CN103816562B

CN103816562B - A kind of scars of war quick-acting haemostatic powder product and preparation method thereof

Info

Publication number: CN103816562B
Application number: CN201410035698.0A
Authority: CN
Inventors: 易正芳; 吕方; 丛晓楠; 金明飞; 裴正培; 刘明耀
Original assignee: East China Normal University
Current assignee: East China Normal University
Priority date: 2013-12-02
Filing date: 2014-01-24
Publication date: 2016-01-13
Anticipated expiration: 2034-01-24
Also published as: CN103816562A; CN103820412B; CN103820411B; CN103820412A; CN103820411A

Abstract

The invention discloses a kind of scars of war quick-acting haemostatic powder product and its preparation method and application, this product comprises the matrix that with the addition of described Microbial transglutaminase (mTG), does the aminoacid sequence of wherein said Transglutaminase EC2.3.2.13 have as SEQ? ID? the protein sequence of the genes encoding described in NO:3, or have as SEQ? ID? protein sequence described in NO:4.More specifically, this hemostasia products is selected from hemostatic agent, hemostasis device, first-aid hemostatic bag or common hemostatic article, and described matrix is the absorbable fluid of human body or semi-solid form, or plastic glue or colloid form.It contains Microbial transglutaminase and gelatin.The present invention has quick-acting haemostatic powder, easy to use, anti-organ is adhered, promote wound healing, toxic side effect is low, absorb the advantage such as completely, except for except war hemostasis, also can be widely used in the wound quick-acting haemostatic powder of the field environment such as fire-fighting, security incident.

Description

A kind of scars of war quick-acting haemostatic powder product and preparation method thereof

Technical field

The invention belongs to the quick-acting haemostatic powder product for field trauma, be specifically related to a kind of hemostatic composition containing Microbial transglutaminase (mTG) and its preparation method and application, this product can be used for the wound quick-acting haemostatic powder of the field environments such as war, fire-fighting, security incident.

Background technology

Severe loss of blood is one of principal element of common people's peacetime death because of wound, and Bleeding control (or bleeding) is the important step of first aid and trauma care.In the field environments such as operation, as war, fire-fighting, security incident etc., because salvage at scene measure is limited, it is pressed for time, condition is simple and crude, makes bleed too much and cause dead event to happen occasionally.Show according to the statistic data that up-to-date, U.S. army falls in battle in officers and men at fight-terrorism warfare, has 90% dead in the way being sent to hospital, and nearly 1/4 just dies because of severe loss of blood within injured 5 ~ 10 minutes.According to statistics, in war, around major blood vessel wound accounts for more than 95% of whole blood vessel injury, and hemostatic technique has become most important link in current treatment of war wound, so hemostasis in time plays a crucial role for reduction percentage of killed in action in war.In addition, in the security incidents such as traffic accident is large, profuse bleeding also usually causes death, often being only in China causes at least 10 ten thousand people dead because of traffic accident, in security incident, has at least 20% personnel to cause death because of massive blood loss (exceeding self-blood total amount more than 20%).Therefore, the quick-acting haemostatic powder product being adapted to the actual needs such as China's war or security incident wound is developed in time particularly important.

At present, think that the desirable first aid hemostasia products for war or mishap has 8 standards in the world, that is: (1) quick-acting haemostatic powder; (2) can use at any time, not need to prepare in advance or mix; (3) be simple and easy to use, do not need the participation of health care professional; (4) lightweight and durable; The storage period of (5) at least 2 years and wide temperature range storage capability (-10 DEG C to 55 DEG C); (6) have no side effect, do not injure or the risk of the viral disease that spreads disease; (7) with low cost; (8) little to wound side effect, be convenient to wound healing.Current commercially available prod comprises following several:

(1) zeolites

Zeolite is a kind of mineral substance of occurring in nature, is distributed in mineral deposits or lakebed volcanic ash deposition area more.With aluminate polymkeric substance and silicate for raw material, by controlling reaction type and Tc, the artificial zeolite similar with natural zeolite can be produced.Natural or artificial zeolite's xln, after dehydration, sterilization, becomes a kind of powerful absorption agent, alternatively absorbs multiple gases and liquid, the moisture also in Absorbable rod blood.According to this principle, Chinese People's Liberation Army's Military Medical Academy has developed a kind of Quick-acting styptic powder, and it is the hemostasia products being mainly composition with zeolite developed, and has haemostatic effect better, the advantages such as cost is low.But zeolites hemostatic material has some shortcomings part: one is release of heat in hemostasis, makes local temperature raise, instantaneous temperature, close to 60 ~ 70 DEG C, easily causes site of injury to burn; Remove difficulty after two hemostasis, cause body and mind painful to patient, likely cause secondary hemorrhage, increase the weight of body and mind misery; Three is that zeolite density is large, carries inconvenience.But due to not substitute better at present, therefore still become the hemostasia products being applied to war or field accident at present and saving oneself

(2) Quickclot

U.S. army employs Quickclot and stops blooding to war wound wound in Afghan War and the war in Iraq, and effect is better, significantly improves the survival rate of the wounded.A kind of synthetic inert particulate mineral substance that this material is made up of Si oxide, aluminium, sodium, magnesium and a small amount of quartz, there is effect of molecular sieve and adsorption moisture, covered in bleeding wounds during use, absorb rapidly the moisture in clot, accelerate coagulation process, scab is formed ahead of time.But, and zeolites is seemingly, also there is the deficiency such as heating, clear difficulty in this material.

(3) Fibrin Glue class

Rorbert (RorbertLW.Tissueadhesiveforbattlefieldhemorrhagecontrol [C] ADB209674 in 2000,2000:1 14.) develop a kind of war wound bleeding-stopping dressing, it forms by three layers: innermost layer is the organosilicon membrane sprinkled with Fibrin Glue dry powder, middle one deck is polyurethane foamed material, skin is medical pressure sensitive adhesive, and object can be used for stopping blooding to arteriorrhexis.But such material weak point possible bring that human body or animal blood borne disease infect, complex structure, and cost is high, use inconvenience, anthemorrhagic speed slow, and to great vessels haemostatic effect difference etc.

In addition, some Fibrin Glue needs to add Trypsin inhibitor,Trasylol (such as: Tisseel and Beriplast is all furnished with aprotinin bovine, and Crosseal is furnished with tranexamic acid) in use to slow down fibrinous dissolving in coagulation process temporarily.Within 2008, once there is report (FergussonDA heart operation mortality ratio being increased about Trypsin inhibitor,Trasylol, HebertPC, MazerCD, FremesS, MacAdamsC, MurkinJM, eta1.Acomparisonofaprotininandlysineanaloguesinhighriskc ardiacsurgery [J] .NEnglJMed, 2008,358:23192331.), Bayer pharmaceuticals has reclaimed its aprotinin preparations at each hospital pharmacy (trade(brand)name: Trasylo1) thereafter.

(4) SURGICEL class

SURGICEL (trade(brand)name: Oxycel) is the one of derivatived cellulose, is formed through oxidation of nitric oxide by Mierocrystalline cellulose.And oxidized regenerated cellulose is (also known as speed and yarn, China claims: soluble stanching gauze, trade(brand)name: Surgicel), it is a kind of regenerating oxidation fibrage yarn block, belonging to carboxymethyl cellulose class hemostatic material, is that Mierocrystalline cellulose becomes tulle shape or the cotton shape Absorbable hemostatic material of cellulosic acid through oxide treatment.Its hemostatic mechanism has acid carboxyl Fe3+ in oxyphorase to be combined, form brown blob of viscose, close capillary vessel end and stop blooding, simultaneously after close contact wound, the hemostatic composition in blood can be made to be gathered on mesh gauze, but do not rely on physiological clotting mechanism (JamborovaG.PospisilovaN, SemeckyV, HysplerR, TichaA, PospechovaK, eta1.Microdispersedoxidizedcelluloseasanovelpotentialsub stancewithhypolipidemicproperties [J] .Nutrition, 2008, 24:11741181.).Soluble stanching gauze, after close contact wound, can make blood coagulation composition be gathered in around it, complete hemostasis at 2 ~ 8min, is usually used in the position that the hemorrhage and oozing of blood of surgical wound surface not easily stops at present, as surface of bone oozing of blood etc.Evidence suggests that Surgicel just starts to be absorbed by body in one day in the contact surface of a wound, uptake rate with consumption and local blood for and the character of local organization and fixed, one is 4 ~ 8 weeks.It is good that this product has histocompatibility, soft and belittle, is easy to the advantages such as bag, deposited, filling.Weak point is that bleeding stopping period is longer, poor to hemorrhage swift and violent person's effect, be not suitable for separately as wound hemostasis material (week swashs. introduce a kind of novel rectangle medicine bag [J]. the medical officer people, 2002,45 (1): 61.).In addition, Surgicel can reduce pH value around damaged tissue, this peracidity environment has certain antibacterial ability, but peracidity environment can strengthen inflammatory reaction around damaged tissue simultaneously, cicatrize a wound delay (Kr í zovP, MsovL, SuttnarJ, SalajP, DyrJE, HomolaJ, eta1.Theinfluenceofintrinsiccoagulationpathwayonbloodpla teletsactivationbyoxidizedcellulose [J] .BiomedMaterResA, 2007,82:274280.).

