encoding frame, the sequence produced after having one or more codon to be replaced by the degenerate codon encoding same amino acid. Due to the degeneracy of codon, so being low to moderate the letter of about 70% with 1-1794 position nucleotide sequence homology in SEQIDNO.3 and also can encoding out the sequence described in SEQIDNO.4. This term also comprise can under moderate stringency conditions, better under height high stringency conditions with SEQIDNO.3 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 1-1794 position. This term also comprise with SEQIDNO.3 in from the homology at least 70% of the nucleotide sequence of Nucleotide 1-1794 position. Goodly at least 80%, more preferably at least 90%, the nucleotide sequence of best at least 95%.
This term also comprises coding to be had and the variant form of opening code-reading frame sequence in the SEQIDNO.3 of natural cotton GhHSFA7 gene identical function, these variant forms (but being not limited to): some (are generally 1-90, better ground 1-60, more preferably 1-20,1-10 best) disappearance of Nucleotide, insertion and/or replacement, and hold several of interpolation (to be generally within 60 at 5 ' and/or 3 ', within being 30 goodly, within being more preferably 10, within being 5 best) Nucleotide.
In the present invention, " substantially pure " protein or polypeptide refer to that it at least accounts at least the 20% of the total material of sample, it is preferred that at least 50%, more preferably at least 80%, best at least 90%(by dry weight or weight in wet base). Purity can be measured by any suitable method, as measured the purity of polypeptide by column chromatography, PAGE or HPLC method. Substantially the component with it that pure polypeptide is substantially free of under native state.
In the present invention, term " cotton GhHSFA7 albumen or polypeptide " refers to have the polypeptide of the SEQIDNO.4 sequence of cotton GhHSFA7 protein-active. This term also comprises the variant form with the SEQIDNO.4 sequence with natural cotton GhHSFA7 identical function. These variant forms comprise (but being not limited to): some (are generally 1-50, better ground 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally within 20, within being 10, within being more preferably 5 goodly) amino acid. Such as, in the art, when replacing with similar nature or similar amino acid, the function of protein can not usually be changed. Again such as, one is added or several amino acid also can not change the function of protein usually at C-terminal and/or N-terminal. This term also comprises active fragments and the reactive derivative of cotton GhHSFA7 albumen.
The variant form of the cotton GhHSFA7 polypeptide of the present invention comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutants, under high or low high stringency conditions can with the albumen coded by the DNA of the DNA hybridization of cotton GhHSFA7 gene and utilize the polypeptide or albumen that the antiserum(antisera) of anti-cotton GhHSFA7 polypeptide obtains. Except the polypeptide of almost total length, the present invention also comprises the soluble fragments of cotton GhHSFA7 polypeptide. Usually, this fragment has at least about 10 continuous print amino acid of cotton GhHSFA7 peptide sequence, at least about 30 continuous print amino acid usually, it is preferred that about 50 continuous print amino acid, at least about 80 better continuous print amino acid, at least about 100 best continuous amino acids.
In the present invention, " cotton GhHSFA7 conservative property variation polypeptide " refers to compared with the aminoacid sequence of SEQIDNO.4, has 10 at the most, it is preferred that 8 at the most, and better 5 amino acid at the most are replaced and form polypeptide by the amino acid that character is similar or close. These conservative propertys variation polypeptide preferably carries out replacing and produce according to table 1.
Table 1
| Initial residue | Representative replacement | Preferred replacement |
| Ala(A) | Val;Leu;Ile | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Invention also comprises the analogue of cotton GhHSFA7 albumen or polypeptide. The difference of these analogues and natural cotton GhHSFA7 polypeptide can be the difference on aminoacid sequence, it is also possible to is the difference not affecting on the modified forms of sequence, or haves both at the same time. These polypeptide comprise genetic variant that is natural or induction. Induce variation body can be obtained by various technology, as produced random mutagenesis by radiating or be exposed to mutagenic compound, it is also possible to by site-directed mutagenesis method or some other molecular biological technology. Analogue also comprises the analogue with the residue (such as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (such as ��, gamma-amino acid) that is that non-natural exists or synthesis. It will be understood that the polypeptide of the present invention is not limited to the polypeptide of the above-mentioned representativeness enumerated.
