CN103805711A - Method for designing endogenous reference gene primer suitable for quantitative detection of transgenic wheat and application of endogenous reference gene primer - Google Patents

Abstract

The invention discloses a method for designing an endogenous reference gene primer suitable for quantitative detection of transgenic wheat and an application of the endogenous reference gene primer. The method comprises the steps of A, screening a gene with good species specificity through an NCBI (national center of biotechnology information) database BlastN, searching designed primers of non-homologous segments, amplifying the segments, and performing Primer-Blast detection on upstream and downstream sequences; B, selecting 16 seeds of different species and 35 different wheat varieties, performing sterilization and germination, and taking leaves to extract DNA (deoxyribonucleic acid); C, performing Southern Blot to identify that the number of PSG719 and UCB gene sites with good candidate specificities is 6 and the copy number is 2; D, performing common PCR (polymerase chain reaction) to identify the species specificity of the endogenous reference gene primer; and E, performing common PCR to identify the stability among the different wheat varieties of the endogenous reference gene primer, and determining two pairs of primers to serve as qualitative or quantitative detection endogenous reference gene primers during detection of the transgenic wheat. The method is feasible and simple and convenient in operation, the limit of qualitative detection is 0.95 wheat genome, the limit of quantitative detection is 5 wheat genomes, and a Real-time PCR detection proves that the linear relation is good.

Description

Be applicable to the internal standard gene primer design and application of transgenic wheat detection by quantitative

The application be for the applying date be 2011-12-21, application number: 201110432297.5, denomination of invention: the divisional application of internal standard gene primer design and application that is applicable to transgenic wheat detection by quantitative.

Technical field

The invention belongs to plant inspection quarantine Triticum crop, food, deep processed product transgenosis detection field, more specifically relating to one utilizes Real-time PCR based on PSG719(Ta PSG719gene, FJ497025.1), UCB(Tu CypB gene, EU868840.1) DNA triticum species specificity section design for wheat transgenic detection by quantitative internal standard gene primer, relate to the method for design of the quantitative internal standard gene primer of a kind of transgenic wheat simultaneously, also relate to the purposes of the quantitative internal standard gene primer of a kind of transgenic wheat.

Background technology

Wheat is as the large crop of the first in the world, and owing to being subject to the restriction of transgenic technology, wheat transgenic research lags behind other crop.In recent years, China has also obtained preliminary progress aspect wheat transgenic, and obtain a collection of transgenic wheat novel material that there is Resistant, degeneration-resistant border and improve quality, part strain entered environment discharges the stage (Yin Jun, present situation and the development trend Chinese agriculture information 2009.13-17 of the wheat transgenic research of Li Yongchun China).And people also start to pay close attention to Food safety and health, on the other side is that the development of existing transgenosis detection technique still moves ahead walking unhurriedly.

For the worry of the unknown potential safety hazard that may exist genetically modified food; also be the protection to human consumer's right to know, the numerous and confused legislation of national governments sets up relevant detection threshold to be beneficial to management (C.A.Carter International Approaches to the Labeling of Genetically Modified Foods Agricultural Issue Center University of California2003) simultaneously.

A: plan 0.9%, lower than 1%; B: do not carry out temporarily

And will carry out quantitatively the shared composition of genetically modified food, an internal standard gene just seems very important:

1. cure and process or deep-processed food wherein may adulterate other additive or other food, therefore, internal standard primer can be identified extracted DNA sample quality;

2. whether normal in order to detect PCR as the negative control arranging;

3. can carry out quantitatively the DNA in total reaction system;

4. owing to thering is species specificity, therefore, can, by the comparing of foreign gene and native gene, realize the object that detects transgene component ratio by absolute relative quantification.

Even can not rant out, a suitable internal standard primer is the genetically modified prerequisite of detection by quantitative and basis.And a suitable internal standard primer should have several features:

1. there is species species specificity;

2., there is not twin genes in stable existence between each kind;

3. in genome, copy number definite and lower.

PSG719: the promotor of wheat PSG719 be one there is pollen and in pollen development mid-term until the promotor of flower pesticide ripening period specifically expressing, it except with wheat or barley in part EST have homology, all do not there is any homology with other species, show that this gene has fabulous species specificity (Ling Chen, Guangyuan He.Isolation and heterologous transformation analysis of a pollen-specific promoter from wheat (Triticum aestivum L.) Mol Biol Rep201037:737 – 744),

New cyclophilin B albumen that is positioned endoplasmic reticulum of UCB:urartu cyclophilin B genes encoding, this albumen may participate in storing protein folding, this gene has 8 location (Huimei Wu in bread wheat, Emma Wensley.Identification and analysis of genes encoding a novel ER-localised Cyclophilin B in wheat potentially involved in storage protein folding, Plant Science2009420 – 432).But this experiment proved that to there is site, 6 location.

Summary of the invention

The internal standard gene primer that has been to provide a kind of transgenic wheat quantitative is provided, there is good Triticum species specificity, stability between excellent kind, the qualitative detection limit is 0.95 wheat cdna group, detection by quantitative is the wheat cdna group of 5 copy numbers, detect by Real-time PCR, linear relationship is good.