(5) hemostasis gelatin class

Hemostasis gelatin to extract and purifying forms through the animal skin such as pig or ox, and its vesicular structure Absorbable rod overweights self blood of 45 times, volumetric expansion sealing blood vessels breach or the surface of a wound after absorbing blood, and activates thrombocyte, promotes that blood clot is formed, reaches hemostasis object.Although hemostasis gelatin derives from animal tissues, do not have antigenicity, inorganization is reacted, and staying in the body can be digested after 4 ~ 6 weeks through enzyme effect.With above-mentioned oxidized regenerated cellulose unlike, hemostasis gelatin can not affect the pH value of periwound tissue, therefore be more suitable for and other hemostatic material conbined usage (IgaiH, YamamotoY, ChangSS, YamamotoM, TabataY, YokomiseH.Trachealcartilageregenerationbyslowreleaseofba sicfibroblastgrowthfactorfromagelatinsponge [J] .JThoracCardiovascSurg, 2007,134:170175.).But gelatin hemostasis needs the participation of body thrombin, for there being the not good enough (MartinowiteU of the patient outcome of blood coagulation disorders, SpotniteWD.Fibrintissueadnesives [J] .ThrombHaemost, 1997,78:661.), wound surrounding tissue may be oppressed because expanding after its absorbing blood simultaneously, therefore not be suitable for the operative site near neural or narrow space.Ox horn Glue matrix and thrombin preparation combine by the FloSeal researched and developed by Baxter company, and gelatin particle carries out filling hemostasis by compression by volumetric expansion to wound, and zymoplasm accelerates blood clot and formed.But as mentioned before, these two kinds of ingredient exerts anastalsises all rely on body clotting mechanism.In addition, zymoplasm in FloSeal is from human plasma, at present verifiedly pass through two step steam heating process and effectively can reduce virus load in blood plasma, but the complete processing (ErethMH still not having thoroughly to remove viral infectivity in human plasma goods at present admits in manufacturers, SchaffM, EricsonEF, WetjenNM, NuttallGA, OliverWCJrComparativesafetyandefficacyoftopicalhemostati cagentsinaratneurosurgicalmodel [J] .Neurosurgery, 2008, 63:369372.), illustrate that this series products exists the risk of transmitted diseases.

In sum, three major types (first two is chemical material class) is divided into for the first aid hemostasia products of war or security incident in the world:

Table 1

As shown in Table 1, the first aid hemostasia products that can meet above standard completely is also lacked at present.

In sum, desirable war or first aid hemostasia products, it should at least have following general character, that is: hemostasis is fast, wound is not adhered, easily healing, with low cost, easily by body absorption, not fast spreading disease and sequela few etc.But still do not reach at present or the close hemostatic agent reaching above-mentioned standard.To this, in recent years, people constantly carry out the research and development of novel hemostatic material.

Transglutaminase EC2.3.2.13 (protein-L-glutamic acid-gamma-glutamyl amine transaminase; Transglutaminase; be called for short TGase); also known as transglutamin-ase 9 transaminase or gamma-glutamyl amine acyltransferase; be made up of 331 amino; catalyzing acyl shift reaction, can the hydrolysis of glutamy amido in catalytic proteins molecule or in intermolecular crosslinked, connection between protein and amino acid and protein molecule, thus improves the structure and function characteristic of protein.Due to the crosslinking feature of its brilliance, be described as " 21 century super tackiness agent ".Extensive prospect (Cui Yanhua etc., " biotechnology circular ", 2009 year first phase) is shown in fields such as food, medicine, weaving, makeup

TGase is extensively present in animal and plant and microflora organisms tissue.Nearest research finds, the TGase of different sources has difference in the physico-chemical property of aminoacid sequence, molecular size range, enzyme.Not etc., need calcium ion activated, enzyme active center is not cysteine residues site for the TGase molecular weight of animal-origin.The TGase of animal-origin is the most deep with the TGase of Guinea Pig Liver (GTG) research, and the molecular weight of this enzyme is 90kD, and its enzymatic reaction needs calcium ion activated.Strong to substrate specificity, cause its poor heat stability because this enzyme contains 17 cysteine residues simultaneously.At 50 DEG C, after 10 minutes, enzymic activity is only residual 40%.The TGase activity influence of calcium ion to plant origin is different because of species.The TGase source of extracting from animal tissues is few, and cost is high, and separable programming is complicated, not easily applies.

It is still not fully aware of which kind of role TGase plays the part of in plant tissue, and Kang etc. extract TGase and are studied from soybean leaves.But separation purifying technique is complicated, the yield of enzyme is lower.At present, plant origin TGase is not yet had for commercially producing.

But microbe-derived TGase (mTG) has different enzyme characteristics from the TGase of animal-origin, mTG molecular weight is between 23 ~ 45kD, and majority is about 40kD, about the half for animal-origin TGase molecular weight.Importantly, mTG has stronger thermostability, and all has greater activity within the scope of relatively wide pH.Meanwhile, the enzymic activity of mTG does not rely on calcium ion, so there is the acry radical donor of substrate specificity widely, this point is completely different from the TGase of plant and animal material.Meanwhile, mTG comparatively GTG compares, and has more significant stability under elevated pressure conditions.Above-mentioned characteristic makes mTG have more wide range of application.

Microbe-derived TGase belongs to extracellular enzyme, can direct secretion in substratum. separation and purification is easy compared with the TGase of plant and animal material, and fermentable cheaper starting materials, to produce the enzyme cycle short, the most applicablely carry out large-scale industrial production, therefore enjoy the favor of investigator.

Research finds that TGase glutamine between catalysis adjacent fiber protein molecular and Methionin can form ε-(Y glutamine)-Methionin covalent linkage, thus it is crosslinked to be formed between adjacent fiber protein molecular.Transglutaminase EC2.3.2.13 and factor XIII a (FXIIIa) belong to Transglutaminase EC2.3.2.13 superfamily; function and the latter are very similar; can catalyzing acyl shift reaction; make in protein molecule or intermolecular formation is cross-linked; thus change the structure and function of protein; this reaction is present in a lot of biological procedures, comprises the sclerosis of blood clotting process, wound healing, epidermal cornified, erythrocyte membrane.Chinese patent " purposes of Transglutaminase EC2.3.2.13 " (CN2008100475880) reports Transglutaminase EC2.3.2.13 and can be used as skin wound healing promoters or its activeconstituents, wherein comprises the activeconstituents of Transglutaminase EC2.3.2.13 as skin wound healing promoters of 0.1-100U/ml or 0.1-100% dry weight.But, this research be only using Transglutaminase EC2.3.2.13 as assistant agent (i.e. promotor) for wound healing, it had not both related to the purposes of quick-acting haemostatic powder, do not study this enzyme and how to realize the effect that wound is not adhered yet, the scheme of 0.1-100U/ml or the 0.1-100% dry weight is simultaneously too wide in range, lacks concrete effective data and is not finally authorized to.Therefore, its correlative study still rest on TG enzyme how to reduce the wound healing time aspect (talk red, Microbial transglutaminase to the research of rat Wound Healing, " Chinese biological engineering magazine ", the 27th volume the 9th phase in 2007; Zhang Nianrong, the characteristic of glutaminase transaminase and applied research progress thereof, " western leather ", the 34th volume the 14th phase in 2012).

Chinese patent application CN2007800512154 and patent family application WO2008076407 thereof discloses a kind of gelatin-Transglutaminases hemostasis auxiliary material and sealing material, and it comprises the cross-linked material of gelatin and nontoxicity Transglutaminases, can be used for treating wound tissue.But, it is conventional microbial source transglutamin-ase 9 transaminase (USA that this invention uses, CHICAGO, lot number L-04207), this enzyme is not only expensive, and optimal reaction temperature one at 50 DEG C about-55 DEG C, when normal temperature (25 DEG C), enzyme is lived and is only had about 20% of optimal reaction temperature, thus has had a strong impact on the activity relating to Transglutaminase EC2.3.2.13 (see embodiment 1).

For this phenomenon, studies in China person Cui Yan China waits (Transglutaminase EC2.3.2.13 progress, " biotechnology circular ", 1st phase in 2009) paper show, " mTG deriving from different microorganisms there are differences in zymetology; even there is this either large or small difference between the TG enzyme of different bacterial classifications even from same bacterial classification different strains in iso-electric point, optimal pH, optimum temperuture, thermostability etc., these difference directly can affect the application of enzyme." " such as, the TG enzyme genetic homology of bacillus TG enzyme and streptomyces is lower, and the enzyme activity also there are differences.The enzyme optimum temperuture alive of S.mobaraensismTG is 50 DEG C, and is 60 DEG C from the mTG optimum temperuture of B.subtilis.”

Due to for war hemostasis series products, the stability of enzyme is very important, particularly for normal temperature preserve product all the more so.But the optimal reaction temperature of the mTG of above-mentioned research one at 50 DEG C about-55 DEG C, when normal temperature (25 DEG C), enzyme is lived and is only had about 20% of optimal reaction temperature, even in body temperature (37 DEG C) left and right, (BuettnerK about the enzyme half also only having best enzyme to live alive, HertelTC, PietzschM, AminoAcids.2012Feb; 42 (2-3): 987-96.; MarxCK, HertelTC, PietzschM, JBiotechno1.2008Sep10; 136 (3-4): 156-62.).In addition the thermostability of these enzymes is poor, and 60 DEG C can cause mTG enzyme loss about 80% (MarxCK, HertelTC, PietzschM, JBiotechno1.2008Sep10 alive for 10 minutes; 136 (3-4): 156-62.).For These characteristics, the scientist of Germany, to this has been research, and achieves certain achievement, has found that the enzyme of Heat stability is good under high temperature is (as above-mentioned document, and European patent WO2008020075A1, WO2010101256A1; US Patent No. 20120021459A1), but the best enzyme reaction temperature of these enzymes is still at about 50 DEG C, and this constrains the application of Transglutaminase EC2.3.2.13 as curable product far away.