(usually the not changing primary structure) form of modification comprises: the chemically derived form of the polypeptide that body is interior or external is such as acetylize or carboxylated. Modify and also comprise glycosylation, as those carry out polypeptide that is glycosylation modified and that produce in the synthesis of polypeptide and processing or in further procedure of processing. Enzyme (glycosylase or deglycosylating enzyme such as Mammals) that these modifications can carry out glycosylation by being exposed to by polypeptide and complete. Modified forms also comprises the sequence with phosphorylated amino acid residue (such as Tyrosine O-phosphate enzyme, phosphoserine, phosphothreonine). Also comprise and modified thus improve its anti-proteolysis performance or optimize the polypeptide of solubility property.
In the present invention, various carrier known in the art can be selected, such as commercially available carrier, comprise plasmid, clay etc. When the cotton GhHSFA7 polypeptide of production the present invention, it is possible to cotton GhHSFA7 gene coded sequence can be operated, be connected in expression regulation sequence, thus form cotton GhHSFA7 protein expression vector.
As used herein, " what can operate is connected in " refers to a kind of like this situation, and namely some part of linear DNA molecule can affect the activity of same other parts of linear DNA molecule. Such as, if signal peptide DNA expresses as prerequisite and participates in the secretion of polypeptide, so signal peptide (secretion leader sequence) DNA be exactly can operate be connected in polypeptid DNA; If transcribing of promotor control sequence, so it be can operate be connected in encoding sequence; If ribosome bind site is placed in when can make position that it is translated, so it be can operate be connected in encoding sequence. Generally, " what can operate is connected in " means adjacent, then means in reading frame adjacent for secretion leader sequence.
In order to obtain the dot matrix of the cotton cDNAs relevant to cotton GhHSFA7 gene, it is possible to screen Cotton cDNA libraries with DNA probe, these probes are under low high stringency conditions, with 32P, all or part of of cotton GhHSFA7 gene are cooked what radioactivity marked and obtain. The cDNA library being best suited for screening is the library from cotton plants different tissues. Building is that biology field is well-known from the method for cell interested or the cDNA library of tissue, and the library referred in this research is often referred to the mitogenetic vigorous tissues such as the young leaflet tablet of cotton, ovary. In addition, many such cDNA libraries can also buy, such as, purchased from companies such as Clontech, Stratagene. This kind of screening method can identify the nucleotide sequence of the gene family relevant to cotton GhHSFA7.
The cotton GhHSFA7 gene nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually. For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA library or by the cDNA library prepared by ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence. When sequence is longer, it is often necessary to carry out twice or repeatedly pcr amplification, and then the fragment amplified each time is stitched together by correct order.
Once obtain relevant sequence, so that it may to obtain relevant sequence in large quantity with recombination method. This is normally cloned into carrier, then proceeds to cell, then obtains relevant sequence by ordinary method separation from the host cell after propagation.
In addition, also relevant sequence can be synthesized by the method for artificial chemistry synthesis. Before the application, prior art by first synthesizing multiple polynucleotide small segment, and then can carry out connecting and obtain the nucleotide sequence of code book invention cotton GhHSFA7 gene completely. Then, this nucleotide sequence can be introduced in this area in various existing DNA molecular (such as carrier) and cell.
Below in conjunction with specific embodiment, set forth the present invention further. Limit the scope of the invention it will be understood that these embodiments are only not used in for illustration of the present invention. The experimental technique of unreceipted concrete condition in the following example, usual conveniently condition, such as Sambrook equimolecular clone: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition that manufacturer advises.