Another object of the present invention is the preparation method who has been to provide the quantitative internal standard gene primer of a kind of transgenic wheat, easy to implement the method, easy and simple to handle, by bioinformatics method, screen satisfactoryly there is species specificity, plant between the internal standard gene that has good stability.

A further object of the present invention is to be to provide the application of the quantitative internal standard gene primer of a kind of transgenic wheat in wheat transgenic detection by quantitative, the qualitative detection limit is 0.95 wheat cdna group, detection by quantitative is 5 wheat cdna groups, detect by Real-time PCR, linear relationship is good.

In order to realize above-mentioned object, the present invention adopts following technical measures:

A preparation method for the quantitative internal standard gene primer of transgenic wheat, the steps include:

A, by disparate databases (NCBI, EMBL, DDBJ) screening structure gene, and detect its species specificity by bioinformatics method, design primer, and verify the possible product of its primer in disparate databases;

B, sterilization are sprouted 35 kinds of Wheat Cultivars and 15 different plant species seeds, get blade CTAB method (M.G.Murray, W.F.Thompson.Rapid isolation of high molecular weight plant DNA.Nucleic Acids Research.1980Vol.8No.19) and extract DNA;

Select full clean seed, 70% (V/V) alcohol immersion 30 seconds, then 10%NaClO soaks 10 minutes, 3-5 each 1-3min of aseptic water washing, the seed of sterilization is immersed in sterilized water, 28 ℃, 220r/min is sprouted and is spent the night, and is positioned in sterilizing culture dish on filter paper, to sprout to 2 leaf phases to get young leaflet tablet after showing money or valuables one carries unintentionally;

C, Southern Blot identify PSG719, the number of sites of UCB gene in hexaploid wheat;

D, regular-PCR identify that it,, 15 different plant species DNA cloning situations, detects its species specificity;

E, regular-PCR identify that it,, in 35 different varieties Wheat DNAs amplification situations, identifies stability between its kind.

In two pairs, standard gene primer and information see the following form:

The application of the quantitative internal standard gene primer of transgenic wheat in wheat transgenic detection by quantitative, the steps include:

A, regular-PCR are determined internal standard gene primer limit of detection;

B, Real-time PCR determine its detection by quantitative limit;

C, Real-time PCR determine C _tlinear relationship between value and wheat cdna group number.

The present invention compared with prior art, has the following advantages and effect:

At home 2006 can be for transgenic wheat qualitative detection (Luan Fengxia by the internal standard gene primer based on the molten protein gene of γ-ol (GAG56D) of people's designs such as Luan Fengxia, Zhang Hongxiang, in vain searching and qualitative PCR and real-time fluorescence PCR checking 200,616 6 phases of volume of biotechnology of month endogenous special reference gene of wheat: 50); And abroad, M _aYUi _iDAdeng people, by design, the internal standard primer limit of detection take the Waxy-D1 in wheat D genome as template is 15 genomes, quantitation limit the unknown (M _aYUi _iDA, AKIHIRO HINO Development of Taxon-Specific Sequences of Common Wheat for the Detection of Genetically Modified Wheat.J.Agric.Food Chem.2005,53,6294-6300); The people such as Hernandez 1 genome of internal standard gene primer limit of detection based on ACC-1 gene design, 20 genomes of quantitation limit (M.Hernandez Real-Time Polymerase Chain Reaction Based Assays for Quantitative Detection of Barley, Rice, Sunflower, and Wheat.J.Agric.Food Chem.2005,53,7003-7009); 2006, internal standard gene primer limit of detection and this experiment of the people such as Ronning based on PKABA1 gene design is unanimous on the whole, quantitation limit is 5 genomes, 1.8 genome (S.B.Ronning of limit of detection, A.H.Jensen.Novel Reference Gene, PKABA1, Used in a Duplex Real-Time Polymerase Chain Reaction for Detection and Quantitation of Wheat-and Barley-Derived DNA.J.Agric.Food Chem.2006,54,682-687); The people such as Vautrin 2 genomes of internal standard gene primer limit of detection based on ALMT-1 gene design, 20 genome (S.Vautrin of quantitation limit, D.Zhang.Real-Time Polymerase Chain Reaction Assay for Endogenous Reference Gene for Specific Detection and Quantification of Common Wheat-Derived DNA (Triticum aestivum L.) .Journal of AOAC international2007vol.90, no.3).Two pairs of internal standard primer limit of detection for transgenic wheat detection by quantitative of the present invention are 0.95 wheat cdna group, and the detection by quantitative limit is 5 wheat cdna groups.

Accompanying drawing explanation:

Fig. 1 a is that a kind of BlastN detects PSG gene species specificity schematic diagram.

PSG719 gene Triticum specificity in Gramineae is good, only finds the goal gene PSG719 in Triticum to have high homology;

Fig. 1 b is that a kind of BlastN detects UCB gene species specificity schematic diagram.

UCB gene Triticum specificity in Gramineae is good, only finds the goal gene UCB in Triticum to have high homology;

Fig. 2 a is that a kind of Primer-Blast detects PSGF2/PSGR2 primer specificity schematic diagram.