For addressing this problem, the present inventor proposes to utilize at first Chinese patent application CN2012101922407 the Microbial transglutaminase proenzyme not having enzyme and live first, and in conjunction with appropriate activating enzyme and gelatin, obtains good wound hemostasis effect.But, the activating enzyme that this institute uses is Dispase, this is a kind of nonspecific metalloprotease, although its can dispersion tissue, classification cell, but part Dispase can injure cell, and it is unstable when cultivating, even mycoplasma contamination may be introduced, and it is expensive, need Dispase and Transglutaminase EC2.3.2.13 proenzyme to carry out aqueous solution before use simultaneously, the two can not be pre-mixed and to make relevant curable product, this greatly have impact on the medical use of Transglutaminase EC2.3.2.13 proenzyme.

In addition, the present inventor proposes to utilize the existing wild enzyme of transformation to obtain high reactivity mutant enzyme at another previous Chinese patent application CN2012102021709, and it relate to the recombinase (hereinafter referred to as 3 mutant enzymes) that 3 site mutations obtain.Although this mutant enzyme has certain haemostatic effect, but general effect particularly preventing adhesiving effect haves much room for improvement, and anthemorrhagic speed (i.e. the activity of enzyme) need to improve, therefore have impact on the war first aid purposes of Transglutaminase EC2.3.2.13 proenzyme to a certain extent, cause it to be only applicable to the purposes that are micro-, that stop blooding in a small amount such as daily wound.

Based on the good haemostatic effect of Microbial transglutaminase and the feature had no side effect, needing to provide a kind of at present take Microbial transglutaminase as rapid hemostatic material and the compound hemostatic product of main active ingredient, it should have quick-acting haemostatic powder, avoid organ or tissue's adhesion, easily absorb, not fast spreading disease, hemostatic material in medical use with low cost, to fill up the blank needs of civil war or scene of the accident quick-acting haemostatic powder analogous products.

Summary of the invention

In sum, prior art problem is how to provide a kind of containing new Microbial transglutaminase, quick-acting haemostatic powder product for war or other wounds, wherein this enzyme should have and is different from prior art structure and performance is more excellent, and the quick-acting haemostatic powder product of described war simultaneously or other wounds also should have the product structure being different from prior art.

Therefore, thinking of the present invention is active not enough under being to overcome existing Transglutaminase EC2.3.2.13 normal temperature, or need auxiliary to activate the shortcoming of (i.e. activating enzyme), to provide a kind of take Novel transglutaminase as main active ingredient, for the rapid hemostatic material of war or other wound hemostasis and compound hemostatic product.This new Microbial transglutaminase, its structure is different from the mutant that any one reported has new capability, can meet simultaneously and to depart to lesser temps in optimum activity temperature and to have good thermostability.Pyroprocessing shows, and this mTG still embodies very high remnant enzyme activity after 70 DEG C of process.Temperature of reaction shows, and the optimum activity temperature of this enzyme is 40 DEG C (closer to human body temperature), lower than wild-type mTG, simultaneously normal temperature and 37 DEG C time higher than wild-type mTG than enzyme work.

The mTG Primary mutations site with thermostability comprising foregoing bibliographical information is the mutant serine of 2 is tyrosine, or the mutant serine of 23 is α-amino-isovaleric acid or tyrosine, or the tyrosine of 24 sports l-asparagine, or the lysine mutation of 294 is leucine or Isoleucine; Or the mutant serine of 101 is proline(Pro), or the glycine mutation of 250 is arginine, or the glycine mutation of 157 is Serine.The Transglutaminase EC2.3.2.13 of these sudden changes does not have more than 3 amino acid mutation combinations, and does not have good thermostability.

Therefore, the present invention's first object is to provide a kind of new Microbial transglutaminase mTG, this mTG there occurs the amino acid mutation in four sites compared with wild-type mTG, sudden change is respectively that the 23rd Serine becomes L-Ala, 73 glycine become tyrosine, 317 Methionin becomes glutamine and 325 Methionins become glutamine (i.e. S23A, G73Y, K317Q, K325Q), and these four mutational sites (suddenling change hereinafter referred to as four) is all different from the mutational site of existing bibliographical information.In one embodiment, described Transglutaminase EC2.3.2.13 mTG has the sequence as described in SEQIDNO:4.In another embodiment, described Transglutaminase EC2.3.2.13 mTG has the protein sequence of the genes encoding as described in SEQIDNO:3.

In a specific embodiment, described Transglutaminase EC2.3.2.13 mTG, wherein this enzyme electrophoresis purity is more than at least 90%, and specific activity is greater than 25U/ milligram, and preferably, purity is more than 95%, and specific activity is greater than 25U/ milligram; Wherein the optimal reactive temperature of this enzyme is between 25-45 DEG C.

The present invention's second object is the gene order providing a kind of said mutation enzyme of encoding.In one embodiment, described sequence is selected from the gene as described in SEQIDNO:3.

The present invention's the 3rd object is active not enough under being to overcome existing Transglutaminase EC2.3.2.13 normal temperature, or need auxiliary to activate the shortcoming of (i.e. activating enzyme), there is provided a kind of and comprise the war or scene of the accident quick-acting haemostatic powder product (organ or tissue such as the wounded under other wound environment of war stops blooding) that this Transglutaminase EC2.3.2.13 is chief active matrix, this hemostasia products comprises the matrix that with the addition of Microbial transglutaminase (mTG), the aminoacid sequence of wherein said Transglutaminase EC2.3.2.13 has the protein sequence of the genes encoding as described in SEQIDNO:3, or the protein sequence had as described in SEQIDNO:4.

In one embodiment, described matrix is the absorbable solid of human body, semisolid, powder or fluid, or plastic glue or colloid form.In a specific embodiment, the electrophoresis purity of described Microbial transglutaminase is more than at least 90%, and specific activity is greater than 25U/ milligram.Preferably, purity is more than 95%, and specific activity is greater than 25U/ milligram.

In one embodiment, the form of described Microbial transglutaminase includes but not limited to solid, semisolid or fluid, plastic glue or the form such as colloid, powder.

In one embodiment, except Microbial transglutaminase in described hemostasia products, also containing other auxiliary materials, described auxiliary material includes but not limited to mineral powder, protein powder etc.In a specific embodiment, described hemostasia products is military hemostasia products.

In another embodiment, described hemostasia products is hemostatic agent (including but not limited to powder hemostatic article, solid state hemostatic article, fluid or semi-fluid hemostatic article, liquid hemostatic goods), hemostasis device, first-aid hemostatic bag or first-aid chest or common hemostatic article.

In a specific embodiment, the matrix of described fluid or semi-solid form or material comprise liquid fiber albumen sealing material or glue class, such as Keratin sulfate, collagen protein, fluid gelatin etc.Wherein, liquid fiber albumen sealing material or glue class as hemorrhage control Operation theatre subsidiary material and employed (people (1990) .J.Trauma.30:512-513 such as J.L.Garza of many years; The people such as H.B.Kram (1990) .J.Trauma.30:884-887), and single donor fibrin sealant material is widely used in various surgery situation clinically.In another embodiment, described liquid fiber albumen sealing material or glue class comprise lysate, and described lysate is phosphate buffered saline buffer, and phosphate buffered saline buffer PH scope is from 7.0 to 9.0.

In another embodiment, described plastic glue or colloid form comprise SURGICEL, oxidized regenerated cellulose, chitosan, Keratin sulfate, collagen protein, gelfoam, in a more particular embodiment, the material of plastic glue or colloid form can be gelfoam, it can be used as jointing material, simulate scleroproein-zymoplasm cascade reaction that stops blooding with Microbial transglutaminase to realize stopping blooding, and (T.Chen, Biomacromolecules.2003 November-December can be removed on demand with being had no problem; 4 (6): 1558-63; ).

In one embodiment, described matrix is selected from proteinaceous substances, such as absorbable fibre albumin glue, Keratin sulfate, collagen protein or gelatin, or glucide, such as SURGICEL, oxidized regenerated cellulose, chitosan, protein-polysaccharide (such as poly-n-acetyl glucosamine amine), glycolic acid polymer, lactic acid polymer.In a specific embodiment, described matrix comprises the medical gelatin in various source and liquid fiber albumen sealing material or glue, such as Keratin sulfate, collagen protein, one from animal-origin, recombinant sources or its combinations produce source.In a more particular embodiment, Absorbable rod matrix is gelatin.Preferably, the preferred fish of animal-origin and mammiferous gelatin.More preferably, Mammals is selected from the gelatin of pig and ox.The A type high molecular gelatin of this experiment preferred mammal, or the gelatin of 20% ~ 60% proline(Pro) hydroxylation.

In a preferred embodiment, Powdered Microbial transglutaminase (mT6) is dissolved in phosphate buffered saline buffer, forms Microbial transglutaminase solution; Hydroxylation gelatin powder is dissolved in phosphate buffered saline buffer, forms hydroxylation gelatin solution; Described Microbial transglutaminase (mT6) solution is mixed with hydroxylation gelatin solution, the fluid composition of the gelatin comprising above-mentioned transaminase and 20% ~ 60% proline(Pro) hydroxylation can be prepared.In a preferred embodiment, described Microbial transglutaminase concentration is within the scope of 1U/g ~ 180U/g in the composition; Described hydroxylation gelatin solution concentration is within the scope of 15%w/v ~ 40%w/v.In another preferred embodiment, the volume ratio of described hydroxylation gelatin solution and Microbial transglutaminase solution is 10:1 ~ 1:10.The stock material shapes of hemostasia products described here is: the gelatin of (i) powder, particle or other solid forms; (ii) the transglutamin-ase 9 transaminase of powder, particle or other solid forms.

The present invention's the 4th object is to provide the hemostasis device of a kind of scars of war hemostasis, comprises the enzyme according to any one of above-mentioned embodiment, composition or hemostasia products.The form of described enzyme, composition or hemostasia products includes but not limited to the forms such as solid, semisolid, fluid, liquid, gas (as sprays), can make gauze shape, the as required various and form that produces such as spongy.

In one embodiment, described hemostasis device is tourniquet or hemostatic gauze, comprise with cotton yarn or the soluble stanching gauze tourniquet that is body or hemostatic gauze outer, with for the internal layer contacted and bind up a wound, containing the matrix powder of described Transglutaminase EC2.3.2.13 or medicine core in wherein said internal layer.In a specific embodiment, described internal layer shows to be rich in protective film or pad pasting.

In another embodiment, the preparation method of described tourniquet or hemostatic gauze is as follows:

This section of content is prepared enzyme powder contents instead and is claimed 1-6g Microbial transglutaminase to be dissolved in 240ml50mMHEPES damping fluid (PH=7), is mixed with enzyme and lives as the mT6 enzyme solution of 50-300u/ml.In addition, also can select to contribute to keeping transglutaminase activity and the customary adjuvant being conducive to performance haemostatic effect, as gelatin etc.

Laminatedly in cotton yarn or soluble stanching gauze scribble medical adhesive,

Matrix powder containing above-mentioned enzyme is sprayed on the sticking internal layer of tool, forms tourniquet or hemostatic gauze drug core layer;

Protective film or mucous membrane are set outside drug core layer, make described hemostasis device.

In another embodiment, described hemostasis device is the spraying plant of quick-acting haemostatic powder, comprises the spraying of pressurization or the mixture of foam, gelatin and Transglutaminase EC2.3.2.13 component.In a specific embodiment, above-mentioned hemostasis device comprises the mixture of a part of transglutamin-ase 9 transaminase composition, gelatin, foam or spraying.Using of the hemostasis adjunct ingredient mixture of these methods is used selectively such as also immediately to mix them before administration by separating storing mixture component; Such as optionally by with inactive form together storage component with immediately activate them before administration and come.One or more in the spray-dired powder that the hemostasis auxiliary material component of inactive form is selectively provided as frozen soln, needs the powder of the freeze-drying reconstituted, needs reconstitute and/or the non-activity sealing material mixture of any other applicable form.

In other embodiments, described hemostasis device can also be the first-aid hemostatic bag, first-aid chest etc. containing above-mentioned gelatin and Transglutaminase EC2.3.2.13 component.In other embodiments, described hemostasis device is military hemostasis device.

The present invention's the 5th object is to provide a kind of method of the quick-acting haemostatic powder product for the preparation of war or scene of the accident wound, this product comprises the matrix that with the addition of Microbial transglutaminase, and the aminoacid sequence of wherein said Transglutaminase EC2.3.2.13 is as shown in SEQIDN0:4.

Step comprises:

(1) preparation can express the recombinant microorganism of described Microbial transglutaminase, and carries out recombinant expressed;

(2) collect also purifying and there is the Transglutaminase EC2.3.2.13 of described activity, and be configured to living solution;

(3) by ordinary method, the living solution of described Transglutaminase EC2.3.2.13 is added in human body Absorbable rod matrix;

(4) described matrix is carried out conventional processing, namely obtain the above-mentioned quick-acting haemostatic powder product for war or scene of the accident wound.

In one embodiment, Powdered Microbial transglutaminase (mTG) is dissolved in phosphate buffered saline buffer, forms Microbial transglutaminase solution; Powdered hydroxylation gelatin is dissolved in phosphate buffered saline buffer, forms hydroxylation gelatin solution; Described Microbial transglutaminase (mTG) solution is mixed with hydroxylation gelatin solution, the fluid composition of the gelatin comprising above-mentioned transaminase and 20% ~ 60% proline(Pro) hydroxylation can be prepared.In a preferred embodiment, described Microbial transglutaminase concentration is within the scope of 1U/g ~ 180U/g in the composition; Described hydroxylation gelatin solution concentration is within the scope of 15%w/v ~ 40%w/v.In another preferred embodiment, the volume ratio of described hydroxylation gelatin solution and Microbial transglutaminase solution is 10:1 ~ 1:10.

Selectively, the present composition may further include and forms the object that bionical clot reaches hemostasis.

technical term

" scars of war " used herein or " accident wound " refers in war or the scene of the accident, is subject to bullet, any infringement that any tissue of mishap to the wounded carries out, and it causes a large amount of blood loss, the even deficiency of skeletal limb etc. of the recycle system.Tissue can be in-vivo tissue (such as organ or blood vessel), or vitro tissue (such as head, four limbs etc.).The loss of blood can be (such as from the organ broken) in body, or external (such as from lacerated wound, scuffing, incised wound etc.).Wound can in soft tissue (such as organ), or in sclerous tissues's (such as bone).This wound does not process in time, maybe should may cause life threatening.Therefore, of the present invention is not hemostasia products for daily wound (Micro trauma) for war or scene of the accident wound quick-acting haemostatic powder product, as patches such as adhesive bandages, the hemostasia products that clinical operation rescues class neither be used for, as medical hemostatic bag, hemostasis adhesive tape, mosquito forceps etc.

" field trauma " used herein refers to the field condition such as scars of war, security incident wound, as traffic accident, mine accident, industrial accident etc.If not otherwise specified, war class wound also includes the wounds such as traffic accident, mine accident, industrial accident, but war class wound or field trauma do not comprise daily life category microtrauma or clinical operation wound class.

" hemostasia products " used herein and hemostatic agent refer to containing Transglutaminase EC2.3.2.13 of the present invention (mTG) and the quick-acting haemostatic powder goods of " scars of war " or " accident wound " can be used for, such as: hemostatic agent (comprising powdery hemostatic article, solid state hemostatic article, fluid or semi-fluid hemostatic article, liquid hemostatic goods), hemostasis device, first-aid hemostatic bag or first-aid chest and existing hemostatic article.In common battlefield or onsite application, the hemostasia products of described non-device class also can be described as hemostatic agent.

" absorbability matrix or material " used herein refers to spontaneous and/or is decomposed into the material of component via body of mammals, described component is consumed significantly not disturb the mode of wound healing and/or tissue regeneration or eliminates, and can not cause any significant metabolism disorder.Such as, but resorbable material proteinaceous substances, such as scleroproein, Keratin sulfate, collagen protein, or glucide, such as alginate, chitin, Mierocrystalline cellulose, protein-polysaccharide (such as poly-n-acetyl glucosamine amine), glycolic acid polymer, lactic acid polymer or oxyacetic acid/lactic acid copolymer.But such as resorbable material glucide.Wherein, based on the bleeding-stopping dressing of the above resorbable material improved, it comprises the multiple layers comprising absorbability material, for example, see PCT/US03/28100, and No. 0060155234th, U.S. Patent application.

" non-resorbable material " used herein refers to and can not be decomposed into nontoxicity by patient body or not disturb wound healing and/or tissue regeneration, maybe can not cause the material of any significant metabolism disorder, as sterile bandage, sterile gauze, mineral substance class styptic powder (Si oxide powder, potassium iron oxygen acid salt powder etc.) etc.

Beneficial effect

The present invention with Microbial transglutaminase and gelatin for active substance, compared with the prior art, beneficial effect of the present invention comprises, and the hemostasia products containing Microbial transglutaminase and gelatin can strengthen scars of war wound recovery effects, and haemostatic effect is obvious.Secondly, the raw material Microbial transglutaminase that the present invention uses, under the function not changing traditional microbiological Transglutaminase EC2.3.2.13 and original hypotoxic situation, by the thermotolerance of certain technique improvement Microbial transglutaminase, obtain the Microbial transglutaminase at normal temperatures with better stability.In addition, the effects such as this hemostasia products has quick-acting haemostatic powder, anti-wound is adhered, and low side effect, to have good healing effect, onset of action fast to wound, absorb the advantages such as good.Especially, in war or accident wound environment, product of the present invention does not generate heat in hemostasis, apply after without the need to removing, histocompatibility and absorptivity are good, overcome heating noted earlier, be difficult to shortcomings such as removing, can not absorb.In the use procedure of this product, thermopositive reaction is not obvious, can not cause burn to human body, and can be rapidly absorbed in body and do not produce negative interaction, avoids other class Hemostatic products later stages to remove and the secondary injury that brings.In addition, the present invention can the single married operation that can complete hemostatic agent, easy to use, has adapted to the needs of special conditions in war and accident wound.