Accompanying drawing explanation
Fig. 1 is the cotton GhHSFA7 gene relative expression quantity in upland cotton root (A is the experimental result that 150mMNaCl processes, and B is the result of 150mM treatment with mannitol, and WT is untreated control group) under salt stress (A) and drought stress (B) of the present invention.
Fig. 2 is cotton GhHSFA7 gene plant expression vector figure (LB represents left side circle, and CaMV35S represents promotor, and GhHSFA7 represents goal gene, and NOS represents terminator, and RB represents right margin) of the present invention.
Fig. 3 is the Arabidopis thaliana homozygous plants PCR electrophorogram of process LAN GhHSFA7 gene.
The transgenic Arabidopsis plants salt tolerance that Fig. 4 is process LAN GhHSFA7 gene is analyzed (root length (A) under 150mMNaCl treatment condition, fresh heavy (B), dry weight (C), chlorophyll content (D) are measured, n > 3).
Embodiment
The clone of embodiment 1 cotton GhHSFA7 gene
1. separate tissue (isolation)
Liquid nitrogen freezen protective it is placed in immediately, it should be noted that the material selected by this experiment and the cotton variety material selected do not have inevitable contacting after taking the ovary of field cotton.
The separation of 2.mRNA and reverse transcription (mRNAisolationandreversetranscription)
Get portion of tissue, grind with mortar broken, add the 50ml pipe filling cell pyrolysis liquid, fully after vibration, then move in glass homogenizer. Move after homogenate to 50ml and newly manage, extracted total RNA (TRIzolReagents, Gibco, NY, USA). Total serum IgE quality is identified with denaturing formaldehyde gel electrophoresis.
Takara ThermoScript II (MLV) test kit (Dalian, China) is utilized to be inverted to cDNA.
3. the full-length clone (CloningofFull-lengthcDNA) of gene
According to cotton GhHSFA7 conserved sequence, design primer (primer 1:ATGAATCCGTATTTTCCGG; Primer 2: CTACTTTGGACTTGAACCC), utilize homologous genes clone's principle, adopt the method (GibcoBRL test kit) of PCR: 94 DEG C of denaturation 3min; 94 DEG C of 30sec, 55 DEG C of 30sec, 72 DEG C of 2min, totally 35 circulations; 72 DEG C extend 10min, obtain the GhHSFA7 gene cDNA sequence of cotton from the cDNA of cotton.
PCR primer reclaims, and is connected on PMD18T-simple carrier, transfers to biotech firm to check order. Return the amino acid coded by sequence there is the more typical feature of HSF protein to comprise DNA land and many polymeric areas. Its sequence is shown in SEQIDNO.3, and this unnamed gene is GhHSFA7 gene.
Embodiment 2: the sequence information of cotton GhHSFA7 gene and homology analysis
In the present invention, the length of cotton GhHSFA7 full length gene cDNA is 1794bp, and detailed sequence is shown in SEQIDNO.3. The aminoacid sequence of cotton GhHSFA7 is derived, totally 362 amino-acid residues according to full-length cDNA. Detailed sequence is shown in SEQIDNO.4.
The protein blast program encoded by the full-length cDNA of GhHSFA7 and the homologous protein of corn, wheat, Arabidopis thaliana and tobacco carry out sequence alignment, found that to there is certain homology between them. Therefore, the HSF gene of GhHSFA7 gene and corn, paddy rice and Arabidopis thaliana compares on protein level, and except conservative section, GhHSFA7 gene and other albumen homologies are lower than 50%.
Embodiment 3: the expression amount of the GhHSFA7 gene in cotton under adverse environmental factor
Coercing the condition with drought stress with 150mMNaCl and 150mM N.F,USP MANNITOL analog salt respectively, detection is the expression amount of GhHSFA7 gene in cotton under this adverse environmental factor.
1. choosing the sowing cotton seedling of latter 2 weeks, it carries out the process of 150mMNaCl and 150mM N.F,USP MANNITOL respectively, the treatment time is 30min, 1h, 2h, 3h, 6h.
2. the RNA at difference extraction process material and undressed Radix Gossypii position, and carry out reverse transcription and obtain cDNA.