In ncbi database, detect the possible amplified production of primer in Gramineae by Primer-Blast, only find design primer section product

Fig. 2 b is that a kind of Primer-Blast detects UCBF2/UCBR2 primer specificity schematic diagram.

In ncbi database, detect the possible amplified production of primer in Gramineae by Primer-Blast, only find design primer section product

Fig. 3 a is a kind of PSGF2/PSGR2 of detection primer specificity schematic diagram.

The amplification of PSGF2/PSGR2 in 16 different plant species: 1:DL100Marker; 2:ddH2O; 3:Triticum aestivum: Zheng 9023;

4-12:oryza Sativa: magnificent matter 49, China 560, China 564, Ne-3, Ne-9, Ne-L-11, RHS, ZR64,9311; 13-17:Hordeum vulgare: barley No. 1, barley 6741, barley A438, barley 07A349, barley 32386; 18:Zea mays: Zheng Dan 958; 19:Secale cereale: rye 4; 20:Lycopersicon sculentun: Tomato No.3; 21:Vigna unguiculata: No. 3, Fengcheng; 22:Brassica campestris: rape 3; 23:Brassica rapa: magnificent 5 days good morning; 24:Gossypium spp: Hubei Province is cotton assorted; 25:Giycine max: middle yellow No. 3; 26:Arabidopsis thaliana:; 27:Vigna radiata: No. 1, medium green; 28:Cucumis sativus: magnificent Cucumber No.2; 29:Solanum tuberosum: middle potato 13; 30:Pisum sativum: middle pea 6.Only in Zheng 9023 of Triticum, there is amplified production.

Fig. 3 b is a kind of UCBF2/UCBR2 of detection primer specificity schematic diagram.

The amplification of UCBF2/UCBR2 in 16 different plant species: 1:DL100Marker; 2:ddH2O; 3:Triticum aestivum: Zheng 9023;

4-12:oryza Sativa: magnificent matter 49, China 560, China 564, Ne-3, Ne-9, Ne-L-11, RHS, ZR64,9311; 13-17:Hordeum vulgare: barley No. 1, barley 6741, barley A438, barley 07A349, barley 32386; 18:Zea mays: Zheng Dan 958; 19:Secale cereale: rye 4; 20:Lycopersicon sculentun: Tomato No.3; 21:Vigna unguiculata: No. 3, Fengcheng; 22:Brassica campestris: rape 3; 23:Brassica rapa: magnificent 5 days good morning; 24:Gossypium spp: Hubei Province is cotton assorted; 25:Giycine max: middle yellow No. 3; 26:Arabidopsis thaliana:; 27:Vigna radiata: No. 1, medium green; 28:Cucumis sativus: magnificent Cucumber No.2; 29:Solanum tuberosum: middle potato 13; 30:Pisum sativum: middle pea 6.Only in Zheng 9023 of Triticum, there is amplified production.

Fig. 4 a is stability schematic diagram between a kind of PSGF2/PSGR2 of detection kind.

The amplification of PSGF2/PSGR2 in 35 Wheat Cultivars: 1,20 is DL100Marker; 2 is ddH ₂o; 3-19,21-38 are followed successively by 35 wheat breed: Ponpei, all wheats 19, Henan agriculture 99, Henan wheat 10, Wenmai 6, Zheng wheat 004, littlely lay down 81, Xu wheat 958, Mount Taishan 034682, Lip river wheat 21, Ji 58, section's agriculture 119, new former 958, China spring, short anti-No. 8, ton is anti-58, fortune 4002, cigarette good fortune 188, No. 3, safety, many wheats No. 1, new wheat 19, abundant wheat 936, Ji wheat 776, Zheng 9023, Henan agriculture 49498, Henan agriculture 391, Henan wheat 9676, Henan wheat 7036, Henan wheat 58, all wheats 16, temperature wheat 8, warm wheat 19, Mount Taishan 04533, rich dance 981, short by anti-58

In all wheat breeds, all there is object band

Fig. 4 b is stability schematic diagram between a kind of UCBF2/UCBR2 of detection kind.

The amplification of UCBF2/UCBR2 in 35 Wheat Cultivars: 1,20 is DL100Marker; 2 is ddH2O; 3-19,21-38 are followed successively by 35 wheat breed: Ponpei, all wheats 19, Henan agriculture 99, Henan wheat 10, Wenmai 6, Zheng wheat 004, littlely lay down 81, Xu wheat 958, Mount Taishan 034682, Lip river wheat 21, Ji 58, section's agriculture 119, new former 958, China spring, short anti-No. 8, ton is anti-58, fortune 4002, cigarette good fortune 188, No. 3, safety, many wheats No. 1, new wheat 19, abundant wheat 936, Ji wheat 776, Zheng 9023, Henan agriculture 49498, Henan agriculture 391, Henan wheat 9676, Henan wheat 7036, Henan wheat 58, all wheats 16, temperature wheat 8, warm wheat 19, Mount Taishan 04533, rich dance 981, short by anti-58

In all wheat breeds, all there is object band

Fig. 5 a is that a kind of Southern Blot identifies roughly site schematic diagram of PSG gene.

