CN103820494B - A kind of remove random integration site-specific integration carrier and construction process and application - Google Patents

Abstract

The invention discloses a kind of remove random integration site-specific integration carrier and construction process and application, do you comprise pUC? ori, attB sequence and multiple clone site MCS, a loxP sequence and a rox sequence is respectively equipped with in attB sequence upstream and downstream, CMV promoter is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent marker gene, fluorescent marker gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and it is identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just to screen element.The new application of the present invention for providing rejecting random integration reconstitution cell directly to filter out the reconstitution cell of pseudo attP site specific integration in cell screening.

Description

A kind of remove random integration site-specific integration carrier and construction process and application

Technical field

The invention belongs to genetically engineered field, relate to a kind of expression vector of site-specific integration, particularly a kind of remove random integration site-specific integration carrier and construction process and application.

Background technology

Focus in the present scientific research just of research of transgenic animal.But, still there is certain drawback in existing transgenic animal production technology: the position effect that the radom insertion of foreign gene brings, namely foreign gene radom insertion causes its unconventionality expression to the gene internal relevant to the important vital movement of cell, or foreign gene insertion heterochromatic zone causes exogenous gene expression reticent.

In recent years, Streptomyces Phage intergrase is because its transgenosis plasmid that can mediate with attB site is integrated at mammalian genes group pseudo attP site, and this integration has unidirectional integration, effectively integrates without the need to extraneous chemical energy source and cofactor, competent large fragment gene, foreign gene can the feature [CalosMP.The such as long-term and high efficient expression integrasesystemforgenetherapy.CurrGeneTher, 2006,6 (6): 633 – 645.], increasing for transgenic research.And show about the research of pseudo attP site in the genome regularity of distribution, pseudo attP site multidigit, between gene or in gene intron, is integrated and is seldom occurred in [ThyagarajanB in the exon of gene, LiuY, ShinS, LakshmipathyU, ScheyhingK, XueH c, StrehlR, HyllnerJ, RaoMS, ChesnutJD.Creationofengineeredhumanembryonicstemcellline susing integrase.StemCells, 2008,26 (1): 119 – 126.].And integration site does not prefer to transcription initiation site [ChalbergTW, PortlockJL, OlivaresEC, ThyagarajanB, KirbyPJ, HillmanRT, HoeltersJ, CalosMP.Integrationspecificityofphage integraseinthehumangenome.JMolBiol, 2006,357 (1): 28 – 48.], from this respect, comparatively radom insertion and virus carrier system are much smaller the potential potential safety hazard of integrase mediated integration.

But, also random integration events [Thyagarajan is in various degree there is in integrase mediated integrating remark, B., Olivares, E.C., Hollis, R.P., Ginsburg, D.S. & Calos, M.P.Site-specificgenomicintegrationinmammaliancellsmedia tedbyphagephiC31integrase.Molecularandcellularbiology21,3926-3934 ,], these random integrations greatly reduce integrase mediated site-specific integration accuracy, and bring uncertain hidden danger for the security of the method; And ordinary method by the qualification of PCR equimolecular biological means, and can only be given up artificially there is the reconstitution cell of random integration in integrase mediated integrating remark, this method wastes time and energy.

The effectively section of having that somatic cell nuclear transfer technique is produced as transgenic animal, its outstanding advantages is that transgenosis is advanceed to the somatic cell culture stage, effectively can improve natality and production control cost [the M.B.WheelerandE.M.Walters.Transgenictechnologyandapplica tionsinswine.Theriogenology2001 of transgenic animal, 56 (8): 1345-1369], but the preparation of nuclear donor cell generally needs through drug screening, and antibiotic-screening mark residual in final transgenic cell, potential threat is caused to transgenic animal safety and environmental safety, and all the other carrier frameworks derive from bacterial component, host is even reticent often through epigenetics modification (as methylating) render transgenic unstable expression.Along with people are to the concern of biological safety, the security of vector backbone sequence (being called as " junk DNA ") and selectable marker gene has become one of important object of agriculture GMO bio-safety evaluation.Given this, a kind of effective screening pseudo attP site integrates reconstitution cell and excision comprises the system exigence of selection markers and carrier framework in transgenic animal production process.

Summary of the invention

The problem that the present invention solves be to provide a kind of remove random integration site-specific integration carrier and construction process and application, overcome the defect that existing gene integration and screening aspect exist, reject random integration reconstitution cell in integrase mediated integrating remark and directly filter out the reconstitution cell of pseudo attP site specific integration, for body-cell neucleus transplanting builds the nuclear donor cell that transgene clone embryo provides carrier free skeleton and selection markers, improve the security that transgenic animal produce.