3. carry out RT-PCR, the expression amount of GhHSFA7 when detection different treatment.
The results are shown in Figure 1, GhHSFA7 gene is subject to salt stress (1A) and the induction of drought stress (1B) as seen from the figure, illustrates that GhHSFA7 gene take part in the intracellular signaling process of salt stress and drought stress.
Experimental example 4: containing the structure of goal gene (cotton GhHSFA7 gene) expression vector
Complete encoding sequence (SEQIDNO.3) according to cotton GhHSFA7, design amplifies the primer (SEQIDNO.1 and SEQIDNO.2) of complete coding reading frame, and introduce the attB joint of Gateway system on positive anti-primer respectively, so that construction of expression vector. The amplified production obtained in embodiment 1 is as template, after pcr amplification, the cDNA sequence of cotton GhHSFA7 gene is cloned into intermediate carrier (such as pDONR-Zeo), it is cloned into plant expression vector (such as pEarlyGate101) further, at the expression vector (such as Fig. 2) ensureing to identify under the prerequisite of reading frame, then proceeded in agriculture bacillus (GV3101).
Experimental example 5: the acquisition of the Arabidopis thaliana positive plant of overexpression GhHSFA7 gene
1. choose the positive bacterium colony (experimental example 4) got on YEB selection flat board with sterile toothpick, it is inoculated in 2mlYEB liquid (Rif+,Gen+,Kan+), 28 degree, 200rpm shaking culture 24-36 hour;
2. the centrifugal 10min of 4,000g under room temperature;
3. abandoning supernatant, thalline 1/2MS liquid nutrient medium suspends, and the 5-20 being diluted to original volume doubly, makes the OD of bacterium liquid600About=0.5;
4. select the Arabidopsis plant bloomed to carry out being stained with flower to infect;
5. sowing after Arabidopis thaliana maturation;
6. by T0 for, after Arabidopis thaliana planting seed, starting to spray Basta weedicide in time growing two panels cotyledon and carry out resistance screening;
7. the DNA extracting the Arabidopsis plant by screening carries out PCR positive detection;
8. choose positive plant and carry out the cultivation of T2 for plant, until obtaining T3 for positive plant.
The results are shown in Figure 3, GhHSFA7 gene has been transferred in Arabidopis thaliana and has formed homozygous plants as seen from the figure.
Experimental example 6: the salt tolerance analysis of the Arabidopis thaliana of GhHSFA7 gene in overexpression under adverse environmental factor
With 150mMNaCl analog salt stress conditions, the Arabidopsis plant of overexpression cotton GhHSFA7 gene under this adverse environmental factor is carried out phenotype analytical.
1. by the Arabidopis thaliana T3 of process LAN for planting seed on MS solid medium, growth 4d after transfer them on the MS solid medium containing 150mMNaCl continue cultivate 10d.
2. the respectively index such as the root length of Arabidopis thaliana seedling after measurement processing and wild type seedlings, dry weight, fresh heavy, chlorophyll content.