1-4 represents that ECoR V, Hind III, Nde I, SaC I enzyme cut digestion Yangmai158 genomic dna successively, and PSG719 mostly is No. 2 swimming lanes most nearly 6 bands, and know thus PSG719 by inference has site, 6 location in hexaploid wheat.

Fig. 5 b is that a kind of Southern Blot identifies roughly site schematic diagram of UCB gene.

1-4 represents that ECoR V, Hind III, Nde I, SaC I enzyme cut digestion Yangmai158 genomic dna successively, and UCB has 6 bands at No. 4 swimming lanes, and know thus UCB by inference has site, 6 location in hexaploid wheat.

Fig. 6 a is that a kind of regular-PCR detects PSGF2/PSGR2 limit of detection schematic diagram.

Wherein: 1.DL100Marker; 2.ddH ₂o; 3.82.33ng; 4.16.5ng; 5.8.233ng; 6.1.65ng; 7.823pg; 8.165pg; 9.82.3pg; 10.16.5pg; 11.8.23pg; 12.4.1pg; 13.1.65pg.The conventional PCR limit of detection of PSG719 is 16.5pg or 0.95 genome.

Fig. 6 b is that a kind of regular-PCR detects UCBF2/UCBR2 limit of detection schematic diagram.

Wherein: 1.DL100Marker; 2.ddH ₂o; 3.82.33ng; 4.16.5ng; 5.8.233ng; 6.1.65ng; 7.823pg; 8.165pg; 9.82.3pg; 10.16.5pg; 11.8.23pg; 12.4.1pg; 13.1.65pg.The conventional PCR limit of detection of UCB is 16.5pg or 0.95 genome.

Fig. 7 a is that a kind of Real-time PCR PSGF2/PSGR2 dissolves peak value schematic diagram.

By checking PSGF2/PSGR2Real-time pcr amplification solubility curve, in reaction, only there is a peak value, prove that it is without unexpected product

Fig. 7 b is that a kind of Real-time PCR UCBF2/UCBR2 dissolves peak value schematic diagram.

By checking UCBF2/UCBR2Real-time pcr amplification solubility curve, in reaction, only there is a peak value, prove that it is without unexpected product

Fig. 8 a is a kind of Real-time PCR PSGF2/PSGR2 amplification cycles curve synoptic diagram.

By checking PSGF2/PSGR2Real-time pcr amplification cyclic curve, gradient correlation method, amplification fluorescent semi-invariant is all normal.

Fig. 8 b is a kind of Real-time PCR UCBF2/UCBR2 amplification cycles curve synoptic diagram.

By checking UCBF2/UCBR2Real-time pcr amplification cyclic curve, gradient correlation method, amplification fluorescent semi-invariant is all normal.

Fig. 9 a is a kind of Real-time PCR PSGF2/PSGR2 amplification typical curve schematic diagram.

Utilize Roche480 with the linear relationship between software analysis amplification CT value and PSGF2/PSGR2PCR system initiate dna concentration, result is good.Fig. 9 b is a kind of Real-time PCR UCBF2/UCBR2 amplification typical curve schematic diagram.

Utilize software analysis that Roche480 is with amplification C _tlinear relationship between value and UCBF2/UCBR2PCR system initiate dna concentration, result is good.

Embodiment

Embodiment 1:

The preparation method of the quantitative internal standard gene primer of a kind of transgenic wheat (and stability checking between species specificity, kind), the steps include: A, screen the good gene of species specificity by ncbi database BlastN, search non-homogeneous section design primer, amplification section is as follows, upstream and downstream sequence is carried out to Primer-Blast(http: //www.ncbi.nlm.nih.gov/tools/primer-blast/# simultaneously), parameters is: special species: Poales(Gramineae); Database: nr(Non-Redundant, nonredundancy sequence)

PSG species specificity section: (its sequence is shown in SEQ ID NO:1)

601 CTTT TCCGAA CTTTTCCATC AAGACCTATT AACGTGGGAT CTAGTTATGA AGATCTTGAC

661 GCGAGAAATC CAATGATGAA ACCGGTTAGG AATGCGGACG CACATTTCAA GAGATATATA

721 TTTTTGGAAT AATTGGAACT ACAGAAAAGC AAAGAAAAAA CCATGTTGCG ACAAGTGGTG

781 CACATTGTCA GCGCCTAGGA AGATGGGTGT GACCTTTGT A AGGGCTACCG TCAGTTGATG

841 ATTTTGGAGT ATCCAGCGCG CTGGAAGAAT TCTATTCCGT GCATGGCGCA TAGAATAGTT

Remarks: come from NCBI Datebase, Gene Accession:FJ497025.1

UCB species specificity section: (its sequence is shown in SEQ ID NO:2)

2641 ATACCTCCCG CCTGGTGATT GTTTTTTTAT GAGGACCAAT CTCACAGTAG TTTTATACTT

2701 GAAAATCTTT AAAGAAACAT TTCTGGCTTT ACGCTTTAAA A GGTCTGAAA ACTGTTGGGA

2761 GCACTACCCT ATGACCTTTG TGTCGATGAA GCTCCACCAC TGCCCGGTAG AGGAGAATCT

Remarks: come from NCBI Datebase, Gene Accession:EU868840.1

Utilize Primer5(Primer Co.Ltd.Canada) design meet without mispairing, low hairpin structure, dimer free energy low wait require internal standard gene primer, its relevant information sees the following form:

Internal standard gene primer sequence and relevant information

By above-mentioned primer, can utilize the DNA copy number in absolute quantitation detection system, simultaneously can be by increase with foreign gene simultaneously, utilize absolute relative quantification method to detect external source and insert gene insertion point number and transgene component proportion.