The present invention is achieved through the following technical solutions:

A kind of site-specific integration carrier removing random integration, comprise pUCori, attB sequence and multiple clone site MCS, a loxP sequence and a rox sequence is respectively equipped with in attB sequence upstream and downstream, CMV promoter is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent marker gene, fluorescent marker gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and it is identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just to screen element.

Described multiple clone site MCS comprises following restriction enzyme enzyme recognition site: PvuI, SpeI, AscI, PacI and AgeI.

The open reading frame of described negative screening-gene is HSVtk open reading frame, bear and be also connected by linker between screening-gene with a rox sequence, the open reading frame of fluorescent marker gene is AcGFP1-Nuc open reading frame, and its terminator is Sv40 terminator; Just screening element is KanR/neoR Expression element.

A described loxP sequence, attB sequence, a rox sequence, linker and tk bear screening-gene amalgamation and expression loxP-attB-rox-linker-tk under CMV promoter effect; Fluorescent marker gene is raised rrna by IRES2 after transcribing under CMV promoter effect and is translated fluorescent indicator protein; Described CMV promoter is composing type PcmvIE promotor.

Described loxP-attB-rox-linker-tk fusion gene, is divided into three kinds according to linker difference: LAR-Null-tk, LAR-(Gly4Ser) 3-tk and LAR-P2A-tk.

Sequence after a described loxP sequence, attB sequence are connected with a rox sequence is as shown in SEQ.ID.NO.1;

Sequence after the 2nd described rox sequence, MCS are connected with the 2nd loxP sequence is as shown in SEQ.ID.NO.2.

Remove a construction process for the site-specific integration carrier of random integration, comprise the following steps:

1) by SOE-PCR method, clone contains at the two ends obtained as shown in SEQ.ID.NO.1 the attB sequence of HindIII and SalI restriction enzyme site and a loxP sequence and a rox sequence, obtains LAR sequence;

2) enter pGEM-3Z carrier with HindIII/SalI double digestion LAR sequence clone and obtain pGEM-LAR carrier

3) annealing synthesis is with the linker sequence of SalI/BamHI sticky end, and the pGEM-LAR carrier being cloned into SalI/BamHI double digestion respectively obtains pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier respectively;

4) difference NcoI single endonuclease digestion pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier, reclaim about 300bp fragment, be cloned into pORF-HSVtk carrier respectively, obtain pLARNtk respectively, pLARGtk and pLARPtk carrier;

5) by SOE-PCR method, clone obtains the MCS that NotI restriction enzyme site and the 2nd loxP sequence are contained in two ends, is cloned into pIRES2-AcGFP1-Nuc carrier and obtains pIAN-MCSL;

6) obtain two ends with the SV40 terminator of PvuI and SpeI restriction enzyme site and the 2nd rox sequence by PCR, be cloned in pIAN-MCS carrier and obtain pIAN-RMCSL;

7) NheI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk carrier, reclaims about 1500bp fragment, is cloned into pIAN-RMCSL carrier respectively, obtains pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL.

The site-specific integration carrier of the described random integration removed provides rejecting random integration reconstitution cell and directly filters out the application of the reconstitution cell of pseudo attP site specific integration in mammalian cell screening.

The site-specific integration carrier can removing random integration, after carrying out cell transfecting, carries out drug screening, obtains the reconstitution cell of expression vector stable transfection; Then the process that loxP sequence and Dre restructuring shearing rox sequence are sheared in Cre restructuring is carried out to it, obtain the reconstitution cell of the antibiotic-free selection markers plasmid-free skeleton of pseudo attP site specific integration.

The process that loxP sequence and Dre restructuring shearing rox sequence are sheared in described Cre restructuring is:

Reconstitution cell after drug screening is comprised to the transfection of the expression vector of Cre element and Dre element, or it is hatched in containing the environment being connected with Cre recombinase and the Dre recombinase wearing film peptide.

Compared with prior art, the present invention has following useful technique effect:

1, the site-specific integration carrier removing random integration provided by the invention, after carrying out cell transfecting, at Streptomyces Phage under integrase mediated, major part can be incorporated into pseudo attP site in gene of eucaryote cell group locus specificity, the region of the transcriptionally active between gene or in gene intron is partial in its distribution, avoid silenced gene expression and other potential safety hazards that plasmid radom insertion causes, thus make persistent transgene high expression.