Can find out that from Fig. 4 (A) transfer-gen plant of overexpression GhHSFA7 gene root length under condition of salt stress is obviously greater than WT, wherein the average root length of wild-type Arabidopsis plants is 1.29 �� 0.05cm, the average root length that transgenic line ties up under salt stress is 2.28 �� 0.04cm, illustrate under condition of salt stress, process LAN plant is in order to resist adverse circumstance, increase the root length of plant, to stretch to the soil of more deep layer, reduce the absorption of salinity. From Fig. 4 (B) and 4(C) can find out under condition of salt stress, the fresh heavy and dry weight of process LAN plant is all obviously higher than WT, wherein the average fresh heavy and dry weight of the whole strain of wild-type Arabidopsis plants is respectively 5.76 �� 0.02mg and 4.10 �� 0.02mg, the average fresh heavy and dry weight of over-ground part is respectively 4.56 �� 0.03mg and 3.40 �� 0.02mg, and the average fresh heavy and dry weight of underground part is respectively 1.10 �� 0.02mg and 0.70 �� 0.02mg; The average fresh heavy and dry weight of the whole strain of transgenic line is respectively 9.78 �� 0.04mg and 6.52 �� 0.03mg, the average fresh heavy and dry weight of over-ground part is 7.76 �� 0.03mg and 5.34 �� 0.02mg, and the average fresh heavy and dry weight of underground part is 1.65 �� 0.02mg and 1.41 �� 0.02mg. Can finding out that, under condition of salt stress, the growth conditions of process LAN plant is obviously better than WT plant, GhHSFA7 gene really shows certain salt tolerance in Arabidopis thaliana. Under condition of salt stress, obviously there is the state of yellow in the blade of wildtype Arabidopsis thaliana, and some is even dead, but the yellowing leaf degree of process LAN plant is not obvious, and plant is all survival substantially. As can be seen from the chlorophyll content of Fig. 4 (D) is measured in comparison, under condition of salt stress, the chlorophyll content of wildtype Arabidopsis thaliana greatly reduces, this is consistent completely with practical situation, therefore further demonstrate that GhHSFA7 gene shows stronger salt tolerance in Arabidopis thaliana.
The sequence that the present invention relates to and mark divide row as follows:
(1) information of SEQIDNO.1
(i) sequence signature:
(A) length: 21bp
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linear
(ii) molecule type: oligonucleotide
(iii) sequence description: SEQIDNO.1
ATGAATCCGTATTTTCCGGTG
(2) information of SEQIDNO.1
(i) sequence signature:
(A) length: 21bp
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linear
(ii) molecule type: oligonucleotide
(iii) sequence description: SEQIDNO.2
CTACTTTGGACTTGAACCCAA
(3) information of SEQIDNO.3
(i) sequence signature:
(A) length: 1794bp
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linear
(ii) molecule type: Nucleotide
(iii) sequence description: SEQIDNO.3
1atgaatccgtattttccggtgaaggaagagtacccgaactcgagttattcacagtccgac
61gatgacccgccgctgatgatgatggggccgccgccaccccagccgatggagagtcttcgc
121gattcagggccaccgccattcctcacgaagacctttgacattgttgatgatcctagcact
181aattacatagtttcgtggagcagaggaggtagcagctttgttgtgtgggatcctcacgct
241ttctccactaatcttcttcctcgatatttcaagcacaataatttctctagtttcgttcgg
301caactcaatacttacgtaagtcttcttatctctcaacctctgttttcaattttccaaaaa
361aaaaaaaaaaaactttccaattttaaaaatttctctccaaatattattacatcaagctag
421aatttctattcccctggaggctaatgttgaattataatcttttagaaggtcaaaatgtaa
481tattgcagtttttagagtgactaaaccataatttcaccatttaagggccaaaggccactg
541cttcctccatttcatagcttcataatgattcttagtaaaatgtttacttgttaatgttct
601tctgggtttcactcaatttgtttgatttacgtttagtttttttttttttgcagcaataat
661tgatttttttttattcttttatctccttgttcattggatgcaaaaagttttcctctttaa
721attattgatgctcgatagttctggaatctcacatgacttacagatcatccaaagtttata
781tatattgttttttattacgtttttgtagagattgttctatcaccattattttaatccttt
841gagcaactcccttgggttttttcttattgttttttaatttttagaccttaatggttcttt
901ctggaagtgggacctcgctcaattatttattggttcttgtctgcatcaacaatgggaact
961aatcataaattattaacaagttttttttatttgatttattgtgtgatttcacttactgca
