CN103820494A - Site specific integration vector capable of removing random integration, construction method thereof and application thereof - Google Patents

Abstract

The invention discloses a site specific integration vector capable of removing random integration, a construction method thereof and an application thereof. The vector comprises a pUC ori, an attB sequence and a multiple cloning site (MCS). The upstream and downstream of the attB sequence is respectively provided with a first loxP sequence and a first rox sequence. A CMV promoter is connected to the upstream of the first loxP sequence. A negative screening gene is connected to the first rox sequence. The downstream of the negative screening gene is connected to an internal ribosome binding site IRES2. The downstream of the IRES2 is a fluorescence labeling gene. The downstream of the fluorescence labeling gene is the MCS. The upstream and downstream of the MCS is respectively provided with a second rox sequence and a second loxP sequence. The direction of the second rox sequence and the direction of the first rox sequence are same, and the direction of the second loxP sequence and the direction of the first loxP sequence are same. The downstream of the MCS is a positive screening element. The application relates to rejection of random integration recombinant cells so as to directly screen false attP site specific integration recombinant cells.

Description

A kind of site-specific integration carrier and construction process and application of removing random integration

Technical field

The invention belongs to genetically engineered field, relate to a kind of expression vector of site-specific integration, particularly a kind of site-specific integration carrier and construction process and application of removing random integration.

Background technology

Focus in the present scientific research just of research of transgenic animal.But, still there is certain drawback in existing transgenic animal production technology: the position effect that the radom insertion of foreign gene brings, be that foreign gene radom insertion causes its unconventionality expression to the gene inside relevant to the important vital movement of cell, or foreign gene insertion heterochromatic zone cause exogenous gene expression silence.

In recent years, Streptomyces Phage intergrase is because it can mediate with the transgenosis plasmid in attB site integrates at mammalian genes group pseudo attP site, and this integration have unidirectional integration, without extraneous chemical energy source and cofactor, competent large fragment gene effectively integrate, foreign gene can long-term and high efficient expression etc. feature [Calos MP.The

integrase system for gene therapy.Curr Gene Ther, 2006,6 (6): 633 – 645.], more and more for transgenic research.And show in the research aspect genome distribution rule about pseudo attP site, pseudo attP site multidigit, between gene or in gene intron, is integrated [Thyagarajan B in the exon that seldom occurs in gene, Liu Y, Shin S, Lakshmipathy U, Scheyhing K, Xue H c, Strehl R, Hyllner J, Rao MS, Chesnut JD.Creation of engineered human embryonic stem cell lines using integrase.Stem Cells, 2008,26 (1): 119 – 126.].And integration site does not prefer to transcription initiation site [Chalberg TW, Portlock JL, Olivares EC, Thyagarajan B, Kirby PJ, Hillman RT, Hoelters J, Calos MP.Integration specificity of phage

integrase in the human genome.J Mol Biol, 2006,357 (1): 28 – 48.], from this respect,

the potential potential safety hazard of integrase mediated integration is much smaller compared with radom insertion and virus carrier system.

But,

in integrase mediated integrating remark, also there is random integration event [Thyagarajan in various degree, B., Olivares, E.C., Hollis, R.P., Ginsburg, D.S. & Calos, M.P.Site-specific genomic integration in mammalian cells mediated by phage phiC31integrase.Molecular and cellular biology21,3926-3934 ,], these random integrations greatly reduce

integrase mediated site-specific integration accuracy, and bring uncertain hidden danger for the security of the method; And ordinary method can only be identified by PCR equimolecular biological means, and give up artificially the reconstitution cell that has random integration in integrase mediated integrating remark, this method wastes time and energy.

The effectively section of having that somatic cell nuclear transfer technique is produced as transgenic animal, its outstanding advantages is that transgenosis is advanceed to the somatic cell culture stage, can effectively improve natality and production control cost [the M.B.Wheeler and E.M.Walters.Transgenic technology and applications in swine.Theriogenology2001 of transgenic animal, 56 (8): 1345-1369], but the preparation of nuclear donor cell generally need to be passed through drug screening, and antibiotic-screening mark residual in final transgenic cell, transgenic animal safety and environmental safety have been caused to potential threat, and all the other carrier frameworks derive from bacterium composition, host often modifies even silence of (as methylating) render transgenic unstable expression by epigenetics.Along with the concern of people to biological safety, the security of vector backbone sequence (being called as " junk DNA ") and selectable marker gene has become one of important object of agriculture genetically modified organism safety evaluation.Given this, a kind of effective screening pseudo attP site is integrated reconstitution cell and is excised the system exigence that comprises selection markers and carrier framework for transgenic animal production process.

Summary of the invention

The problem that the present invention solves is to provide a kind of site-specific integration carrier and construction process and application of removing random integration, overcomes the defect that existing gene integration and screening aspect exist, and rejects

random integration reconstitution cell in integrase mediated integrating remark and directly filter out the reconstitution cell of the special integration of pseudo attP site, provide the nuclear donor cell of carrier free skeleton and selection markers for body-cell neucleus transplanting builds transgene clone embryo, improve the security that transgenic animal produce.

The present invention is achieved through the following technical solutions:

A kind of site-specific integration carrier of removing random integration, comprise pUC ori, attB sequence and multiple clone site MCS, be respectively equipped with a loxP sequence and a rox sequence in attB sequence upstream and downstream, CMV promotor is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent mark gene, fluorescent mark gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just screening element.

Described multiple clone site MCS comprises following restriction enzyme enzyme recognition site: PvuI, SpeI, AscI, PacI and AgeI.

The open reading frame of described negative screening-gene is HSVtk open reading frame, between negative screening-gene and a rox sequence, be also connected by linker, the open reading frame of fluorescent mark gene is AcGFP1-Nuc open reading frame, and its terminator is Sv40 terminator; Just screening element is KanR/neoR Expression element.

The negative screening-gene amalgamation and expression loxP-attB-rox-linker-tk under the effect of CMV promotor of a described loxP sequence, attB sequence, a rox sequence, linker and tk; Fluorescent mark gene is raised rrna translation fluorescence indicator protein by IRES2 after transcribing under the effect of CMV promotor; Described CMV promotor is composing type Pcmv IE promotor.

Described loxP-attB-rox-linker-tk fusion gene, is divided into three kinds according to linker difference: LAR-Null-tk, LAR-(Gly4Ser) 3-tk and LAR-P2A-tk.

Sequence after a described loxP sequence, attB sequence and a rox sequence is connected is as shown in SEQ.ID.NO.1;

Sequence after described the 2nd rox sequence, MCS and the 2nd loxP sequence is connected is as shown in SEQ.ID.NO.2.

A construction process of removing the site-specific integration carrier of random integration, comprises the following steps:

1), by SOE-PCR method, clone obtains the attB sequence that HindIII and SalI restriction enzyme site and a loxP sequence and a rox sequence are contained in the two ends as shown in SEQ.ID.NO.1, obtains LAR sequence;

2) enter pGEM-3Z carrier with HindIII/SalI double digestion LAR sequence clone and obtain pGEM-LAR carrier

3) the synthetic linker sequence with SalI/BamHI sticky end of annealing, the pGEM-LAR carrier that is cloned into respectively SalI/BamHI double digestion obtains respectively pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier;

4) difference NcoI single endonuclease digestion pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier, reclaim 300bp left and right fragment, be cloned into respectively pORF-HSVtk carrier, obtain respectively pLARNtk, pLARGtk and pLARPtk carrier;

5) by SOE-PCR method, clone obtains the MCS that NotI restriction enzyme site and the 2nd loxP sequence are contained in two ends, is cloned into pIRES2-AcGFP1-Nuc carrier and obtains pIAN-MCSL;

6) obtain SV40 terminator and the two rox sequence of two ends with PvuI and SpeI restriction enzyme site by PCR, be cloned in pIAN-MCS carrier and obtain pIAN-RMCSL;

7) NheI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk carrier, reclaim 1500bp left and right fragment, is cloned into respectively pIAN-RMCSL carrier, obtains pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL.

The site-specific integration carrier of the described random integration removed provides the application of rejecting random integration reconstitution cell and directly filter out the reconstitution cell of the special integration of pseudo attP site in mammalian cell screening.

Can remove the site-specific integration carrier of random integration after carrying out cell transfecting, carry out drug screening, obtain the reconstitution cell of expression vector stable transfection; Then it is carried out the processing of Cre restructuring shearing loxP sequence and Dre restructuring shearing rox sequence, the reconstitution cell of the antibiotic-free selection markers plasmid-free skeleton of the special integration of acquisition pseudo attP site.

LoxP sequence is sheared in described Cre restructuring and being treated to of rox sequence sheared in Dre restructuring:

The transfection of the expression vector that the reconstitution cell after drug screening is comprised to Cre element and Dre element, or it is hatched containing to be connected with in wearing the Cre recombinase of film peptide and the environment of Dre recombinase.

Compared with prior art, the present invention has following useful technique effect:

1, the site-specific integration carrier of removing random integration provided by the invention, is carrying out after cell transfecting, at Streptomyces Phage

under integrase mediated, major part can be incorporated into pseudo attP site in gene of eucaryote cell group locus specificity, the region of the transcriptionally active between gene or in gene intron is partial in its distribution, genetic expression silence and other potential safety hazards of having avoided plasmid radom insertion to cause, thus make transgenosis continue high efficient expression.

2, the site-specific integration carrier of removing random integration provided by the invention, due to the design of positive-negative selection mark, can carry out drug screening by G418 and GCV, obtain and not only there is G418 resistance (prompting stable integration) but also do not express HSVtk(and point out without random integration event) positive cell clone, and be aided with fluorescence indicator protein prompting transient transfection efficiency and eliminating to the insensitive random integration reconstitution cell of GCV medicine.

3, the site-specific integration carrier of removing random integration provided by the invention, obtain after positive reconstitution cell in screening, by Cre restructuring shearing loxP and Dre restructuring are sheared to rox, remove two CMV promotors between loxP in the same way, just screening element and other carrier frameworks, and remove negative selection markers and fluorescence indicator protein between two rox, thereby the transgenosis recombinant chou that the pseudo attP site that obtains plasmid-free skeleton and selection markers is integrated, get rid of the impact of selection markers on transgenic animal safety and environmental safety, also the transgene silencing or the unstable expression that in host cell body, cause due to carrier framework have been avoided.

4, the site-specific integration carrier of removing random integration provided by the invention, for the problem such as vector integration site, transgene expression level, selection markers and carrier framework be residual, can be applicable to provides the nuclear donor cell of carrier free skeleton and selection markers for body-cell neucleus transplanting builds transgene clone embryo, thereby set up the safe cultivation system of transgenic animal of a kind of carrier free skeleton and selection markers, can be used for carrying out Animal Transgenic research.

Accompanying drawing explanation

Fig. 1 is the detected through gel electrophoresis figure that carrier pLAR-linker-tk-IAN-RMCSL builds;

Fig. 2 is the sequencing result of different linker in pLAR-linker-tk-IAN-RMCSL carrier;

Fig. 3 is carrier system pie graph of the present invention;

Fig. 4 is the expression that Western Blotting detects tk fusion rotein after different pLAR-linker-IAN-RMCSL expression vector transfected HEK 293s;

Fig. 5 is expression and the Subcellular Localization situation that immunostaining detects tk fusion rotein after different pLAR-linker-IAN-RMCSL expression vector transfected HEK 293s.

Fig. 6 is that after different pLAR-linker-IAN-RMCSL expression vector transfected HEK 293s, tk fusion rotein detects the cytotoxicity of different GCV concentration.

Embodiment

The site-specific integration carrier of removing random integration provided by the invention, this carrier system can be at Streptomyces Phage

under the mediation of intergrase, be incorporated into pseudo attP site in gene of eucaryote cell group locus specificity, thereby make transgenosis continue high efficient expression, the problem of resolved vector integration site, transgene expression level; Then after the positive cell that has obtained rejecting the participation of random integration event through medicine positive-negative selection, under the effect of Cre and Dre restructuring shearing, excise selection markers and other carrier frameworks, finally obtain the transgenic cell of screening marker-free and carrier framework, for body-cell neucleus transplanting, produce the transgenic animal of screening marker-free and carrier framework, thereby improve transgenic animal security, provide valuable technology platform for carrying out Animal Transgenic research.Below in conjunction with the structure of concrete carrier with detect that the present invention is described in further detail, the explanation of the invention is not limited.

A construction process of removing the site-specific integration carrier of random integration, comprises the following steps:

1), by SOE-PCR method, clone obtains the attB sequence that HindIII and SalI restriction enzyme site and a loxP sequence and a rox sequence are contained in the two ends as shown in SEQ.ID.NO.1, called after LAR; Concrete operations are:

Primer LAR_F1 and LAR_R1 are synthesized to fragment LAR1 by annealing;

Take carrier pARNG(referring to see patent ZL201110259942.8-" a kind of based on pseudo attP site integrate universal expression vector and construction process and application ") as template, obtain 300bp left and right fragment LAR2(by primer LAR_F2 and LAR_R2 amplification and see Fig. 1-a, swimming lane 1);

Take LAR1 and LAR2 as template, obtain the LAR fragment (seeing Fig. 1-a, swimming lane 2) of 381bp by primer LAR_F1 and LAR_R2 amplification

LAR?F1:ccaagcttcc?atggtagcta?gcataacttc?gtatagcata?cattatacga?agttatagg；

LAR?R1:ggtggcccta?taacttcgta?taatgtatgc?tatacgaagt?tatgctagct?accatggaag?c；

LAR?F2:ttatagggcc?accatgcccg?ccgtgaccg；

LAR?R2:cgacgtcgac?taactttaaa?taattggcat?tatttaaagt?taagatgtag?gtcacggtc；

2) with HindIII/SalI double digestion LAR sequence and pGEM-3Z carrier, gel reclaims LAR fragment and carrier framework fragment, and 4 ℃ of connections of spending the night, obtain recombinant vectors pGEM-LAR;

Enzyme is cut and is identified as shown in Fig. 1-b, wherein swimming lane 1 is HindIII/SalI double digestion pGEM-3Z carrier (negative control), only has the band of a 2743bp, and swimming lane 2 is HindIII/SalI double digestion pGEM-LAR recombinant vectors, can cut out 2743bp(pGEM-3Z carrier framework) and 381bp(LAR fragment) two bands.

3) the synthetic 3 kinds of linker sequences with SalI/BamHI sticky end of annealing, the pGEM-LAR carrier that is cloned into respectively SalI/BamHI double digestion obtains pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier; Sequencing result as shown in Figure 2.

Wherein, the linker sequence of Null is ccatgg;

(Gly4Ser) 3 linker sequence is ggtggcggtggctcgggcggtggtgggtcgggtggcggcggt tcc;

The linker sequence of P2A is ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtgg Aggagaaccctggaccc;

4) NcoI single endonuclease digestion pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier, reclaims 400bp left and right fragment, is cloned into respectively pORF-HSVtk carrier, obtains pLARNtk, pLARGtk and pLARPtk carrier;

Enzyme is cut qualification result as shown in Fig. 1-c: swimming lane 1 is NcoI single endonuclease digestion pORF-HSVtk carrier (negative control), have to a 4373bp band, swimming lane 2-4 is respectively NcoI single endonuclease digestion p LARNtk, pLARGtk and pLARPtk recombinant vectors, obtain respectively 4373bp and 400bp left and right two bands.

5) by SOE-PCR method, clone obtains the MCS that NotI restriction enzyme site and the 2nd loxP sequence are contained in two ends, is cloned into pIRES2-AcGFP1-Nuc carrier and obtains pIAN-MCSL; Concrete operations are as follows:

Primer MCS_F1 and MCS_R1 are synthesized to fragment MCS1(Fig. 1-d, 86bp by the method for SOE-PCR); This step SOE-PCR template used is primer itself, as MCS_F1/MCS_R1 itself be primer be also template, because these two pairs of primers have the reverse complementary sequence of 15-20bp, complementary sequence combination when annealing, when PCR, in Taq enzyme effect downward-extension polishing fragment, form the template of next round SOE-PCR;

Take fragment MCS1 as template, MCS_F1 and MCS_R2 are primer, by the synthetic fragment MCS(127bp of method of SOE-PCR, and Fig. 1-d), its sequence is specifically as shown in SEQ.ID.NO.2, and wherein LoxP sequence is ataacttcgt atagcataca ttatacgaag ttat;

MCS?F1：ataagaatgc?ggccgctcgc?gatcgcgact?agactagtct?agttg；

MCS?R1：cgaagttatc?gaccggtagc?ccttaattaa?ggttggcgcg?ccaactagac?tagtctagtc?gcgat；

MCS?R2：atagtttagc?ggccgcataa?cttcgtataa?tgtatgctat?acgaagttat?cgaccggt；

6) obtain SV40 terminator and the two rox sequence of two ends with PvuI and SpeI restriction enzyme site by PCR, be cloned in pIAN-MCSL carrier and obtain pIAN-RMCSL;

Double digestion qualification result is as shown in Fig. 1-e: swimming lane 1 is PvuI/SpeI double digestion pIAN-MCSL carrier, has to 5524bp mono-band; Swimming lane 2 is PvuI/SpeI double digestion pIAN-RMCSL recombinant vectors, obtains 5524bp and 280bp two bands.

7) NheI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk carrier, reclaim 1500bp left and right fragment, is cloned into respectively pIAN-RMCSL carrier, obtains pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL recombinant vectors;

Double digestion qualification result is as shown in Fig. 1-f, and swimming lane 1 is NheI single endonuclease digestion pIAN-RMCSL carrier (negative control), has to the band of a 5804bp; Swimming lane 2-4 is NheI single endonuclease digestion pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL recombinant vectors, obtains respectively two bands of 5804bp and 1500bp.

Constructed universal expression vector pLAR-linker-tk-IAN-RMCSL carrier, its pie graph as shown in Figure 3, comprise pUC ori, attB sequence and multiple clone site MCS, be respectively equipped with a loxP sequence and a rox sequence in attB sequence upstream and downstream, CMV promotor is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent mark gene, fluorescent mark gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just screening element.

Wherein pUC ori is the replication origin of plasmid, for plasmid can copy amplification in bacterium, derives from pEGFP-C1 carrier; AttB sequence is at Streptomyces Phage

under the mediation of intergrase, can there is homologous recombination with pseudo attP site in gene of eucaryote cell group (pseudo attP), thereby make carrier pARNG locus specificity and be integrated into the transcriptionally active district in gene of eucaryote cell group, be conducive to transgenosis and continue high efficient expression; Multiple clone site MCS comprises 5 rare restriction enzyme enzyme recognition sites, for the clone of goal gene element;

CMV constitutive promoter (deriving from pIRES2-AcGFP1-Nuc carrier) is connected with attB sequence, two rox elements are in the same way inserted in attB sequence downstream, it between rox sequence, is linker-tk-IRES2-AcGFP1-Nuc-SV40polyA element, two rox element downstreams are provided with multiple clone site MCS, MCS downstream is two LoxP elements in the same way, comprises KanR/neoR Expression element, pUC ori and CMV promotor between two LoxP elements.

After expression vector pLAR-linker-tk-IAN-RMCSL is incorporated into eukaryotic cell, through G418 drug screening, acquisition has the positive cell clone of G418 resistance, wherein: the reconstitution cell of site-specific integration is owing to rupturing in attB site, TK gene (negative selection markers) is not expressed, therefore still survival under GCV drug screening; And do not rupture in the reconstitution cell attB site of random integration, TK gene is continuous expression under the effect of CMV promotor, the necrocytosis under GCV drug screening pressure of random integration reconstitution cell.Obtaining after the reconstitution cell of site-specific integration, process positive cell clone with Cre recombinase and Dre recombinase, remove two neo selection markers, CMV promotor and other carrier frameworks between the TK selection markers between LoxP, green fluorescence protein gene and two rox sequences in the same way.

Sequence after a described loxP sequence, attB sequence and a rox sequence is connected is as shown in SEQ.ID.NO.1;

Sequence after described the 2nd rox sequence, MCS and the 2nd loxP sequence is connected is as shown in SEQ.ID.NO.2.

The following describes the application of constructed pLAR-linker-tk-IAN-RMCSL carrier at the transgenic cell of the antibiotic-free selection markers of screening site-specific integration, specifically comprise by the operation of cell cultures, transfection, fluorescent screening.

1, based on transient transfection cell, to the detection of tk expressing fusion protein

1) preparation of host cell

HEK293 cell is inoculated in the DMEM nutrient solution that contains 10% foetal calf serum, 6 well culture plates of inoculating cell are put into 37 ℃, 5%CO ₂in incubator.In the time that converging rate to 70%-90%, Growth of Cells carries out transfection.

2) preparation of transfection composite

A. prepare 6 aseptic centrifuge tubes of 1.5mL, add respectively 200 μ l Opti-MEM substratum;

B. in centrifuge tube, add respectively pIRES2-AcGFP1-Nuc plasmid vector (2 μ g, negative control), pORF-HSVtk-IAN plasmid vector (2 μ g, are cloned into pIRES2-AcGFP1-Nuc carrier by HSV-1tk open reading frame), (2 μ g), (g) (2 μ g) with pLARPtk-IAN-RMCSL plasmid vector for 2 μ for pLARGtk-IAN-RMCSL plasmid vector for pLARNtk-IAN-RMCSL plasmid vector;

C. of short duration soft vortex (being no more than 10s);

D. add respectively 8 μ l X-tremeGENE HP DNA Transfection Reagent;

E. of short duration soft vortex;

F. room temperature (15 ℃-25 ℃) is hatched 15-30min.

3) transfection composite is dropwise added in the cell of 6 well culture plates successively, respectively mark IAN, HSVtk, LARNtk, LARGtk and LARPtk;

4), after incubated cell 36h, the reconstitution cell that has carried out different reorganization schemes is carried out to following detection:

A, by the cell of restructuring be respectively used to Western Blotting detect.Collect each group of cell in the PBS of 1mL precooling solution, centrifugal 5 minutes of 1000rpm, supernatant discarded, 60 μ l Western and IP cell pyrolysis liquid (the green skies) re-suspended cell, add cOmplete Protease Inhibitor Cocktail Tablets (Roche) to be adjusted to working concentration, cracking 30min on ice, whole protein is added to sample-loading buffer, 100 ℃ of sex change 5min, 12% SDS-PAGE gel electrophoresis, then sample is transferred on pvdf membrane from SDS-PAGE gel by semidrying, 4 ℃ of night incubation of primary antibodie, washing, the two anti-2.5h of hatching, after washing, use the exposure of eECL Western Blot Kit highly sensitive chemistry luminous detection test kit.

Detect HSV-1tk: primary antibodie: Goat polyclonal antibody against HSV-1thymidine kinase(Santa Cruz company); Two is anti-: HRP-labeled Donkey Anti-Goat IgG (H+L) (the green skies).

Detect GAPDH: primary antibodie: Rabbit polyclonal antibody against GAPDH (Sigma company); Two is anti-: HRP-labeled goat anti-rabbit IgG (H+L) (the green skies).

Western Blotting detected result is as shown in Figure 4: carry out Western blotting detection using Goat polyclonal antibody against HSV-1thymidine kinase as primary antibodie, any band do not detected in negative control IAN; In positive control HSVtk and sample LARPtk, all detect that size is about the band of 40kDa; In LARNtk and LARGtk, detecting that size is about the band of 55kDa, the band of lower molecular weight detected simultaneously, may be fusion rotein degraded product (using starlike sign flag); GAPDH is as the internal reference of Western blot Protein Standardization.

B, by the cell of restructuring for immunofluorescence dyeing, PBS cleans three times, selects immunostaining stationary liquid (the green skies) room temperature fix 10min, PBS shakes and washes three times, at every turn 5min; With immunostaining confining liquid (containing Triton X-100, the green skies) room temperature sealing 60min, PBS shakes and washes 5min; Add the Goat polyclonal antibody against HSV-1thymidine kinase primary antibodie that is diluted to working concentration, 4 ℃ of night incubation, inferior daily PBS shakes and washes three times, each 5min; Add the anti-goat IgG of the donkey that contains Cy3 mark (H+L) antibody (the green skies) that is diluted to working concentration, normal temperature lucifuge is hatched 60min, shakes and washes three times after hatching end with PBS, each 5min; Add the DAPI that is diluted to working concentration to redye nucleus, normal temperature lucifuge is hatched 5min, hatches and finishes the rear staining fluid of removing, the Subcellar location situation of the various tk fusion roteins of fluorescence microscopy Microscopic observation after PBS cleans.

Result is as shown in Figure 5: in negative control IAN, can't detect any fluorescent signal; The expression of HSV-1tk gene in positive control HSVtk, detected, wild-type HSV-1tk is mainly distributed in tenuigenin; Tk expressing fusion protein in sample LARNtk, LARGtk and LARPtk, all detected, and tk fusion rotein is mainly distributed in tenuigenin; In addition, in sample LARNtk, LARGtk and LARPtk, all can be observed green fluorescent protein (AcGFP1-Nuc) and express, be mainly distributed in nucleus.

Above detected result proves:

By pLAR-linker-tk-IAN-RMCSL(pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL or pLARPtk-IAN-RMCSL) after transfected HEK 293, tk expressing fusion protein, and be mainly distributed in tenuigenin.

C, the reconstitution cell of the cells green fluorescent protein (AcGFP1-Nuc) after transfection is sorted out by BD FACSAria flow cytometer (BD company), and with 5.0 × 10 ³the density of cells/well is inoculated in 96 orifice plates, then adds the GCV of different concns (0,0.01,0.1,1,10, and20 μ g/mL).After 4 days, illustrate and detect the sensitivity of different tk fusion roteins to GCV according to WST-1 cell proliferation and toxicity detection kit (the green skies).

Result is as shown in Figure 6: the reconstitution cell of transfection pIRES2-AcGFP1-Nuc empty carrier is insensitive to GCV, even if within 4 days, only demonstrate afterwards 2.76% cell mortality in the GCV effect of 10 μ g/mL high densitys; And the reconstitution cell of transfection pORF-HSVtk-IAN, pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL carrier is under the GCV effect of 10 μ g/mL high densitys, all demonstrate cytotoxicity, GCV processes nearly all necrocytosis after 4 days; .And in the time that GCV activity is reduced to 0.1 μ g/mL, in LARPtk group, have 51.1 ± 4.0% necrocytosiss, cell mortality is significantly higher than LARNtk (28.5 ± 7.7%, P=0.001) and LARGtk group (34.8 ± 4.5%, P=0.032), point out it more responsive to GCV.

3, remove the screening of the transgenic cell of the site-specific integration of random integration:

Treat that Growth of Cells converges rate to 70%-90%, use electroporation transfection method is carried out pLARNtk-IAN-RMCSL plasmid vector, pLARGtk-IAN-RMCSL plasmid vector and pLARPtk-IAN-RMCSL plasmid vector respectively with phiC31 intergrase mRNA cotransfection to HEK293 cell.

Because universal expression vector pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL comprise G418 resistant gene neoR, under stable integration can be survived to the positive cell of the neoR gene on genome in the nutrient solution that contains finite concentration G418, and be that the normal cell of transfection can be killed by this medicine.

After universal expression vector transfected HEK 293 24h being that the G418 of minimum lethal concentration (400 μ g/ml) screens containing adding final concentration in the DMEM cell culture fluid of serum; With the negative contrast of HEK293 inoblast of untransfected, its cell culture fluid is added with the G418 of same concentration.After transfectional cell G418 screening 12d, the cell of control group is all dead; The positive reconstitution cell of transfection that shows as G418 resistance is observed under fluorescent microscope, observed fluorescence indicator protein AcGFP1-Nuc and whether express.

Because attB sequence is connected between CMV promotor and tk fusion rotein-IRES2-AcGFP1-Nuc reading frame, therefore can cause attB sequence to rupture by the integrase mediated site-specific integration of phiC31, thereby tk fusion rotein and AcGFP1-Nuc fluorescin are not expressed, and the reconstitution cell that site-specific integration only occur is insensitive and can't detect green fluorescence under fluorescent microscope to GCV medicine; The random integration relating in integrating remark can not affect CMV-tk fusion rotein-IRES2-AcGFP1-Nuc expresses, thereby causes the reconstitution cell that relates to random integration can green fluorescence under fluorescent microscope, can be detected and produce cytotoxicity and death under GCV drug effect.

According to this characteristic, design two kinds of screening methods:

A.G418(400～600 μ g/mL) single medicine screening;

B.G418(400～600 μ g/mL) and GCV(1～10 μ g/mL) positive and negative two screenings.

G418 single medicine screening can obtain fluorescent protein expression (GFP+) and fluorescin does not express the mono-clonal of (GFP-), and the positive and negative two mono-clonals of having to GFP-that screen of G418 and GCV.By counting, visible:

After the different pLAR-linker-tk-IAN-RMCSL carrier of table 1 transfected HEK 293, form the contrast of clone's number

Result shows: under the screening of G418 single medicine, owing to not comprising attB element in HSVtk group, therefore the experimental group that the number of cell clones with G418 resistance (G418r) of its formation significantly contains attB element lower than other, and nearly all cell clone presents the GFP positive (GFP+) in HSVtk group, prompting random integration occurs; Although and major part presents GFP feminine gender in other experimental group, still some presents the GFP positive, point out in these GFP positive cells and have random integration event.Under G418 and the two drug screening of GCV, in HSVtk group, be unscreened to obtain recombinant cell clone, supposition is due to random integration cells HSV-1tk albumen, produces cytotoxicity, necrocytosis under GCV drug effect; And the number of cell clones obtaining in experimental group reduces while screening compared with G418 single medicine, and GFP positive cell ratio significantly reduces, especially in LARPtk group for GFP positive cell being detected, supposition is because the tk fusion rotein of expressing in LARPtk group causes GCV is more responsive compared with the fusion rotein of expressing in LARNtk and LARGtk group.

After the two screenings of G418 and GCV, in the cell clone of survival, choose and not only there is G418 resistance but also the positive cell clone of expressing green fluorescent protein not, the G418 concentration of substratum is reduced by half and continues screening until at the bottom of cell covers with ware, then use pancreas enzyme-EDTA peptic cell, then add the not DMEM cell culture fluid enlarged culturing of added with antibiotic.

3) Cre and the processing of Dre recombinase:

By not only have G418 resistance but also not the positive cell of expressing green fluorescent protein be inoculated in the DMEM nutrient solution that contains 10% foetal calf serum, 6 well culture plates of inoculating cell are put into 37 ℃, 5%CO ₂in incubator.In the time that converging rate to 70%-90%, Growth of Cells carries out Cre and the processing of Dre recombinase.

3.1Cre and Dre plasmid transfection sieve method:

A. prepare the aseptic centrifuge tube of 1.5mL, add 200 μ l Opti-MEM substratum;

B. to add in centrifuge tube pCAG-Cre-IP plasmid vector (1 μ g) and pCAGGs-Dre-IRES-puro(1 μ g);

C. of short duration soft vortex (being no more than 10s);

D. add respectively 8 μ l X-tremeGENE HP DNA Transfection Reagent;

E. of short duration soft vortex;

F. room temperature (15 ℃-25 ℃) is hatched 15-30min.

G. transfection composite is dropwise added in the cell of 6 well culture plates;

H. after incubated cell 24h, obtain the cell of the antibiotic-free mark of restructuring.

I.PCR detects the excision of Cre and Dre recombinase-mediated;

3.2Cre and Dre protein transduction method:

In Cre and Dre recombinase treatment step, express the plasmid vector random integration of Cre or Dre recombinase in positive cell genome, bring unnecessary risk, can use and be connected with Cre and the Dre recombinase of wearing film peptide and add in DMEM cell culture fluid, hatch 4h, then utilize Protocols in Molecular Biology to detect, finally obtain the positive cell of antibiotic-free selection markers.

Claims (10)

1. can remove the site-specific integration carrier of random integration for one kind, it is characterized in that, comprise pUC ori, attB sequence and multiple clone site MCS, be respectively equipped with a loxP sequence and a rox sequence in attB sequence upstream and downstream, CMV promotor is connected to the upstream of a loxP sequence, negative screening-gene is connected with a rox sequence, negative screening-gene downstream is also connected with internal ribosome binding site IRES2, IRES2 downstream is fluorescent mark gene, fluorescent mark gene downstream is MCS, MCS upstream and downstream is respectively equipped with the 2nd rox sequence and the 2nd loxP sequence, and identical with a loxP sequence direction with a rox sequence respectively, MCS downstream is for just screening element.

2. the site-specific integration carrier of removing random integration as claimed in claim 1, is characterized in that, described multiple clone site MCS comprises following restriction enzyme enzyme recognition site: PvuI, SpeI, AscI, PacI and AgeI.

3. the site-specific integration carrier of removing random integration as claimed in claim 1, it is characterized in that, the open reading frame of described negative screening-gene is HSVtk open reading frame, between negative screening-gene and a rox sequence, be also connected by linker, the open reading frame of fluorescent mark gene is AcGFP1-Nuc open reading frame, and its terminator is Sv40 terminator; Just screening element is KanR/neoR Expression element.

4. the site-specific integration carrier of the random integration removed as described in claim 1 or 3, it is characterized in that, a loxP sequence, attB sequence, a rox sequence, linker and tk bear screening-gene amalgamation and expression loxP-attB-rox-linker-tk under the effect of CMV promotor; Fluorescent mark gene is raised rrna translation fluorescence indicator protein by IRES2 after transcribing under the effect of CMV promotor; Described CMV promotor is composing type Pcmv IE promotor.

5. the site-specific integration carrier of removing random integration as claimed in claim 3, it is characterized in that, described loxP-attB-rox-linker-tk fusion gene, is divided into three kinds according to linker difference: LAR-Null-tk, LAR-(Gly4Ser) 3-tk and LAR-P2A-tk.

6. the site-specific integration carrier of removing random integration as claimed in claim 1, is characterized in that, the sequence after a described loxP sequence, attB sequence and a rox sequence is connected is as shown in SEQ.ID.NO.1;

Sequence after described the 2nd rox sequence, MCS and the 2nd loxP sequence is connected is as shown in SEQ.ID.NO.2.

7. the construction process that can remove the site-specific integration carrier of random integration, is characterized in that, comprises the following steps:

1), by SOE-PCR method, clone obtains the attB sequence that HindIII and SalI restriction enzyme site and a loxP sequence and a rox sequence are contained in the two ends as shown in SEQ.ID.NO.1, obtains LAR sequence;

2) enter pGEM-3Z carrier with HindIII/SalI double digestion LAR sequence clone and obtain pGEM-LAR carrier

3) the synthetic linker sequence with SalI/BamHI sticky end of annealing, the pGEM-LAR carrier that is cloned into respectively SalI/BamHI double digestion obtains respectively pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier;

4) difference NcoI single endonuclease digestion pGEM-LAR-Null, pGEM-LAR-(Gly4Ser) 3 and pGEM-LAR-P2A carrier, reclaim 300bp left and right fragment, be cloned into respectively pORF-HSVtk carrier, obtain respectively pLARNtk, pLARGtk and pLARPtk carrier;

5) by SOE-PCR method, clone obtains the MCS that NotI restriction enzyme site and the 2nd loxP sequence are contained in two ends, is cloned into pIRES2-AcGFP1-Nuc carrier and obtains pIAN-MCSL;

6) obtain SV40 terminator and the two rox sequence of two ends with PvuI and SpeI restriction enzyme site by PCR, be cloned in pIAN-MCS carrier and obtain pIAN-RMCSL;

7) NheI single endonuclease digestion pLARNtk, pLARGtk and pLARPtk carrier, reclaim 1500bp left and right fragment, is cloned into respectively pIAN-RMCSL carrier, obtains pLARNtk-IAN-RMCSL, pLARGtk-IAN-RMCSL and pLARPtk-IAN-RMCSL.

8. the site-specific integration carrier of removing random integration claimed in claim 1 provides the application of rejecting random integration reconstitution cell and directly filter out the reconstitution cell of the special integration of pseudo attP site in mammalian cell screening.

9. application as claimed in claim 8, is characterized in that, can remove the site-specific integration carrier of random integration after carrying out cell transfecting, carries out drug screening, obtains the reconstitution cell of expression vector stable transfection; Then it is carried out the processing of Cre restructuring shearing loxP sequence and Dre restructuring shearing rox sequence, the reconstitution cell of the antibiotic-free selection markers plasmid-free skeleton of the special integration of acquisition pseudo attP site.

10. application as claimed in claim 9, is characterized in that, loxP sequence is sheared in described Cre restructuring and being treated to of rox sequence sheared in Dre restructuring:

The transfection of the expression vector that the reconstitution cell after drug screening is comprised to Cre element and Dre element, or it is hatched containing to be connected with in wearing the Cre recombinase of film peptide and the environment of Dre recombinase.

Images