2, the site-specific integration carrier removing random integration provided by the invention, due to the design of positive-negative selection mark, drug screening can be carried out by G418 and GCV, obtain and not only there is G418 resistance (prompting stable integration) but also do not expressed HSVtk(prompting without random integration events) positive cell clone, and be aided with fluorescent indicator protein prompting transient transfection efficiency and eliminating to the insensitive random integration reconstitution cell of GCV medicine.

3, the site-specific integration carrier removing random integration provided by the invention, after screening obtains positive reconstitution cell, rox is sheared by shearing loxP and Dre restructuring to Cre restructuring, remove two CMV promoter in the same way between loxP, just screening element and other carrier frameworks, and the negative selection markers removed between two rox and fluorescent indicator protein, thus the transgenosis recombinant chou that the pseudo attP site obtaining plasmid-free skeleton and selection markers is integrated, eliminate the impact of selection markers on transgenic animal safety and environmental safety, it also avoid the transgene silencing because carrier framework causes in host cell body or unstable expression.

4, the site-specific integration carrier removing random integration provided by the invention, for problems such as vector integration site, transgene expression level, selection markers and carrier framework remain, can be applicable to as body-cell neucleus transplanting builds the nuclear donor cell that transgene clone embryo provides carrier free skeleton and selection markers, thus set up the safe cultivation system of transgenic animal of a kind of carrier free skeleton and selection markers, can be used for carrying out Animal Transgenic research.

Accompanying drawing explanation

Fig. 1 is the detected through gel electrophoresis figure that carrier pLAR-linker-tk-IAN-RMCSL builds;

Fig. 2 is the sequencing result of different linker in pLAR-linker-tk-IAN-RMCSL carrier;

Fig. 3 is carrier system pie graph of the present invention;

Fig. 4 is the expression that WesternBlotting detects tk fusion rotein after different pLAR-linker-IAN-RMCSL expression vector transfected HEK 293;

Fig. 5 is expression and the Subcellular Localization situation that immunostaining detects tk fusion rotein after different pLAR-linker-IAN-RMCSL expression vector transfected HEK 293.

Fig. 6 is that after different pLAR-linker-IAN-RMCSL expression vector transfected HEK 293, tk fusion rotein detects the cytotoxicity of different GCV concentration.

Embodiment

The site-specific integration carrier removing random integration provided by the invention, this carrier system can at Streptomyces Phage under the mediation of intergrase, be incorporated into pseudo attP site in gene of eucaryote cell group locus specificity, thus make persistent transgene high expression, the problem of resolved vector integration site, transgene expression level; Then obtain eliminating after the positive cell that random integration events participates in through medicine positive-negative selection, selection markers and other carrier frameworks are excised under the effect that Cre and Dre restructuring is sheared, finally obtain the transgenic cell of screening marker-free and carrier framework, for body-cell neucleus transplanting, produce the transgenic animal of screening marker-free and carrier framework, thus improve transgenic animal security, provide valuable technology platform for carrying out Animal Transgenic research.Below in conjunction with concrete carrier structure and detect the present invention is described in further detail, the explanation of the invention is not limited.

Remove a construction process for the site-specific integration carrier of random integration, comprise the following steps:

1) by SOE-PCR method, clone contains at the two ends obtained as shown in SEQ.ID.NO.1 the attB sequence of HindIII and SalI restriction enzyme site and a loxP sequence and a rox sequence, called after LAR; Concrete operations are:

By primer LAR_F1 and LAR_R1 by annealing synthesis fragment LAR1;

With carrier pARNG(see seeing patent ZL201110259942.8-" a kind of universal expression vector of integrating based on pseudo attP site and construction process and application ") for template, obtain about 300bp fragment LAR2(by primer LAR_F2 and LAR_R2 amplification and see Fig. 1-a, swimming lane 1);

With LAR1 and LAR2 for template, obtained the LAR fragment (see Fig. 1-a, swimming lane 2) of 381bp by primer LAR_F1 and LAR_R2 amplification

LARF1:ccaagcttccatggtagctagcataacttcgtatagcatacattatacgaagttatagg；

LARR1:ggtggccctataacttcgtataatgtatgctatacgaagttatgctagctaccatggaagc；

LARF2:ttatagggccaccatgcccgccgtgaccg；

LARR2:cgacgtcgactaactttaaataattggcattatttaaagttaagatgtaggtcacggtc；

2) with HindIII/SalI double digestion LAR sequence and pGEM-3Z carrier, gel reclaims LAR fragment and vector backbone segment, and 4 DEG C of connections of spending the night, obtain recombinant vectors pGEM-LAR;

Enzyme cuts qualification as shown in Fig. 1-b, wherein swimming lane 1 is HindIII/SalI double digestion pGEM-3Z carrier (negative control), only has the band of a 2743bp, and swimming lane 2 is HindIII/SalI double digestion pGEM-LAR recombinant vectors, 2743bp(pGEM-3Z carrier framework can be cut out) and 381bp(LAR fragment) two bands.

3) annealing synthesis is with 3 kinds of linker sequences of SalI/BamHI sticky end, and the pGEM-LAR carrier being cloned into SalI/BamHI double digestion respectively obtains pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier; Sequencing result as shown in Figure 2.

Wherein, the linker sequence of Null is ccatgg;

(Gly4Ser) the linker sequence of 3 is ggtggcggtggctcgggcggtggtgggtcgggtggcggcggttcc;

The linker sequence of P2A is ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggAggagaa ccctggaccc;

4) NcoI single endonuclease digestion pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier, reclaims about 400bp fragment, is cloned into pORF-HSVtk carrier respectively, obtains pLARNtk, pLARGtk and pLARPtk carrier;

Enzyme cuts qualification result as shown in fig 1-c: swimming lane 1 is NcoI single endonuclease digestion pORF-HSVtk carrier (negative control), have to a 4373bp band, swimming lane 2-4 is respectively NcoI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk recombinant vectors, obtains about 4373bp and 400bp two band respectively.

5) by SOE-PCR method, clone obtains the MCS that NotI restriction enzyme site and the 2nd loxP sequence are contained in two ends, is cloned into pIRES2-AcGFP1-Nuc carrier and obtains pIAN-MCSL; Concrete operations are as follows:

By the method synthesis fragment MCS1(Fig. 1-d of primer MCS_F1 and MCS_R1 by SOE-PCR, 86bp); This step SOE-PCR template used is primer itself, also be template if MCS_F1/MCS_R1 itself is primer, because these two pairs of primers have the reverse complementary sequence of 15-20bp, during annealing, complementary sequence combines, in Taq enzyme effect downward-extension polishing fragment during PCR, form the template of next round SOE-PCR;

With fragment MCS1 for template, MCS_F1 and MCS_R2 is primer, method synthesis fragment MCS(127bp, Fig. 1-d by SOE-PCR), its sequence is specifically as shown in SEQ.ID.NO.2, and wherein LoxP sequence is ataacttcgtatagcatacattatacgaagttat;

MCSF1：ataagaatgcggccgctcgcgatcgcgactagactagtctagttg；

MCSR1：cgaagttatcgaccggtagcccttaattaaggttggcgcgccaactagactagtctagtcgcgat；

MCSR2：atagtttagcggccgcataacttcgtataatgtatgctatacgaagttatcgaccggt；

6) obtain two ends with the SV40 terminator of PvuI and SpeI restriction enzyme site and the 2nd rox sequence by PCR, be cloned in pIAN-MCSL carrier and obtain pIAN-RMCSL;

Double digestion qualification result is as shown in Fig. 1-e: swimming lane 1 is PvuI/SpeI double digestion pIAN-MCSL carrier, has to 5524bp mono-band; Swimming lane 2 is PvuI/SpeI double digestion pIAN-RMCSL recombinant vectors, obtains 5524bp and 280bp two band.

7) NheI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk carrier, reclaims about 1500bp fragment, is cloned into pIAN-RMCSL carrier respectively, obtains pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL recombinant vectors;

Double digestion qualification result is as shown in Fig. 1-f, and swimming lane 1 is NheI single endonuclease digestion pIAN-RMCSL carrier (negative control), has to the band of a 5804bp; Swimming lane 2-4 is NheI single endonuclease digestion pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL recombinant vectors, obtains two bands of 5804bp and 1500bp respectively.

Constructed universal expression vector pLAR-linker-tk-IAN-RMCSL carrier, its pie graph as shown in Figure 3, comprise pUCori, attB sequence and multiple clone site MCS, a loxP sequence and a rox sequence is respectively equipped with in attB sequence upstream and downstream, CMV promoter is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent marker gene, fluorescent marker gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and it is identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just to screen element.

Wherein pUCori is the replication origin of plasmid, in order to plasmid can copy amplification in bacterium, derives from pEGFP-C1 carrier; AttB sequence is at Streptomyces Phage homologous recombination can be there is with pseudo attP site (pseudoattP) in gene of eucaryote cell group under the mediation of intergrase, thus the transcriptional active spot be integrated into making carrier pARNG locus specificity in gene of eucaryote cell group, be conducive to persistent transgene high expression; Multiple clone site MCS comprises 5 rare restriction enzyme enzyme recognition sites, for the clone of goal gene element;

CMV constitutive promoter (deriving from pIRES2-AcGFP1-Nuc carrier) is connected with attB sequence, attB sequence downstream inserts two rox elements in the same way, it is linker-tk-IRES2-AcGFP1-Nuc-SV40polyA element between rox sequence, two rox member downstream are provided with multiple clone site MCS, MCS downstream is two LoxP elements in the same way, comprises KanR/neoR Expression element, pUCori and CMV promoter between two LoxP elements.

After expression vector pLAR-linker-tk-IAN-RMCSL is incorporated into eukaryotic cell, through G418 drug screening, obtain the positive cell clone with G418 resistance, wherein: the reconstitution cell of site-specific integration is owing to rupturing in attB site, TK gene (negative selection markers) is not expressed, and therefore still survives under GCV drug screening; And do not rupture in the reconstitution cell attB site of random integration, TK gene is continuous expression under CMV promoter effect, the necrocytosis under GCV drug screening pressure of random integration reconstitution cell.After the reconstitution cell obtaining site-specific integration, with Cre recombinase and Dre recombinase process positive cell clone, remove two TK selection markers in the same way between LoxP, neo selection markers, CMV promoter and other carrier frameworks between green fluorescence protein gene and two rox sequences.

Sequence after a described loxP sequence, attB sequence are connected with a rox sequence is as shown in SEQ.ID.NO.1;

Sequence after the 2nd described rox sequence, MCS are connected with the 2nd loxP sequence is as shown in SEQ.ID.NO.2.

The following describes the application of constructed pLAR-linker-tk-IAN-RMCSL carrier at the transgenic cell of the antibiotic-free selection markers of screening site-specific integration, specifically comprise the operation by cell cultures, transfection, fluorescent screening.

1, based on transient transfection cell, to the detection of tk expressing fusion protein

1) preparation of host cell

HEK293 cell is inoculated in the DMEM nutrient solution containing 10% foetal calf serum, 6 well culture plates of inoculating cell are put into 37 DEG C, 5%CO ₂in incubator.Transfection is carried out when Growth of Cells converges rate to 70%-90%.

2) preparation of transfection composite

A. prepare 6 1.5mL sterile centrifugation tube, add 200 μ lOpti-MEM substratum respectively;

B. in centrifuge tube, add pIRES2-AcGFP1-Nuc plasmid vector (2 μ g respectively, negative control), pORF-HSVtk-IAN plasmid vector (2 μ g, are cloned into pIRES2-AcGFP1-Nuc carrier by HSV-1tk open reading frame), pLARNtk-IAN-RMCSL plasmid vector (2 μ g), pLARGtk-IAN-RMCSL plasmid vector (2 μ g) and pLARPtk-IAN-RMCSL plasmid vector (2 μ g);

C. of short duration soft vortex (being no more than 10s);

D. 8 μ lX-tremeGENEHPDNATransfectionReagent are added respectively;

E. of short duration soft vortex;

F. room temperature (15 DEG C-25 DEG C) hatches 15-30min.

3) transfection composite is dropwise added in the cell of 6 well culture plates successively, mark IAN, HSVtk, LARNtk, LARGtk and LARPtk respectively;

4), after incubated cell 36h, the reconstitution cell carrying out different reorganization scheme is carried out following detection:

A, the cell of restructuring is respectively used to WesternBlotting and detects.Collect each group of cell in the PBS solution of 1mL precooling, centrifugal 5 minutes of 1000rpm, supernatant discarded, 60 μ lWestern and IP cell pyrolysis liquid (the green skies) re-suspended cell, add cOmpleteProteaseInhibitorCocktailTablets (Roche) and be adjusted to working concentration, cracking 30min on ice, whole protein is added sample-loading buffer, 100 DEG C of sex change 5min, the SDS-PAGE gel electrophoresis of 12%, then sample is transferred on pvdf membrane by semidrying from SDS-PAGE gel, primary antibodie 4 DEG C of night incubation, washing, two anti-hatch 2.5h, the exposure of eECLWesternBlotKit highly sensitive chemistry luminescence detection kit is used after washing.

Detect HSV-1tk: primary antibodie: GoatpolyclonalantibodyagainstHSV-1thymidinekinase(SantaC ruz company); Two resist: HRP-labeledDonkeyAnti-GoatIgG (H+L) (the green skies).

GAPDH: primary antibodie: RabbitpolyclonalantibodyagainstGAPDH (the Sigma company) of detection; Two resist: HRP-labeledgoatanti-rabbitIgG (H+L) (the green skies).

WesternBlotting detected result is as shown in Figure 4: carry out Westernblotting detection using GoatpolyclonalantibodyagainstHSV-1thymidinekinase as primary antibodie, any band do not detected in negative control IAN; All detect that size is about the band of 40kDa in positive control HSVtk and sample LARPtk; Detecting in LARNtk and LARGtk that size is about the band of 55kDa, the band of lower molecular weight detected simultaneously, may be fusion rotein degraded product (using starlike sign flag); GAPDH is as the internal reference of Westernblot Protein Standardization.

B, the cell of restructuring is used for immunofluorescence dyeing, PBS cleans three times, and select immunostaining stationary liquid (the green skies) room temperature to fix 10min, PBS shakes and washes three times, each 5min; Close 60min by immunostaining confining liquid (containing TritonX-100, the green skies) room temperature, PBS shakes and washes 5min; Add the GoatpolyclonalantibodyagainstHSV-1thymidinekinase primary antibodie being diluted to working concentration, 4 DEG C of night incubation, secondary daily PBS shakes and washes three times, each 5min; Add donkey anti goat igg (H+L) antibody (the green skies) containing Cy3 mark being diluted to working concentration, normal temperature lucifuge hatches 60min, shakes wash three times, each 5min after hatching end with PBS; Add the DAPI being diluted to working concentration and redye nucleus, normal temperature lucifuge hatches 5min, removes staining fluid after hatching end, the Subcellar location situation of the various tk fusion rotein of fluorescence microscopy Microscopic observation after PBS cleaning.

Result is as shown in Figure 5: can't detect any fluorescent signal in negative control IAN; The expression of HSV-1tk gene detected in positive control HSVtk, wild-type HSV-1tk is mainly distributed in tenuigenin; Tk expressing fusion protein all detected in sample LARNtk, LARGtk and LARPtk, and tk fusion rotein is mainly distributed in tenuigenin; In addition, all can be observed green fluorescent protein (AcGFP1-Nuc) in sample LARNtk, LARGtk and LARPtk and express, be mainly distributed in nucleus.

Above detected result proves:

By pLAR-linker-tk-IAN-RMCSL(pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL or pLARPtk-IAN-RMCSL) after transfected HEK 293, tk expressing fusion protein, and be mainly distributed in tenuigenin.

C, the reconstitution cell of the cells green fluorescent protein (AcGFP1-Nuc) after transfection to be sorted out by BDFACSAria flow cytometer (BD company), and with 5.0 × 10 ³the density of cells/well is inoculated in 96 orifice plates, then adds the GCV of different concns (0,0.01,0.1,1,10, and20 μ g/mL).After 4 days, to illustrate from toxicity detection test kit (the green skies) according to WST-1 cell proliferation and detect different tk fusion rotein to the sensitivity of GCV.

Result is as shown in Figure 6: the reconstitution cell of transfection pIRES2-AcGFP1-Nuc empty carrier is insensitive to GCV, even if act at the GCV of 10 μ g/mL high densitys the cell mortality that 4 days only demonstrate 2.76% afterwards; And the reconstitution cell of transfection pORF-HSVtk-IAN, pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL carrier is under the GCV effect of 10 μ g/mL high densitys, all demonstrate cytotoxicity, GCV process nearly all necrocytosis after 4 days; .And when GCV activity is reduced to 0.1 μ g/mL, have 51.1 ± 4.0% necrocytosiss in LARPtk group, cell mortality is significantly higher than LARNtk (28.5 ± 7.7%, P=0.001) and LARGtk group (34.8 ± 4.5%, P=0.032), point out it more responsive to GCV.

3, the screening of the transgenic cell of the site-specific integration of random integration is removed:

Treat that Growth of Cells converges rate to 70%-90%, use electroporation transfection method to carry out pLARNtk-IAN-RMCSL plasmid vector, pLARGtk-IAN-RMCSL plasmid vector and pLARPtk-IAN-RMCSL plasmid vector respectively with phiC31 intergrase mRNA cotransfection to HEK293 cell.

Because universal expression vector pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL comprise G418 resistant gene neoR, stable integration can be survived to the positive cell of the neoR gene on genome in the nutrient solution containing finite concentration G418, and is that the normal cell of transfection can be killed by this medicine.

Adding final concentration in containing the DMEM cell culture fluid of serum after universal expression vector transfected HEK 293 24h is that the G418 of minimum lethal concentration (400 μ g/ml) screens; With the HEK293 inoblast of untransfected for negative control, its cell culture fluid is added with the G418 of same concentration.After transfectional cell G418 screens 12d, the complete cell death of control group; The positive reconstitution cell of the transfection showing as G418 resistance is observed under fluorescent microscope, observes fluorescent indicator protein AcGFP1-Nuc and whether express.

Because attB sequence is connected between CMV promoter and tk fusion rotein-IRES2-AcGFP1-Nuc reading frame, therefore attB sequence can be caused to rupture by the site-specific integration that phiC31 is integrase mediated, thus tk fusion rotein and AcGFP1-Nuc fluorescin are not expressed, the reconstitution cell that namely site-specific integration only occur is insensitive and can't detect green fluorescence under fluorescent microscope to GCV medicine; The random integration related in integrating remark then can not affect CMV-tk fusion rotein-IRES2-AcGFP1-Nuc expresses, thus causes the reconstitution cell relating to random integration green fluorescence can be detected under fluorescent microscope and under GCV drug effect, produce cytotoxicity and dead.

According to this characteristic, design two kinds of screening methods:

A.G418(400 ~ 600 μ g/mL) single medicine screening;

B.G418(400 ~ 600 μ g/mL) and GCV(1 ~ 10 μ g/mL) positive and negative two screening.

The screening of G418 single medicine can obtain the mono-clonal that fluorescent protein expression (GFP+) and fluorescin do not express (GFP-), and G418 and GCV is positive and negative twoly screens the mono-clonal having to GFP-.By counting, visible:

The contrast of clone's number is formed after table 1 different pLAR-linker-tk-IAN-RMCSL carrier transfected HEK 293

Result shows: under the screening of G418 single medicine, owing to not comprising attB element in HSVtk group, therefore its number of cell clones with G418 resistance (G418r) formed significantly contains the experimental group of attB element lower than other, and nearly all cell clone presents the GFP positive (GFP+) in HSVtk group, prompting random integration occurs; And although major part presents GFP feminine gender in other experimental group, still some presents the GFP positive, points out in these GFP positive cells and there is random integration events.Under the two drug screening of G418 and GCV, be unscreened to obtain recombinant cell clone in HSVtk group, supposition is due to random integration cells HSV-1tk albumen, produces cytotoxicity, necrocytosis under GCV drug effect; And the number of cell clones obtained in experimental group reduces when comparatively G418 single medicine screens, and GFP positive cell ratio significantly reduces, especially in LARPtk group for GFP positive cell being detected, supposition causes GCV is more responsive compared with the fusion rotein of expressing in LARNtk and LARGtk group due to the tk fusion rotein of expressing in LARPtk group.

After the two screening of G418 and GCV, choose in the cell clone of survival and not only there is G418 resistance but also the positive cell clone of not expressing green fluorescent protein, the G418 concentration of substratum is reduced by half and continues screening until cell covers with at the bottom of ware, then use pancreas enzyme-EDTA peptic cell, then add the DMEM cell culture fluid enlarged culturing of not added with antibiotic.

3) Cre and Dre recombinase process:

Not only will there is G418 resistance but also the positive cell of not expressing green fluorescent protein is inoculated in the DMEM nutrient solution containing 10% foetal calf serum, 6 well culture plates of inoculating cell are put into 37 DEG C, 5%CO ₂in incubator.The process of Cre and Dre recombinase is carried out when Growth of Cells converges rate to 70%-90%.

3.1Cre and Dre plasmid transfection sieve method:

A. prepare 1.5mL sterile centrifugation tube, add 200 μ lOpti-MEM substratum;

B. in centrifuge tube, pCAG-Cre-IP plasmid vector (1 μ g) and pCAGGs-Dre-IRES-puro(1 μ g is added);

C. of short duration soft vortex (being no more than 10s);

D. 8 μ lX-tremeGENEHPDNATransfectionReagent are added respectively;

E. of short duration soft vortex;

F. room temperature (15 DEG C-25 DEG C) hatches 15-30min.

G. transfection composite is dropwise added in the cell of 6 well culture plates;

H., after incubated cell 24h, the cell of the antibiotic-free mark of recombinating is obtained.

I.PCR detects the excision of Cre and Dre recombinase-mediated;

3.2Cre and Dre protein transduction method:

In order to avoid in Cre and Dre recombinase treatment step, express the plasmid vector random integration of Cre or Dre recombinase in positive cell genome, bring unnecessary risk, can use and be connected with Cre and the Dre recombinase wearing film peptide and add in DMEM cell culture fluid, hatch 4h, then utilize Protocols in Molecular Biology to detect, finally obtain the positive cell of antibiotic-free selection markers.

Claims (10)

1. can remove the site-specific integration carrier of random integration for one kind, it is characterized in that, comprise pUCori, attB sequence and multiple clone site MCS, a loxP sequence and a rox sequence is respectively equipped with in attB sequence upstream and downstream, CMV promoter is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent marker gene, fluorescent marker gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and it is identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just to screen element,

The open reading frame of described negative screening-gene is HSVtk open reading frame; Just screening element is KanR/neoR Expression element.

2. can remove the site-specific integration carrier of random integration as claimed in claim 1, it is characterized in that, described multiple clone site MCS comprises following restriction enzyme enzyme recognition site: PvuI, SpeI, AscI, PacI and AgeI.

3. can remove the site-specific integration carrier of random integration as claimed in claim 1, it is characterized in that, also be connected by linker between described negative screening-gene with a rox sequence, the open reading frame of fluorescent marker gene is AcGFP1-Nuc open reading frame, and its terminator is Sv40 terminator.

4. the site-specific integration carrier of the random integration removed as described in claim 1 or 3, it is characterized in that, a loxP sequence, attB sequence, a rox sequence, linker and tk bear screening-gene amalgamation and expression loxP-attB-rox-linker-tk under CMV promoter effect; Fluorescent marker gene is raised rrna by IRES2 after transcribing under CMV promoter effect and is translated fluorescent indicator protein; Described CMV promoter is composing type PcmvIE promotor.

5. can remove the site-specific integration carrier of random integration as claimed in claim 3, it is characterized in that, described loxP-attB-rox-linker-tk fusion gene, three kinds are divided into: the linker sequence of LAR-Null-tk, LAR-(Gly4Ser) 3-tk and LAR-P2A-tk, Null is ccatgg according to linker difference.

6. can remove the site-specific integration carrier of random integration as claimed in claim 1, it is characterized in that, the sequence after a described loxP sequence, attB sequence are connected with a rox sequence is as shown in SEQ.ID.NO.1;

Sequence after the 2nd described rox sequence, MCS are connected with the 2nd loxP sequence is as shown in SEQ.ID.NO.2.

7. can remove a construction process for the site-specific integration carrier of random integration, it is characterized in that, comprise the following steps:

1) by SOE-PCR method, clone contains at the two ends obtained as shown in SEQ.ID.NO.1 the attB sequence of HindIII and SalI restriction enzyme site and a loxP sequence and a rox sequence, obtains LAR sequence;

2) enter pGEM-3Z carrier with HindIII/SalI double digestion LAR sequence clone and obtain pGEM-LAR carrier

3) annealing synthesis is with the linker sequence of SalI/BamHI sticky end, the pGEM-LAR carrier being cloned into SalI/BamHI double digestion respectively obtains pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier respectively, and the linker sequence of Null is ccatgg;

4) difference NcoI single endonuclease digestion pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier, reclaim about 300bp fragment, be cloned into pORF-HSVtk carrier respectively, obtain pLARNtk respectively, pLARGtk and pLARPtk carrier;

5) by SOE-PCR method, clone obtains the MCS that NotI restriction enzyme site and the 2nd loxP sequence are contained in two ends, is cloned into pIRES2-AcGFP1-Nuc carrier and obtains pIAN-MCSL;

6) obtain two ends with the SV40 terminator of PvuI and SpeI restriction enzyme site and the 2nd rox sequence by PCR, be cloned in pIAN-MCS carrier and obtain pIAN-RMCSL;

7) NheI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk carrier, reclaims about 1500bp fragment, is cloned into pIAN-RMCSL carrier respectively, obtains pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL.

8. the site-specific integration carrier removing random integration according to claim 1 provides rejecting random integration reconstitution cell and directly filters out the application of the reconstitution cell of pseudo attP site specific integration in mammalian cell screening.

9. apply as claimed in claim 8, it is characterized in that, the site-specific integration carrier can removing random integration, after carrying out cell transfecting, carries out drug screening, obtains the reconstitution cell of expression vector stable transfection; Then the process that loxP sequence and Dre restructuring shearing rox sequence are sheared in Cre restructuring is carried out to it, obtain the reconstitution cell of the antibiotic-free selection markers plasmid-free skeleton of pseudo attP site specific integration.

10. apply as claimed in claim 9, it is characterized in that, the process that loxP sequence and Dre restructuring shearing rox sequence are sheared in described Cre restructuring is:

Reconstitution cell after drug screening is comprised to the transfection of the expression vector of Cre element and Dre element, or it is hatched in containing the environment being connected with Cre recombinase and the Dre recombinase wearing film peptide.