1021ggttttagaaagactgatccagataaatgggagtttgccaatgaagggttccttagaggc
1081cataagcatctgctgaagaacattaggagaagaaagaccacatctcagcccccaccatct
1141cagcaacctttaggtccttgtgttgaagttggcagatttggggtagatggggaagttggt
1201cgattgaagcgggacaagcaggtgttaatgatggaattagtgaagctaagacaacagcaa
1261caaagcactcgagcttatattgaagccatggaagaaaggttacaaggcactgaaaagaag
1321cagcaacaaatgatgtctttcttggctagagctatgcagaatccagctttcctccggcag
1381ttgatgcaacagaaggagaaaaggaaggagctcgaagaagccatgtcgaagaaaaggcga
1441cggccgatcgatcaacgacatgtaggccaatcgagccgaggtagcgaggggataaatccg
1501gttaaaactgaacctccggagtatggtgaatacggataccaagtgacagagttggaagca
1561ttggcactggaaatgcaagggtatggtagggccagaagggagcaagaggaaccacaagat
1621gaactccaacatggccatggccatgacagagagcttgatgaagggttttgggaagaatta
1681ttgaatgagagatttgaaggagagttggatatacctgaaggaggtgaaggtgaagatgaa
1741gatgtgaatgtactggctgaccggttggggtatttgggttcaagtccaaagtag
(4) information of SEQIDNO.4
(i) sequence signature:
(A) length: 362 amino acid
(B) type: amino acid
(C) chain: strand
(D) topological framework: linear
(ii) molecule type: polypeptide
Below the preferred embodiment of the present invention is described in detail. It is to be understood that the those of ordinary skill of this area just can make many modifications and variations according to the design of the present invention without the need to creative work. Therefore, the technical scheme that all technician in the art can be obtained by logical analysis, reasoning, or a limited experiment under this invention's idea on the basis of existing technology, all should by the determined protection domain of claim book.
Claims (4)
1. the DNA molecular isolated, it is characterised in that, described DNA molecular is the nucleotide sequence of coding cotton GhHSFA7 transcription factor protein, and described nucleotide sequence is as shown in SEQIDNO.3.
2. the cotton GhHSFA7 transcription factor protein polypeptide that a kind is isolated, it is characterised in that, its aminoacid sequence is as shown in SEQIDNO.4.
3. polypeptide as claimed in claim 2 is coerced and application in anti-drought stress strengthening plant anti-salt.
4. utilizing transgenic technology the nucleotide sequence of coding cotton GhHSFA7 protein active polypeptide to be transformed into plant to increase plant anti-salt and coerce and the method for anti-drought stress, its step is as follows:
(1) nucleotide sequence encoding the purifying of the polypeptide of cotton GhHSFA7 protein-active is operationally connected in expression of plants regulating and controlling sequence, forming the plant expression vector of coding containing cotton GhHSFA7 protein sequence, described nucleotide sequence is as shown in SEQIDNO.3;
(2) expression vector in step (1) is proceeded to vegetable cell;
(3) by screening, transfer-gen plant and offspring thereof is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310642386.1A CN103834666B (en) | 2013-12-03 | 2013-12-03 | A kind of cotton GhHSFA7 gene coded sequence and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310642386.1A CN103834666B (en) | 2013-12-03 | 2013-12-03 | A kind of cotton GhHSFA7 gene coded sequence and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834666A CN103834666A (en) | 2014-06-04 |
| CN103834666B true CN103834666B (en) | 2016-06-01 |
Family
ID=50798563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310642386.1A Active CN103834666B (en) | 2013-12-03 | 2013-12-03 | A kind of cotton GhHSFA7 gene coded sequence and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834666B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112322628B (en) * | 2020-09-27 | 2022-11-15 | 湖北大学 | Transcription factor GhWRKY1-like gene for regulating and controlling verticillium wilt and drought resistance of cotton and application thereof |
| CN116926120A (en) * | 2023-08-17 | 2023-10-24 | 西部(重庆)科学城种质创制大科学中心 | Application of heat shock transcription factor PtrHSFA5a in regulating root system development and improving salt tolerance |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134272A (en) * | 2010-01-26 | 2011-07-27 | 中国科学院遗传与发育生物学研究所 | Application of rice heat stress transcription factor in novel variety cultivation |