Accompanying drawing explanation

Fig. 1 represents the detected through gel electrophoresis figure of mutant mTG gene in embodiment 3;

Fig. 2 represents the mass spectrometry results of mTG albumen in embodiment 5;

Fig. 3 represent the present invention in embodiment 6 suddenly change mTG albumen polishing purification after electrophorogram, wherein 4 swimming lanes are the albumen of purifying;

Fig. 4 to represent in embodiment 7 that the suddenly change specific activity of mTG albumen of wild-type mTG albumen, three site mutation mTG albumen and the present invention at different temperatures measures;

Fig. 5 represents that novel hemostasia products of the present invention and blank group are respectively to the haemostatic effect that rat femoral is hemorrhage.Wherein: Fig. 5 A represents that control group is to the hemorrhage haemostatic effect of rat femoral, and wherein Fig. 5 A-1 represents exposed Rats femoral artery, 5A-2 represent cut off femoral artery after severe bleed; Figure B represents that novel hemostasia products of the present invention is to the hemorrhage haemostatic effect of rat femoral, wherein Fig. 5 B-1 represents exposed Rats femoral artery, 5B-2 represents that cutting off the later severe of femoral artery bleeds, 5B-3 represents that applying hemostasia products of the present invention is bled for 3 minutes later to be stopped, and 5B-4 represents that applying the present invention detects the binding property of hemostasia products and wound with tweezers after 5 minutes;

Fig. 6 represents novel hemostasia products of the present invention and blank group respectively to the hemostasis quantitative statistics of rat femoral;

Fig. 7-A represents to break in rat femoral and is namely applied with novel hemostasia products of the present invention, and Fig. 7-B applies the wound suture outward appearance recovery situation of rat leg after 21 days, and Fig. 7-C represents that solution cuts the recovery situation of rat leg muscle after rat leg open;

Fig. 8-A (enlarged view B) is subcutaneous shallow-layer healthy tissues colored graph.Figure C (enlarged view D) represents at subcutaneous shallow-layer, and experimental group applied hemostatic composition after the 7th day, the tissue staining figure that composition and muscle tissue biocompatible tissue dye.

Fig. 9 represents that experimental group applied hemostatic composition after the 21st day, and composition and muscle tissue biocompatible tissue dye, and figure A (enlarged view B) is subcutaneous shallow-layer, and figure C (enlarged view D) is subcutaneous deep, and arrow indication is composition.

Figure 10 represents that in embodiment 9, novel hemostasia products of the present invention (containing Microbial transglutaminase and gelatin) and blank group are respectively to the hemostasis quantitative statistics of rat liver;

Figure 11 represents hemostatic composition of the present invention (containing Microbial transglutaminase and gelatin) and blank group respectively to the hemostasis of rat liver Hemorrhage Model and anti-ly ooze out effect schematic diagram, wherein:

Figure 11 A and 11C be the front control group of exposure of display process and the liver of experimental group respectively;

The hemostasis that Figure 11 B and 11D bled for 10 seconds after showing the liver wound of manufacture control group and experimental group respectively naturally;

Figure 11 E and 11F shows control group respectively and applies 2 points of hemostasis of 30 seconds, 5 minutes after the present composition;

Figure 11 G and 11H expression manual mode check the binding property of the present composition;

Figure 12 represents the absorbing state of composition of the present invention in rat liver Hemorrhage Model, component 1-5 is illustrated respectively in experimental group B (applying novel hemostasia products of the present invention) and control group A (Johson & Johnson: absorbable hemostatic gelfoam, trade(brand)name Surgiflo ^tM) before process, apply the recovery situation of 2 points of injury of livers after 30 seconds, 5 days, 20 days.

Embodiment

In conjunction with following specific embodiments and the drawings, the present invention is described in further detail, and protection content of the present invention is not limited to following examples.Under the spirit and scope not deviating from inventive concept, the change that those skilled in the art can expect and advantage are all included in the present invention, and are protection domain with appending claims.Implement process of the present invention, condition, reagent, experimental technique etc., except the following content mentioned specially, be universal knowledege and the common practise of this area, the present invention is not particularly limited content.

Embodiment 1 enzyme activity determination

1) enzyme preparation of reagents alive is surveyed

A liquid (0.5L): 0.015mol (5.06g) substrate Na-CBZ-Gln-Gly, 0.05mol (3.475g) oxammonium hydrochloride, 0.005mol (1.536g) reduced glutathion are added 400ml distilled water in beaker, by magnetic stirrer after 20 minutes, add 0.1mol (12.11g) Tris, pH to 6.0 is adjusted with 6mol/L (or lmol/L) hydrochloric acid, solution is moved in 500ml volumetric flask, pour in volumetric flask 3 times with distilled water wash beaker, be settled to 500ml.

B liquid: 3mol/LHCl, 12% trichoroacetic acid(TCA) (W/V), 5% iron trichloride (W/V is dissolved in 0.1mol/L hydrochloric acid, refilters) mix by the volume ratio of 1:1:1.

2) enzyme activity determination

Experimental group: get 0.2ml testing sample, adds 2mlA liquid 37 DEG C of incubations 10 minutes, then adds 2mlB liquid.Control group: get 0.2ml testing sample, adds 2mlB liquid 37 DEG C of incubations 10 minutes, then adds 2mlA liquid.Light absorption value is measured in 525nm.

The mutagenesis of embodiment 2 wild strain

Wild-type mTG bacterial strain is luxuriant source streptomycete (Streptomycesmobaraensis) (as the strains A TCC numbering 29032 of U.S. ATCC or the strains A TCC numbering 27441 of U.S. ATCC, or China Microbiological preserves the bacterial strain at center as CGMCC numbering 4.1719 and CGMCC numbering 4.5591).

Substratum configures: Gause I substratum: Zulkovsky starch 20g/L, KNO ₃1g/L, MgSO ₄7H ₂o0.5g/L, K ₂hPO ₄3H ₂o0.5g/L, NaCl0.5g/L, FeSO ₄7H ₂o0.01g/L, agar 20g/L, pH7.2-7.4.Fermention medium: glycerine 20g/L, yeast extract paste 6g/L, fish meal protein peptone 25g/L, MgSO ₄7H ₂o2g/L, K ₂hPO ₄3H ₂o2g/L, pH7.4.

In Gause I substratum, add the cold sterilized water of 10ml, with inoculating needle abundant scraping surface mycelia, break up spore, aseptic filter paper filters.

Carry out under operating in red light or lucifuge condition, within 0.5 hour, open ultraviolet lamp in advance, make light stability.Get concentration and be about 10 ⁷it is 6 centimetres of sterilizing plates that the spore suspension 3mL of individual spore/mL is placed in diameter, utilizes magnetic stir bar to stir, and under ultraviolet lamp power 15W condition, different irradiation distance, uv irradiation different time carries out mutagenesis.Dilution for difference spore suspension, after 1 hour, is coated on Gao Shi substratum in dark situation by lucifuge, cultivates 7 days for 30 DEG C.Picking list bacterium colony, cultivates 24 hours in the fermentation medium, and during mensuration 37 DEG C, the enzyme of candidate strain and wild strain is lived respectively.

The acquisition of embodiment 3 mutant mTG gene

Genome extracting: the fresh mycelia of mutant strain the highest for the enzymic activity of liquid culture in embodiment 2 is inoculated in fresh culture, cultivates 24 hours; Collected by centrifugation 10ml thalline; New fresh thalli is in mortar (-20 DEG C of precoolings), and liquid nitrogen grinding is to finely powdered repeatedly, and rapid average mark is filled in 2 1.5mL centrifuge tubes; Add TE damping fluid 550 μ L, add the 20%SDS solution 30 μ L of 65 DEG C of preheatings, vortex oscillation 5 second, add 20mg/mL Proteinase K 20 μ L, mix gently, 37 DEG C of insulations 1 hour; Add equal-volume Tris saturated phenol/chloroform/primary isoamyl alcohol (25:24:1) extracting, slightly put upside down mixing, centrifugal 10 minutes of 10000rpm; In careful absorption supernatant to new centrifuge tube, add equal-volume chloroform/primary isoamyl alcohol (24:1) extracting, 10000rpm, centrifugal 5 minutes; Aspirate supernatant and equal-volume Virahol (4 DEG C of precoolings) mix, and then centrifugal 5 minutes of 10000rpm, abandons supernatant.Precipitation 1mL70% ethanol (4 DEG C of precoolings) washing (put upside down, centrifugal 1 minute), natural air drying, add 40uLTE and dissolve ,-20 DEG C save backup.

Design of primers: devise pair of primers can obtain mTG gene complete sequence by polymerase chain reaction, this sequence is selected from: SEQNO:1:ctcaacgaaagcgctccggccgcttc

SEQNO：2：cgctcacatcacggccagccctgc

PCR reaction system and reaction conditions: by the genomic dna of above-mentioned acquisition and primer mixing, carry out PCR reaction by following condition: Taq enzyme reaction solution (2 times of concentration) 25 μ L, primer Pf (2.5mmol/mL) 2 μ L, primer Pr (2.5mmol/mL) 2 μ L, DNA2 μ L and sterilized water.94 DEG C of sex change 1 minute, 55 DEG C annealing 30 seconds, 72 DEG C 2 minutes, 40 circulations altogether.

Electrophoresis detection PCR purity, as shown in Figure 1, left lane is molecular weight standard DNA to result, and the right swimming lane is PCR fragment electrophoresis result.PCR fragment size is between 1000bp and 2000bp, consistent with theoretical value 1058bp.

Embodiment 4 is suddenlyd change the order-checking of mTG gene

In the PCR primer in embodiment 3, add the dehydrated alcohol of 2 times of volumes, mixing, room temperature places 5 minutes.Centrifugal 10 minutes of 12000rmp, abandons most supernatant; Ethanol with 70% washes precipitation once.Drying, with 50 μ L sterilized water dissolution precipitations.React by following system: aseptic water-soluble PCR primer 1 μ L, pUC19-T carrier (Takara company) 0.5 μ L, ligase enzyme 0.5 μ L, damping fluid (10 times of concentration) 5 μ L and sterilized water 43 μ L, mixing, 16 DEG C of reactions 20 minutes.Above-mentioned reacted product is got 5 μ L, joins 100 μ L bacillus coli DH 5 alpha competent cells (Takara company), 4 DEG C are reacted 30 minutes, and 42 DEG C are reacted 90 seconds, add LB substratum, cultivate 1 hour for 37 DEG C, by the coating of bacterium liquid with on LB flat board.After bacterium colony is formed, order-checking company is sent to check order.Compared with wild-type mTG gene, detect mutational site.

Check order through ordinary method, find that the sequence of this mutator gene is as shown in SEQIDNO:3, infer that the protein amino acid sequence of its correspondence is as shown in SEQIDNO4 thus.

The general purifying of embodiment 5mTG albumen

Fermention medium and bacterial strain, with embodiment 2, by luxuriant source streptomycete spore inoculating to being equipped with 30mL fermention medium, to be cultivated 28 hours.Centrifugal 30 minutes of 12000rmp in 4 DEG C of whizzers, removes thalline and solid impurity, obtains 20mL substratum supernatant.Add 40mL dehydrated alcohol, place 1 hour for 4 DEG C.In 4 DEG C of whizzers, centrifugal 30 minutes of 12000rmp, abandons supernatant, collecting precipitation, precipitation is placed in ampoule, and freeze-drying 2 days in freeze drier, namely obtains the wild-type mTG albumen of preliminary purification.

By the luxuriant source streptomycete spore inoculating of sudden change in the 250ml triangular flask that 30mL fermention medium is housed, cultivate 24 hours.Other operation stepss are the same, and purifying obtains sudden change mTG albumen.

Whether its structure of protein utilization mass spectroscopy of purifying is consistent with theoretical implications.Final mass spectrometry results shows as shown in Figure 2: its mass spectroscopy molecular amount is shown as 37934.9Da, meets with the molecular structure of the deduction of gene sequencing.Illustrate that protein sequence is really SEQNO4.Through comparison, relative to wild-type sequence, this SEQIDNO; 4 have 4 sites to undergo mutation, and be respectively that the 23rd Serine becomes L-Ala, 73 glycine become tyrosine, 317 Methionin becomes glutamine and 325 Methionins become glutamine (i.e. S23A, G73Y, K317Q, K325Q).

Embodiment 6 the present invention suddenlys change the polishing purification of mTG albumen

Ion exchange column is utilized to carry out albumen polishing purification in the albumen obtained in embodiment 5.Filler is DEAE-Sephrosefastflow (GEhealthcare), and balance liquid is the tris/HCl damping fluid of 0.05M, pH9.0, and elutriant is the tris/HCl of the NaCl50mM of 0-1mol/L, pH9.0.Linear elution 16 column volumes, collect each component, electrophoresis detection, obtain the good mTG albumen of purity.By freeze-drying after this component desalination.It is consistent with the molecular size range of expection 37.9kDa that experimental result shows this albumen size, and purity is very high, and electrophoresis only has single band, and purity was greater than for 99% (as shown in Figure 3).4th swimming lane is the albumen of purifying.Thus, the result of embodiment 6 has also confirmed the protein sequence analyzed in embodiment 5 is further really SEQNO4.

Suddenly change under embodiment 7 differing temps mTG albumen specific activity measure

The wild-type mTG albumen that purifying is obtained and the present invention suddenly change mTG albumen measure at 25 DEG C, 37 DEG C, 45 DEG C, 55 DEG C, 75 DEG C respectively enzyme live.Measure enzyme and live method therefor with described in embodiment 1.The solution that surveying lives uses preheating 2 minutes at the temperature of correspondence respectively before the reaction.Experimental result display (as shown in Figure 4), at differential responses temperature, the present invention suddenly change mTG ratio enzyme live show the diverse tendency with wild-type mTG.The present invention suddenlys change mTG optimal reaction temperature at about 45 DEG C, and wild-type mTG optimal reaction temperature is at about 55 DEG C, and mTG optimal reaction temperature of the present invention is starkly lower than wild-type mTG.And at 25 DEG C-75 DEG C, mTG of the present invention is more alive than enzyme is all significantly higher than wild-type.37 DEG C time, mTG of the present invention is more alive than enzyme reaches 80U/ milligram, has lived high more than 100%, also improve 50% than 3 site mutations at first patent CN2012102021709 than wild-type mTG enzyme.In addition, under the hot conditions more than 55 DEG C wild-type mTG activity sharply decline and mTG of the present invention still retain high enzyme live.When 65 DEG C-75 DEG C, mTG of the present invention still retains high enzyme and lives, and now wild-type mTG almost inactivation.Visible, compare with 3 site mutation enzymes than wild-type mTG, the present invention mTG that suddenlys change has significantly good enzyme activity and heat-resistant stability, enzyme activity and haemostatic effect positive correlation, 4 sudden change mTG haemostatic effects of the present invention are pointed out to be better than wild-type mTG and 3 site mutation enzymes, and its environment for use is more wide in range, for war or accident wound site environment, there is better adaptability.

Embodiment 8 gene engineering method prepares mTG of the present invention

In order to ensure also can to obtain mutator gene under the prerequisite not having luxuriant source streptomycete mutant strain, the present embodiment utilizes the method for synthetic to obtain mTG mutant.

By the gene order of said mutation at business-like biotech firm (as above marine life engineering corporation, Ying Jun biotech company etc.) synthesis complete genome sequence, and be cloned into commercialization coli expression carrier pET-32a (as Merck biotech firm or other biotech firm; Other expression vector any is as pET-32b or other suitable carrier) EcoRV site in, form the expression vector that can be expressed goal gene.Technical transform conveniently, in e. coli bl21, obtains the genetic engineering bacterium can expressing this albumen.Be inoculated into by this genetic engineering bacterium in 20mlLB substratum, adding solubility according to 1/1000 of culture volume after cultivating 16 hours at 37 DEG C 200 rpms is 1mol/L lactose solution, continues cultivation 4 hours, collects thalline.

With the broken thalline of Ultrasonic Cell Disruptor under the power of 200w; 10000rmp centrifugal 5 minutes supernatant discarded, are resuspended in precipitation in the solution containing 8mol/L urea, blow and beat 3 times; Centrifugal 5 minutes of 10000rmp, collects supernatant purifying as described below.

Utilize the Ni-NTASpin test kit of QIAGEN company, carry out purifying according to wherein said method.Concrete grammar carries out according to its specification sheets completely, finally obtains the fusion rotein of the mTG containing sudden change.

Add the Dispase of 1/10 quality according to the quality of fusion rotein in fusion rotein solution.37 DEG C effect 30 minutes after,

According to the method purifying of embodiment 6, obtain mTG albumen of the present invention.

Embodiment 9: rat femoral hemostasis experiment

This case study on implementation provides the case study on implementation to external profuse bleeding quick-acting haemostatic powder under product simulation battlefield surroundings of the present invention.

Indication of the present invention containing the hemostatic material lyophilized powder proportioning of Transglutaminase EC2.3.2.13 is: Transglutaminase EC2.3.2.13 5400U; Hydroxylation gelatin 25g; Sorbyl alcohol 5g.Preparation method is: claim the 25g hydroxylation gelatin heated and stirred that adds water to make it dissolve completely; Claim 5g sorbyl alcohol, add in above-mentioned solution, stir and make it dissolve completely; Use 0.22 μ tm membrane filtration degerming again, be placed to room temperature and inject and be settled to 100ml with water.Sterile filtration adds 5400U Transglutaminase EC2.3.2.13, after mixing, is placed in Freeze Drying Equipment and carries out lyophilize.Shatter powdered after drying terminates, this hemostatic composition packaging is made finished product.

SD rat 14 is selected in experiment, is divided into blank group and experimental group (mTG-gelatin) at random, often organizes 7.

Surgical knife is used to cut the femoral artery of rat.Severe is bled after about 10 seconds, immediately uses the blood of gauze removing accumulation before administration.Before using hemostatic composition, hemostatic composition is ready to.Apply after composition, femoral artery is still bled being less than in 3 minutes to stopped completely.After 5 minutes, use is taken the photograph son and is manually detected hemostasia products.Observe the experiment effect of gauze hemostasis and the hemostasis of novel hemostasia products respectively, Taking Pictures recording.And statistic fluid blood volume.

Experimental result is shown in Fig. 5 A (control group) and Fig. 5 B (experimental group), and wherein Fig. 5 A-1 represents exposed Rats femoral artery, and 5A-2 represents that cutting off the later severe of femoral artery bleeds; Figure B represents that novel hemostasia products of the present invention is to the hemorrhage haemostatic effect of rat femoral, wherein Fig. 5 B-1 represents exposed Rats femoral artery, 5B-2 represents that cutting off the later severe of femoral artery bleeds, 5B-3 represents that applying hemostasia products of the present invention is bled for 3 minutes later to be stopped, and 5B-4 represents that applying the present invention detects the binding property of hemostasia products and wound with tweezers after 5 minutes.

Therefore, Fig. 5 A shows: rat femoral is cut off rear femoral artery and bled seriously, presses 3 minutes still can not stop blooding with gauze.Illustrate that femoral artery is bled unsuccessful with gauze hemostasis.

On the contrary, Fig. 5 B shows: rat femoral is cut off nature and bled after 10 seconds, apply hemostasia products, the bleeding of femoral artery when being less than 3 minutes can be observed stopped by hemostasia products, time standby tweezers at 5 minutes detect hemostasia products and the adhesion situation of rat leg muscle and the viscosity of hemostasia products, find that hemostasia products viscosity is good, and the adhesion of hemostasia products and rat leg muscle is all right, difficult drop-off.

While the above scheme of enforcement, collect the blood flow of each experimental group, adopt electronic balance weighing and add up the bleeding capacity of rat femoral in 3 minutes.Result is as shown in Figure 6: rat femoral is bled and successfully to be stopped blooding in three minutes with novel hemostasia products, and above-mentioned experimental result illustrates that the quick-acting haemostatic powder of hemostasia products of the present invention is functional.

Embodiment 10: the tissue compatible Journal of Sex Research of novel hemostasia products

15 rats are selected in experiment.Be divided into 5 at random for blank group, 10 is experimental group (mTG-gelatin).

Wherein 10 experimental group, use surgical knife to cut the femoral artery of rat.Severe is bled after about 10 seconds, immediately uses the blood of gauze removing accumulation before administration.Before using hemostatic composition, hemostatic composition is ready to.Apply after composition, femoral artery is still bled being less than in 3 minutes to stopped completely.After 5 minutes, use is taken the photograph son and is manually detected hemostasia products.Afterwards for rat is sewed up, sub-cage rearing.The huckle muscle getting Test sites when the 7th day and 21 days respectively carries out tissue slice.Get 5 rats at every turn.Experimental result shows as shown in Figure 7: be just applied with composition and applying composition the wound recovery situation of rat leg and changing conditions of muscle after 21 days.

Experimental result shows, rat leg the novel hemostasia products of applying after 21 days wound recover, solution is observed hemostasia products contrast and is disappeared with when firm applying after cutting open, and leg muscle does not have significant difference compared to healthy tissues.Illustrate that novel hemostasia products Absorbable rod is all right, detrimentally affect is not caused to rat.

Then, wherein 5 control groups, first day is got 5 rat muscles and is cut into slices, and as blank, obtains the section of normal muscle tissue.

Wherein the experimental procedure of tissue slice is as follows:

1, draw materials with fixing:

Take off tissue block (one thickness is no more than 0.5 centimetre) from rat thigh position to drop into stationary liquid 10% formalin prepared in advance.

2, dewater transparent:

One makes dewatering agent with by lower concentration to alcohol in high concentration, sloughs the moisture content in tissue block gradually.Again tissue block is placed in and was both dissolved in alcohol, be dissolved in again in the transparent base dimethylbenzene of paraffin transparent.

3, waxdip embedding:

Transparent tissue block is placed in the paraffin dissolved, puts into wax-dissolving box insulation.Immerse completely after tissue block until paraffin and embed.

4, section and paster:

Embedded wax stone is fixed on slicing machine, thinly slices.The thin slice cut is put in the water of heating and plates, then is attached on slide glass, puts in 45 DEG C of thermostat containers and dries.

5, dewaxing dyeing:

Dye with HE

HE dyeing course is:

1. put into the phenodin aqueous solution dye entering the section after distilled water several minutes.

2. color separation in sour water and ammoniacal liquor, each several seconds.

3. running water enters distilled water for a moment after 1 hour.

4. enter in 70% and 90% alcohol to dewater each 10 minutes.

5. alcohol eosin stains liquid dyeing 2-3 minute is entered.

6, dewater transparent:

Section after dyeing is dewatered through straight alcohol, then makes section transparent through dimethylbenzene.

7, sealing:

Muted color natural gum carries out mounting.After natural gum is slightly dry, stick mark writing paper, section preparation just can use.

As Figure 8-9, wherein Fig. 8-A (enlarged view B) is subcutaneous shallow-layer healthy tissues colored graph to experimental result.Figure C, (enlarged view D) represents at subcutaneous shallow-layer, and experimental group applied hemostatic composition after the 7th day, the tissue staining figure that composition and muscle tissue biocompatible tissue dye.Result shows, and the tissue slice at the 7th day is observed hemostatic composition (arrow indication) and started to be absorbed with and enter muscle tissue inside.

Fig. 9 represents that experimental group applied hemostatic composition after the 21st day, composition and muscle tissue biocompatible tissue dye, figure A (enlarged view B) is subcutaneous shallow-layer, figure C (enlarged view D) is subcutaneous deep, arrow indication is composition, and in the 21st day, hemostasia products has entered the degraded of muscle tissue inside.

Result also shows, and after 21 days, compare with the muscle tissue section of Normal group Fig. 8 A (enlarged view B), subcutaneous rat superficial muscular tissue tissue slice map 9A (enlarged view B) does not have notable difference.Illustrate and apply hemostasia products later in the time of 21 days, histocompatibility and the absorptivity of hemostasia products are good.

Above experimental result shows: histocompatibility and the absorbability of the novel hemostasia products of the present invention are good.

Embodiment 11 hemostasia products of the present invention is to the contrast of SD rat femoral wound hemorrhage haemostatic effect with local temperature variation

This case study on implementation provides the case study on implementation that the present invention and the military hemostatic agent of tradition contrast wounded's haemostatic effect and local temperature variation.

Indication of the present invention containing the hemostatic material lyophilized powder proportioning of Transglutaminase EC2.3.2.13 is: Transglutaminase EC2.3.2.13 5400U; Hydroxylation gelatin 25g; Sorbyl alcohol 5g.Preparation method is: claim the 25g hydroxylation gelatin heated and stirred that adds water to make it dissolve completely; Claim 5g sorbyl alcohol, add in above-mentioned solution, stir and make it dissolve completely; Use 0.22 μm of membrane filtration degerming again, be placed to room temperature and inject and be settled to 100ml with water.Sterile filtration adds 5400U Transglutaminase EC2.3.2.13, after mixing, is placed in Freeze Drying Equipment and carries out lyophilize.Shatter powdered after drying terminates, this hemostatic composition packaging is made finished product.

SD rat 21 is selected in experiment, is divided into blank group, zeolite powder control group and experimental group (mTG-gelatin) at random, often organizes 7.The SD rat bought starts to test after experimental animal room adapts to 1 week, sets up rupture of blood vessel trauma model.Breathe narcotic anesthetized rat; Facing upward position is fixed on operating table, and sterilization, makes 3cm stringer otch at right lateral thigh front upper part, fully exposes and the femoral artery that dissociates is about 1.5cm, and femoral vein is about 1.5cm, puts temperature measurer between blood vessel, muscle.Femoral artery, femoral vein is cut off with scalpel, sprinkle hemostatic material (each hemorrhage surface of a wound all uses 25g subject material: negative control starch, positive control zeolite granular, styptic powder of the present invention) to the hemorrhage surface of a wound immediately to stop blooding, after pressing 2min, the haemostatic effect of each treated animal surface of a wound of observed and recorded.Statistical procedures: adopt chi square test to compare the significance of haemostatic effect difference; Significance level a=0.05.

Table 2, rupture to SD rat stock arteriovenous hemorrhage haemostatic effect and local temperature variation

Group	Rat	Hemostasis quantity	Average bleeding stopping period (min)	Hemostatic efficiency	Local temperature
						Negative control	7	0		0％	37℃
Zeolite powder contrasts	7	7	2	100％	60～70℃
						The present invention	7	7	2.5	80％	37～50℃

Compare with negative control group, ^*p<0.01

Experimental result shows: hemostatic agent of the present invention and positive control zeolite powder are sprinkling upon strand arteriovenous fracture bleeding part and after pressing femoral artery surface of a wound 3min, can effectively stop blooding.Negative control starch is sprinkling upon bleeding part and can not effectively stops blooding after pressing femoral artery surface of a wound 3min, and the SD rat of no longer applying other intervening measures treatment is all dead.Positive control zeolite granular makes local temperature raise, but the effect that hemostatic agent of the present invention makes local temperature raise far is weaker than zeolite granular, and local temperature is no more than 50 DEG C.Although experimental result shows that hemostatic agent anthemorrhagic speed of the present invention is a little less than zeolite powder anthemorrhagic speed, but still has potent quick-acting anastalsis, be enough to meet the requirement of war quick-acting haemostatic powder.And hemostatic agent of the present invention makes local temperature rising effect be weaker than zeolite, does not cause local organization thermal damage, and its net effect is better than traditional zeolite class hemostatic agent.

Embodiment 12: the hemostasis of composition of the present invention in rat liver Hemorrhage Model and prevent wound from oozing out experiment

This embodiment gives according to the quick-acting haemostatic powder effect to inside of human body internal organs under product of the present invention (Microbial transglutaminase (mTG)-gelatin composition) sham fight environment.

The SD rat 14 of 300g ± 20g is selected in experiment, is divided into control group and experiment (mTG-gelatin) group at random, often organizes 7.

Microbial transglutaminase specific activity is used to be in the present invention: 1-50U/ milligram

For control group, do not add any hemostasia products (or hemostatic agent, lower with), just in order to observation of nature bleeding stopping period.

Make adult rat be in generalized anesthetic state before starting experiment, at whole duration of test, detect and maintain the vital sign of rat.

For using of experiment and contrast, routine operation opens abdominal cavity, exposes after liver, uses surgical knife to manufacture 1 cm long, 0.5 centimetre of dark sagital incision at liver lobus sinister.After active about 10 seconds of bleeding, before mTG-gelatin solution is used, use the blood of gauze removing accumulation in time.

Experimental solutions is applied to the otch on liver lobus sinister.Use latter about two minutes gel formation and stopped completely being less than in about 2.5 minutes to bleed after using.After 5 minutes, firmly shake tissue and use tweezers to cross wound site to apply pulling force, but the still intact and wound closure of gel.

Use electronic balance weighing and add up the bleeding capacity of rat liver in 2.5 minutes, result as shown in Figure 10, experimental result data shows, composition of the present invention can suppress the amount of bleeding of rat liver 93% 2 points and 30 seconds time, haemostatic effect (* *, P<0.01) can be reached rapidly.

Figure 11 represents hemostatic composition of the present invention and blank group respectively to the hemostasis of rat liver Hemorrhage Model and anti-ly ooze out effect schematic diagram, the wherein liver of the control group that exposes before display process respectively of Figure 11 A and 11C and experimental group, as Figure 11 B and 11D show the liver wound manufacturing control group and experimental group respectively after active situation of bleeding for 10 seconds.Figure 11 E represents that control group applies 2 points of situations of 30 seconds after the present composition, and Figure 11 F represents the situation applying after the present composition 5 minutes, Figure 11 G and the 11H expression binding property of the manual mode inspection present composition.

For control group, haemostatic measures situation lower 2 points is not taked can not naturally to stop blooding for 30 seconds.For experimental group, liver wound add hemostatic composition 2 points can hemostasis rapidly after 30 seconds.As depicted in fig. 1 ie, present composition binding property is very strong, is bonded by wound, stopping of bleeding.After 5 minutes, as shown in Figure 11 G and 11H, detect that composition bond intensity can block wound completely with tweezers, anti-Hemostatic Oral Liquid or other body fluid ooze out, and wound can not be allowed again hemorrhage.And hemostasia products can be mentioned by tweezers together with liver, does not at this moment also bleed, show the extremely strong hemostasis of hemostasia products of the present invention and anti-vibration effect, this rehabilitation for patient is very favourable.If mTG solution is stored at 4 DEG C, namely test after taking out, wound also can stop blooding after 3 minutes after adding composition, is bonded by wound, stopping of bleeding.

Embodiment 13: the absorbing state of composition of the present invention in rat liver Hemorrhage Model

This embodiment gives the situation according to naturally absorbing after hemostasis in product of the present invention (Microbial transglutaminase (mTG)-gelatin composition) Synthetic Theatre of War environment lower body.

The SD rat 14 of 300g ± 20g is selected in experiment, is divided into control group (Johson & Johnson: absorbable hemostatic gelfoam, trade(brand)name Surgiflo ^tM) and experiment (mTG-gelatin) group, often organize 7.

Control group A: control group uses international commodity hemostasia products (Johson & Johnson's product, absorbable hemostatic gelfoam, trade(brand)name Surgiflo ^tM), and observe absorbing state.

Animal state: adult rat is in generalized anesthetic state, at whole duration of test, detects and maintains the vital sign of rat.

Experimental procedure: open rat abdominal cavity with operating scissors, exposes liver, uses scalpel to manufacture 1 cm long, 0.5 centimetre of dark sagital incision at liver lobus sinister, after active about 10 seconds of bleeding, with the blood of gauze removing surface accumulation.

Experimental solutions is applied to the otch on liver lobus sinister, uses about two minutes gel formation, bleeding in about 2.5 minutes stops completely.After 5 minutes, firmly shake is organized and is used tweezers to cross wound site and applies pulling force, and gel is still complete, and wound site remains closed.After realizing hemostasis object, liver wound does not need to sew up, conventional stitching abdominal cavity.Respectively after 5 days, 10 days, 20 days, put to death laboratory animal, observe the absorbing state of liver wound hemostatic composition.

As shown in figure 12, the result of experimental group B shows that applying hemostatic composition of the present invention absorbs after 20 days not yet completely to experimental result, but with wound healing, hemostatic composition is absorbed gradually, and degree of absorption and international commodity hemostasia products group are more or less the same.

Claims

1. a glutamine of microbe transaminase mTG, is characterized in that this mTG there occurs the amino acid mutation in four sites compared with wild-type mTG, i.e. S23A, G73Y, K317Q, K325Q.

2. glutamine transaminage mTG according to claim 1, wherein this enzyme has the protein sequence of the genes encoding as described in SEQIDNO:3; Or, there is the protein sequence as described in SEQIDNO:4.

3. for the gene order of enzyme described in claim 1 or 2 of encoding.

4. the quick-acting haemostatic powder product for war or scene of the accident wound, it is characterized in that, comprise the matrix that with the addition of described glutamine of microbe transaminase mTG, the sequence of wherein said glutamine transaminage has the protein sequence of genes encoding as claimed in claim 3, or has protein sequence as claimed in claim 1 or 2.

5. hemostasia products as claimed in claim 4, it is characterized in that, wherein hemostasia products is selected from hemostatic agent, hemostasis device, first-aid hemostatic bag or common hemostatic article, and described matrix is the absorbable fluid of human body, semisolid, powder or plastic glue or colloid form.

6. hemostasia products as claimed in claim 5, it is characterized in that, the matrix of described fluid or semi-solid form or material comprise liquid fiber albumen sealing material or glue class.

7. hemostasia products as claimed in claim 6, wherein said liquid fiber albumen sealing material or glue class are selected from Keratin sulfate, collagen protein or fluid gelatin.

8. hemostasia products as claimed in claim 6, it is characterized in that, described liquid fiber albumen sealing material or glue class comprise lysate, and described lysate is phosphate buffered saline buffer, and phosphate buffered saline buffer PH scope is from 7.0 to 9.0.

9. hemostasia products as claimed in claim 5, it is characterized in that, described plastic glue or colloid form comprise SURGICEL, oxidized regenerated cellulose, chitosan, Keratin sulfate, collagen protein, gelfoam.

10. the hemostasia products as described in any one of claim 4-6, it is characterized in that, described matrix is selected from absorbable fibre albumin glue, Keratin sulfate, the medical gelatin in collagen protein or various source and liquid fiber albumen sealing material or glue, or is selected from SURGICEL, oxidized regenerated cellulose, chitosan, protein-polysaccharide, glycolic acid polymer, lactic acid polymer.

11. hemostasia products as claimed in claim 10, wherein said protein-polysaccharide is poly-n-acetyl glucosamine amine.

12. hemostasia products as claimed in claim 10, it is characterized in that, described matrix is gelatin.

13. hemostasia products as claimed in claim 12, is characterized in that, described matrix is selected from mammiferous A type high molecular gelatin, or containing 20% ~ 60% proline(Pro) by the gelatin of hydroxylation.

14. hemostasia products as claimed in claim 5, it is characterized in that, the stock material shapes of described hemostasia products is: the gelatin of (i) powder, particle or other solid forms; (ii) the transglutamin-ase 9 transaminase of powder, particle or other solid forms.

15. hemostasia products as claimed in claim 5, it is characterized in that, described hemostasia products is tourniquet or hemostatic gauze, comprise with cotton yarn or the soluble stanching gauze tourniquet that is body or hemostatic gauze outer, with for the internal layer contacted and bind up a wound, containing the matrix powder of described glutamine transaminage or medicine core in wherein said internal layer.

16. hemostasia products as claimed in claim 5, is characterized in that, described hemostasia products is the spraying plant of quick-acting haemostatic powder, comprise the spraying of pressurization or the mixture of foam, gelatin and transglutamin-ase 9 transaminase component.

17. hemostasia products as described in claim 12-14, it is characterized in that, described hemostasia products is containing above-mentioned gelatin and the first-aid hemostatic bag of glutamine transaminage component, the military hemostasia products of first-aid chest.

18. prepare the quick-acting haemostatic powder method for product for war or scene of the accident wound described in any one of claim 4-17, comprise the following steps:

(1) preparation can express the recombinant microorganism of described glutamine of microbe transaminase, and carries out recombinant expressed;

(2) collect also purifying and there is the glutamine transaminage of described activity, and be configured to living solution;

(3) by ordinary method, the living solution of described glutamine transaminage is added in human body Absorbable rod matrix;