B, experiment material:

16 different plant species seeds: 1: wheat Triticum aestivum: Zheng 9023; 2: paddy rice oryza Sativa: magnificent matter 49, China 560, China 564, Ne-3, Ne-9, Ne-L-11, RHS, ZR64,9311; 3: barley Hordeum vulgare: barley No. 1, barley 6741, barley A438, barley 07A349, barley 32386; 4: corn Zea mays: Zheng Dan 958; 5: rye Secale cereale: rye 4; 6: tomato Lycopersiconsculentun: Tomato No.3; 7: cowpea Vigna unguiculata: No. 3, Fengcheng; 8: rape Brassica campestris: rape 3; 9: Plantula Brassicae chinensis Brassica rapa: magnificent 5 days good morning; 10: cotton Gossypium spp: Hubei Province is cotton assorted; 11: soya bean Giycine max: middle yellow No. 3; 12: Arabidopis thaliana Arabidopsis thaliana:; 13: mung bean Vigna radiata: No. 1, medium green; 14: cucumber Cucumis sativus: magnificent Cucumber No.2; 15: potato Solanum tuberosum: middle potato 13; 16: pea Pisum sativum: middle pea 6

35 Wheat Cultivars: Ponpei, all wheats 19, Henan agriculture 99, Henan wheat 10, Wenmai 6, Zheng wheat 004, littlely lay down 81, Xu wheat 958, Mount Taishan 034682, Lip river wheat 21, Ji 58, section's agriculture 119, new former 958, China spring, short anti-No. 8, ton is anti-58, fortune 4002, cigarette good fortune 188, No. 3, safety, many wheats No. 1, new wheat 19, abundant wheat 936, Ji wheat 776, Zheng 9023, Henan agriculture 49498, Henan agriculture 391, Henan wheat 9676, Henan wheat 7036, Henan wheat 58, all wheats 16, temperature wheat 8, warm wheat 19, Mount Taishan 04533, rich dance 981, short by anti-58.

Different plant species seed sterilization is got blade:

Select full clean seed, 70%(V/V, identical below) alcohol immersion 30 seconds, then 10%NaClO soaks 10 minutes, 3-5 each 1-3min of aseptic water washing, the seed of sterilization is immersed in sterilized water, 28 ℃, 220r/min is sprouted and is spent the night, and is positioned in sterilizing culture dish, on filter paper, to sprout to 2 leaf phases to get young leaflet tablet after showing money or valuables one carries unintentionally.

Extract DNA:

Get young tender wheat blade, adopt improved CTAB method (M.G.Murray, W.F.Thompson.Rapid isolation of high molecular weight plant DNA.Nucleic Acids Research.1980Vol.8No.19) extracting DNA, concrete steps are as follows:

1) get wheat young leaflet tablet 0.1～0.5g and put into the mortar of drying and sterilizing, pour liquid nitrogen into and rapidly blade clayed into power and pack in 2ml centrifuge tube.

2) in the sample of milled, add the CTAB damping fluid of 0.9ml preheating to mix, 65 ℃ of water-baths 1 hour, put upside down during this time and mix 3 times.

3) add the Potassium ethanoate 214 μ l of 5mol/L, chloroform 158 μ l, turn upside down and mix to chloroform layer color burn, place 30min for-20 ℃.

4) the lower centrifugal 15min of 10500r/min of room temperature (20-25 ℃, below identical), draws supernatant liquor 700 μ l and is transferred to new 1.5ml centrifuge tube, adds 560 μ l Virahols, and the sodium-acetate of 70 μ l3mol/L, puts upside down and mix, and room temperature is placed 10min.

5) the centrifugal 15min of 10000r/min, abandons supernatant, air-dry to Virahol volatilization (about 20min) completely.

6) add 70% ethanol of 500 μ l precoolings to embathe precipitation, will precipitate and hang, make it to depart from the pipe end.

7) the centrifugal 5min of 10500r/min, abandons supernatant, seasoning.

8) add 30 μ l TE damping fluids, 0.1～0.2 μ l10mg/ml RNase A, 4 ℃ of dissolvings of spending the night ,-20 ℃ of storages are for subsequent use.

C, Southern Blot identify number of sites:

Southern hybridization probe primer sequence

Carry out the isotopic labeling of probe with the random primer labelling test kit of Takara.

The step of mark is as follows:

1) in 1.5ml centrifuge tube, add 100ng DNA probe, 2 μ l random primers; And moisturizing is to 14 μ l.

2) in boiling water, boil 5min, in ice-water bath, cooling 5min, centrifugal.

3) add 2.5 μ l10 × Buffer, 2.5 μ l dNTP, 5 μ l α-[P ³²]-dCTP.

4) add 1 μ l archaeal dna polymerase.37 ℃ of water-bath 30min.

5) add the 0.5M EDTA of 1.6 μ l, termination reaction.

6) in boiling water, boil 5min, in ice-water bath, cooling 10min, centrifugal.

Enzyme is cut and electrophoresis:

Get approximately 15～20 μ g wheat cdna group DNA, add respectively restriction enzyme ECoR V, Hind III, Nde I, the SaC I of 3U/ μ g, in suitable reaction system, in the incubator of 37 ℃, carry out the digestion of DNA.The enzyme time of cutting is 12h left and right.

1) enzyme is cut after end, gets the twentieth DNA effect that electrophoresis detection enzyme is cut on 0.8% glue, other be placed in 4 ℃.

2) after having detected, passable if enzyme is cut effect, by DNA deactivation 10min in 75 ℃ of water-baths, be then placed in 4 ℃ for subsequent use.

3) electrophoresis is front in 56 ℃ of water-baths, and 2～3min disconnects the fragment of adhesion again.

4) 0.8%(m/V processed) sepharose, glue thickness 10mm, 360ml glue, comb the wide 7mm in hole.Glue checks whether have bubble in hole after getting well.

5) in DNA sample, add 0.1 times of volume 10 × Loading Buffer.After mixing, put in hand-hole slowly, make DNA sink to bottom.

6) the sample introduction 10min under the voltage of 100V of elder generation, then electrophoresis 20h under the voltage of 30V, making bromjophenol blue is 15cm left and right to the distance in point sample hole.

7) electrophoresis finishes the distance between each band of fluorescence scale marking Marker of rear use and point sample hole.

Transferring film:

1) cut the nonuseable part of glue with blade, but will leave the point sample hole of half, be convenient to be indicated on Hybond membrane.

2) cut a little triangle in the lower left corner of glue (end of first sample), for the direction of mark electrophoresis.

3) Marker swimming lane is cut.

4) glue is immersed and filled in the vinyl disc of 0.2M HCl, become yellow to bromjophenol blue, immediately glue is proceeded in distilled water to the about 10min of rinsing repeatedly.

5) glue is soaked to glue 25min in 0.4M NaOH/1M NaCl solution, and shake repeatedly;

6) cut out a surrounding than the Hybond membrane of the large 2mm of glue, and two thick filter paper onesize with film.

7) Hybond membrane cutting out is floated in distilled water, until all soaked from top to bottom, proceeded to alkali and shift in liquid and soak 5min, then cut off a jiao of film with clean scissors, just in time corresponding with the angle cutting out on glue.

8) when DNA denaturation process, in vinyl disc, add the transfer liquid of appropriate amount, and on dish, put the sheet glass of a suitable size.Cut out two larger filter paper bars (as salt bridge), take on sheet glass soaking in the middle of it, two is immersed in shifts in liquid, and filter paper is soaked completely, and possible bubble is rushed with glass stick.

9) the glue point sample hole direction that in the 5th step, sex change is good is placed in to the central authorities of salt bridge downwards, between glue and filter paper, can not has bubble, with plastic sheet by all around the getting up of glue, in order to avoid transfer printing short circuit.

10) the transfer liquid that did not have in right amount glue face is spilt on glue, film is covered slowly on glue, avoid bubble, one side of film should exceed the point sample hole line of glue slightly.After putting well, just can not move again.

11) with shifting wet two the thick filter paper of immersion, then place it on film.Drive bubble out of with glass stick.

12) thieving paper thick 5～8cm (onesize with the trace filter paper of step 6) is placed on trace filter paper, puts a sheet glass above, and put the weight of about 500g.

13) change at any time the thieving paper soaking, note adding transfer liquid, transferase 12 4h simultaneously.

14) after shifting, thieving paper and trace filter paper are thrown off, film is placed on dry filter paper.

15) film is placed on to immersion 10min in neutralization buffer (0.5M Tris-Cl (pH7.2), 1M NaCl).Encase film with two filter paper, at room temperature desciccator diaphragm 30min, is then placed in the loft drier of 80 ℃, dry 1.5h.If Hybond membrane is not directly used in hybridization, available filter paper packet is got up, and in 4 ℃, preserves.

Prehybridization:

1) prepare prehybridization solution according to table 3.2.

2) make film soak fully about 2min film immersion 6 × SSC or 6 × SSPE.

3) Salmon Sperm DNA is boiled to 8min in boiling water.In ice-water bath fully cooling (10min).Add in the hybridization solution of 65 ℃ of preheatings.

4) the soft Hybond membrane by soaking is rolled into cylindrically, puts into hybrid pipe, adds the prehybridization solution of 65 ℃ of preheatings, and rotation hybrid pipe, removes bubble, tightens hybrid pipe.

5) hybrid pipe is put into the hybrid heater of 65 ℃, prehybridization 15h left and right.

(in advance) hybridization solution composition (10ml)

Hybridization:

1) add 300 μ l hybridization solutions in the good probe liquid of mark, 100 ℃ are boiled 5min, are placed in ice-water bath cooling, centrifugal.

2) outwell prehybridization solution, the hybridization solution of 65 ℃ of preheatings is added in hybrid pipe, then the probe of sex change is added in hybrid pipe, hybridization 36h left and right.

Wash film:

1) Hybond membrane is taken out from hybrid pipe, hybridization solution is poured in radioactive liquid waste bucket.

2) film is put into and filled the 1x SSC of 300ml and the vinyl disc of 0.5%SDS film washing liquid, under room temperature, shake 10min.

3) primary film washing liquid is poured in radioactive liquid waste bucket, added 1x SSC and the 0.1%SDS film washing liquid of 300ml, 45 ℃, shake 2min.

Radioautograph:

1) film is taken out from film washing liquid, be placed on clean filter paper, remove most liquid.

2) then encase with preservative film, be placed in exposure holder, phosphorus screen is pressed.Compressing tablet 15h left and right.

3) phosphorus screen is taken out, on the phosphorus screen imager of company of Fuji, take a picture.

The recycling of Hybond membrane:

1) 0.1%SDS is boiled.

2) be poured in the plastics casing that is placed with film, repeatedly shake 15min.

3) with 2 × SSC rinsing.

PSG719 mostly is No. 2 swimming lanes most nearly 6 bands, and UCB has 6 bands at No. 4 swimming lanes.Know thus PSG719, UCB by inference and in hexaploid wheat, have site, 6 location, 2 copies.

D, species specificity detect:

PCR reaction system:

10X EasyTaq Buffer(Transgene Co.Ltd,China),

2U EasyTaq Polymerase,

120μM dNTPs,

1 μ L template DNA (different plant species blade extracts DNA, about 100ng/ μ L)

200 μ M upstream and downstream primers,

DdH ₂o complements to 25 μ L;

PCR reaction conditions

（ABI2720ThermoCycler,Applied Biosystem Co.Ltd,USA）

Denaturation: 95 ℃ of 5min;

Amplification: 94 ℃ of 40s,

Ta40s,

72℃20s40Cycle;

Extend again: 72 ℃ of 10min;

Insulation: 10 ℃ of 10min

Detection of Stability between E, Wheat Cultivars:

PCR reaction system:

10X EasyTaq Buffer(Transgene Co.Ltd,China),

2U EasyTaq Polymerase,

120μM dNTPs,

1 μ L template DNA (different varieties wheat leaf blade extracts DNA, about 100ng/ μ L)

200 μ M upstream and downstream primers,

DdH ₂o complements to 25 μ L;

PCR reaction conditions

（ABI2720ThermoCycler,Applied Biosystem Co.Ltd,USA）

Denaturation: 95 ℃ of 5min;

Amplification: 94 ℃ of 40s,

Ta40s,

72℃20s40Cycle;

Extend again: 72 ℃ of 10min;

Insulation: 10 ℃ of 10min

Can determine that by above experiment two pairs of candidate's primers all have good species specificity, stability between excellent kind.Standard gene primer in two couple of qualitative or detection by quantitative while being applicable to doing transgenic wheat detection.

In two pairs, standard gene primer and information see the following form:

Embodiment 2:

The application of the quantitative internal standard gene primer of transgenic wheat in wheat transgenic detection by quantitative, the steps include:

A, regular-PCR are determined limit of detection:

PCR reaction system:

10X EasyTaq Buffer(Transgene Co.Ltd,China),

2U EasyTaq Polymerase,

120μM dNTPs,

(wheat extracts DNA to 1 μ L template DNA, and NanoDrop measures concentration, and gradient dilution, and concentration is followed successively by: 1.82.33ng; 2.16.5ng; 3.8.233ng; 4.1.65ng; 5.823pg; 6.165pg; 7.82.3pg; 8.16.5pg; 9.8.23pg; 10.4.1pg; 11.1.65pg)

200 μ M upstream and downstream primers,

DdH ₂o complements to 25 μ L;

PCR reaction conditions:

（ABI2720ThermoCycler,Applied Biosystem Co.Ltd,USA）

Denaturation: 95 ℃ of 5min;

Amplification: 94 ℃ of 15s,

Ta20s,

72℃20s40Cycle;

Extend again: 72 ℃ of 10min;

Insulation: 10 ℃ of 10min

As shown in Figure 6, the limit of detection of UCB in wheat is 16.5pg or 0.95 genome.

B, quantitative PCR are determined the detection by quantitative limit

Real-time PCR system

2X SsoFast Eva SYBR GreenI mixture（Bio-Rad Co.Ltd,USA）,

125 μ M upstream and downstream primers,

1 μ L DNA profiling (gradient dilution),

DdH ₂o complements to 20 μ L;

Real-time PCR condition

（Roche LightCycler480III,Roche Co.Ltd,Switzerland）

Pre-Denaturation：98℃2min；

Quantitative：98℃5s，

Ta20s，

72℃20s(single)45Cycele；

Melting Curve：95℃10s，

65℃1min，

95℃(continuous)；

Cooling：40℃2min

The detection by quantitative limit, template stepwise dilution in PCR system, concentration and calculation result see the following form

The PSG719 detection by quantitative limit:

The UCB detection by quantitative limit:

C, Real-time PCR detect C _tlinear dependence between value and DNA initial concentration

In order to identify that internal standard gene primer is at detection by quantitative linear dependence, template in each PCR system

Real-time PCR system

2X SsoFast Eva SYBR GreenI mixture（Bio-Rad Co.Ltd,USA）,

125 μ M forwards/reverse primers,

1 μ L DNA profiling (gradient dilution, genome number of copies is followed successively by: 9990,4995,2497.5,1248.8,624.4,312.2,78.0,39.0),

DdH ₂o complements to 20 μ L;

Real-time PCR condition

（Roche LightCycler480III,Roche Co.Ltd,Switzerland）

Pre-Denaturation：98℃2min；

Quantitative：98℃5s，

Ta20s，

72℃20s(single)45Cycele；

Melting Curve：95℃10s，

65℃1min，

95℃(continuous)；

Cooling：40℃2min

Real-time PCR condition

Real-time PCR（LightCycler480III,Roche Co.Ltd.Switzerland）

Pre-Denaturation:98℃2min;

Amplification,Quantitative:98℃5S,62℃20S,72℃20S(Single)45Cycle

As shown in Fig. 7,8,9, dissolve peak value, amplification curve, typical curve all fine, linear dependence is fine.

$\frac{{(1+E_F)}^{-{C_T}_F}}{{(1+E_R)}^{{{-C}_T}_R}}=n...\left(1\right)$

$n=2^{-\mathrm{\Δ}{C}_T}...\left(2\right)$

n/N＝Transgenic%…………………………………(3)

$C_T=-3.206*{\log }_{(1+E_R)}N+35.21...(4-1)$

$C_T=-3.022*{\log }_{(1+E_R)}N+38.40...(4-2)$

E _f, E _f=foreign gene, internal standard gene amplification efficiency; C _tF, C _tR=foreign gene, internal standard gene amplification cycles threshold value; N=foreign gene insertion point number and internal standard assignment of genes gene mapping number of sites ratio, foreign gene insertion point number and the internal standard gene position ratio of counting in N=haploid genome, in the time that sample is 100% transgenosis, n=N.

By utilizing formula (1), 100% transgenic line can detect foreign gene insertion point number, works as E _f=E _f=1 o'clock, can calculate and learn fast by formula (2);

Formula (4) can detection by quantitative wheat cdna group copy number;

In the time that known a kind of transgenic wheat external source insertion point is counted, utilize formula (3) to calculate transgene component percentage.

Sequence table

<110> Organization Name: Hua Zhong Agriculture University

<120> Title: the internal standard gene primer design and application that is applicable to transgenic wheat detection by quantitative

<130> AppFile Reference: the internal standard gene primer design and application that is applicable to transgenic wheat detection by quantitative

<140> Current App Number :

<141> Current Filing Date : ____-__-__

Sequence

<213> Organism Name : Triticum aestivum

<400> PreSequence String :

601 CTTTTCCGAA CTTTTCCATC AAGACCTATT AACGTGGGAT CTAGTTATGA AGATCTTGAC

661 GCGAGAAATC CAATGATGAA ACCGGTTAGG AATGCGGACG CACATTTCAA GAGATATATA

721 TTTTTGGAAT AATTGGAACT ACAGAAAAGC AAAGAAAAAA CCATGTTGCG ACAAGTGGTG

781 CACATTGTCA GCGCCTAGGA AGATGGGTGT GACCTTTGTA AGGGCTACCG TCAGTTGATG

841 ATTTTGGAGT ATCCAGCGCG CTGGAAGAAT TCTATTCCGT GCATGGCGCA TAGAATAGTT

<212> Type : DNA

<211> Length : 300

Sequence Name: PSG719 species specificity section

<221> Feature Key : PSGF2

<222> Location From : 605

<222> Location To : 627

Other Information : TCCGAACTTTTCCATCAAGACCT

<221> Feature Key : PSGR2

<222> Location From : 842

<222> Location To : 820

Other Information : ATCATCAACTGACGGTAGCCCTT

<213> Organism Name : Triticum aestivum

<400> PreSequence String :

2641 ATACCTCCCG CCTGGTGATT GTTTTTTTAT GAGGACCAAT CTCACAGTAG TTTTATACTT

2701 GAAAATCTTT AAAGAAACAT TTCTGGCTTT ACGCTTTAAA AGGTCTGAAA ACTGTTGGGA

2761 GCACTACCCT ATGACCTTTG TGTCGATGAA GCTCCACCAC TGCCCGGTAG AGGAGAATCT

<212> Type : DNA

<211> Length : 180

Sequence Name: UCB species specificity section

<221> Feature Key : UCBF2

<222> Location From :2641

<222> Location To : 2663

Other Information : ATACCTCCCGCCTGGTGATTGTT

<221> Feature Key : UCBR2

<222> Location From : 2766

<222> Location To : 2742

Other Information : TAGTGCTCCCAACAGTTTTCAGACC

Claims (1)

1. the quantitative internal standard gene primer of transgenic wheat, its sequence is: For:ATACCTCCCGCCTGGTGATTGTT; Rev:TAGTGCTCCCAACAGTTTTCAGACC.

Images