| CN102199610A (en) * | 2011-03-30 | 2011-09-28 | 上海市农业生物基因中心 | Application of OsHSF01 (oryza sativa heat stress transcription factors 01) gene |
-
2013
- 2013-12-03 CN CN201310642386.1A patent/CN103834666B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134272A (en) * | 2010-01-26 | 2011-07-27 | 中国科学院遗传与发育生物学研究所 | Application of rice heat stress transcription factor in novel variety cultivation |
| CN102199610A (en) * | 2011-03-30 | 2011-09-28 | 上海市农业生物基因中心 | Application of OsHSF01 (oryza sativa heat stress transcription factors 01) gene |
Non-Patent Citations (5)
| Title |
|---|
| Construction and analysis of cotton (Gossypium arboreum L.) drought-related cDNA library;Ling Zhang等;《BMC Research Notes》;20090702;第2卷;1-8 * |
| Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum);Jun Wang等;《BMC Genomics》;20141106;第15卷;1-19 * |
| Over-expression of OsHsfA7 enhanced salt and drought tolerance in transgenic rice;Ai-Ling Liu等;《BMB Reports》;20130131;第46卷(第1期);31-36 * |
| Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres;Andrew H. Paterson等;《NATURE》;20121227;第492卷;423-428 * |
| 棉花热激转录因子基因的克隆及其序列分析;萨娜瓦尔•艾比布拉 等;《新疆农业大学学报》;20121231;第35卷(第6期);464页1.2.1-1.2.3节，466页图4，467页右栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834666A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100429311C (en) | EPSP synzyme of high anti-cancrinia discoidea and its coding squence | |
| CN103602686A (en) | Sweet wormwood MYC2 transcription factor protein coding sequence and applications thereof | |
| CN101362799A (en) | Gene for regulating and controlling plant height and application thereof | |
| CN109666659A (en) | Plant drought, salt tolerant protein AsCIPK14 and its encoding gene and application | |
| CN109666681A (en) | Plant drought, salt tolerant protein EeCIPK26 and its encoding gene and application | |
| CN105524152A (en) | Rice high-temperature-resistance gene and application thereof in crop high-temperature-resistance breeding | |
| CN101418300A (en) | Gene for improving plant salt tolerance and drought resistance and use thereof | |
| CN103834666B (en) | A kind of cotton GhHSFA7 gene coded sequence and application thereof | |
| CN101935342B (en) | Moth orchid development B gene-PhAP3 coded sequence and application thereof | |
| CN100395333C (en) | Alfalfa cysteine prolease and its coding gene and uses | |
| CN103288943B (en) | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof | |
| CN1919866B (en) | Soybean Trihelix transcription factor, encode gene and application thereof | |
| CN104278053B (en) | A kind of method for improving drought tolerance in plants ability | |
| CN113004382A (en) | Application of EmBP1 gene or protein thereof | |
| CN103484472B (en) | Rice lateral root formation control gene OsHK1 and coded protein thereof | |
| CN113563439B (en) | Fruit shape development related protein, and coding gene and application thereof | |
| CN102250230A (en) | Rice OsI2 protein, gene for coding protein and application | |
| CN105693835B (en) | A kind of rice grain shape GAP-associated protein GAP GIF1 and its encoding gene and application | |
| CN1919867B (en) | Soybean Trihelix transcription factor, encode gene and application thereof | |
| CN100393744C (en) | Paddy rice stalk extension gene, coded protein and application thereof | |
| CN101186919B (en) | Protein coded sequence for regulating and controlling temperature and light sensitive nuclear sterility | |
| CN104450757A (en) | SL gene for regulating panicle shape and grain shape in rice, and applications thereof | |
| CN100460420C (en) | Frigostable correlative transcriptive factor of rice and its coding gene and application | |
| CN106432449A (en) | Protein VPS23A related to drought tolerance of plants, encoding gene of protein VPS23A and application | |
| CN108841836B (en) | Barley HvAIR12 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |