CN103789442B - A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit - Google Patents

A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit Download PDF

Info

Publication number
CN103789442B
CN103789442B CN201410061800.4A CN201410061800A CN103789442B CN 103789442 B CN103789442 B CN 103789442B CN 201410061800 A CN201410061800 A CN 201410061800A CN 103789442 B CN103789442 B CN 103789442B
Authority
CN
China
Prior art keywords
primer
rickettsiae
pcr
nest
fret
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410061800.4A
Other languages
Chinese (zh)
Other versions
CN103789442A (en
Inventor
王成明
张继垒
陆光武
张毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN201410061800.4A priority Critical patent/CN103789442B/en
Publication of CN103789442A publication Critical patent/CN103789442A/en
Application granted granted Critical
Publication of CN103789442B publication Critical patent/CN103789442B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

FRET-PCR and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit in real time to the present invention relates to one.Described primer, probe are as shown in sequence 1-8.The present invention designs primer and the probe of FRET-PCR, the nucleic acid of all Rickettsiae kinds that can increase specifically, thus judges positive fast; Then select 2 pairs of primers of other conservative block design nest-type PRCs of homologous genes, and determined the Rickettsiae kind of corresponding positive by nest-type PRC, agarose gel electrophoresis and order-checking.Therefore, the Rickettsiae all kinds being detected that this system can not only be quick, special, and its kind can be determined.

Description

A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit
Technical field
The present invention establish a set of based on citric acid synthesized enzyme gene, can detect all rickettsial kinds and the system of somatotype.The mode that native system is combined by real-time FRET-PCR and nest-type PRC and reach the object of rapid detection and all Rickettsiae kinds of somatotype.
Background technology
Rickettsiae is a kind of bacterium, but the simultaneously virulent feature of tool, is that strict cytozoicus is biological, colonizes in various HAEMATOPHAGOUS ARTHROPODS and insect body.Humans and animals is bitten or contacts its ight soil by infected rickettsial insect vector and infects, and human and animal can be caused to generate heat, have a headache and the clinical symptom such as fash.This disease mostly occurs in the torrid zone and subtropical countries and area, and current rickettsial infection becomes worldwide problem.The transmissible disease caused by rickettsial infection such as epidemic typhus, endemic typhus is classified as Category B notifiable disease by current China.There is the disease that more than 10 kinds rickettsial infections cause in China, as epidemic typhus, endemic typhus, tsutsugamushi fever, North asia tick borne spotted fever, Heilungkiang tick borne spotted fever, Inner Mongol tick borne spotted fever, Q heat, person monocytic cell's Ehrlichia is sick, Human Granulocytic Ehrlichia is sick and bartonellosis etc.The strict cytozoicus of Rickettsiae determines qualification rickettsial infection and is different from traditional bacteriodiagnosis, is separated and cultivates as being not easy to.Rickettsiae worldwide recall rate not high and in positive Rickettsiae nucleic acid content relatively low, need a kind of efficient and highly sensitive detection method badly.
1. separation and Culture.For bacterial infection, in morbidity body, be separated and cultivate pathogenic agent is the common method measuring its kind.Rickettsiae be a class between bacterium and virus, closer to the prokaryotic organism of bacterium.The rickettsial common method of current separation and Culture has: (1) cell cultures.Be the most popular method of current clinical samples initial gross separation Rickettsiae, the most frequently used clone has L929 and vero cell.(2) animal inoculation pvaccination method.For just generation is separated, common experimental animal has small white mouse, cavy, big white mouse, suslik etc.(3) chick embryo yolk sac culture method.As the householder method that animal is cultivated, cultivate failed low virulent strain and avirulent strain cultivation for animal, also can be used for pathogenic agent inoculation of going down to posterity in animal body, it can direct isolated pathogen from Field samples.Due to the cytozoicus that Rickettsiae is strict, human or animal's microbemia time of simultaneously infecting is shorter and pathogenic bacteria content is very low, makes rickettsial separation and Culture comparatively difficult.
2. serology.The detection of Rickettsiae specific antibody is one of Main Diagnosis technology of WHO recommendation, but serum antibody generally can detect in morbidity for 5 to 10 days, mainly IgM type antibody.Single sera specific antibody can be clarified a diagnosis apparently higher than local normal population serum titer or paired sera generation serological conversion (serum antibody 4 times rising).Usually experimentally object, experiment condition carry out serological method.General international standard is that indirect immunofluorescence (IFA) detects serum antibody.(1) indirect immunofluorescence (IFA).Main employing Rickettsiae specific antigen detects and infects human or animal's serum antibody, and same antigen slide can detect multiple Rickettsiae simultaneously.(2) complement fixation test (CFT) (CF).Be a kind of have complement participate in and the immunologic detection method being index system with sheep red blood cell (SRBC) and hemolysin.(3) enzyme linked immunosorbent assay (ELISA).Envelope antigen is generally recombinant antigen, can be used for acute case diagnosis and epidemiology survey.Due to the more difficult separation and Culture of Rickettsiae, antigen in test kit is made to purify not enough and make often to occur false positive or cross infection in result.
3. immunohistochemical methods.Immunohistochemical methods fluoroscopic examination Rickettsiae can diagnose the infection of disease human or animal before seroconversion.Flesh tissue, formalin are fixed or paraffin-embedded sample all can be used for immunodetection, the Rickettsiae observing cell peripheral infection under simple microscope has higher susceptibility and specificity, is not especially having the laboratory of fluorescent microscope convenient.But this method is highly professional, and complex operation.
4. molecular biology.Pathogen separation has been replaced at present as direct diagnosis basis for the Protocols in Molecular Biology of Main Means using pcr amplification and order-checking.Round pcr comprises Standard PCR, nest-type PRC and real-time fluorescence quantitative PCR (real-timequantitative PCR).(1) Standard PCR.Usually select genus, group or plant specific gene and increase.As Dermacentroxenus 16SrRNA, typhus fever and Rickettsia spoted fever group 17KD, gltA and outer membrane protein ompB etc.(2) nest-type PRC.As 17KD, gltA, ompB, 56KD nest-type PRC is used to detect typhus fever group and Rickettsia spoted fever group, rickettsia akamushi respectively.(3) real-time fluorescence quantitative PCR.This detects quick, accurate, special, the sensitiveest nucleic acid detection technique of pathogenic agent at present.As established the fluorescence quantitative PCR detection technique of typhus fever and Rickettsia spoted fever group according to gltA gene order design primer and probe.But current molecular diagnosis method is ripe not enough.Part can contain all Rickettsiae kinds by the detection method of normal PCR and agarose gel electrophoresis, but complex operation, be not suitable for the detection of great amount of samples.Existing quantitative PCR only can detect rickettsial Some Species, and can not distinguish the Rickettsiae not of the same race having Difference in Pathogenicity.
Summary of the invention
1. the technical problem that will solve
Current rickettsial detection method is as follows: the 1) separation of pathogenic bacteria and cultivation.Obtain Rickettsiae by being separated in infection human or animal body, then inoculating cell etc. are also cultivated and are judged.But make the separation of Rickettsiae cause of disease bacterium due to rickettsial strict born of the same parents' endoparasitism and cultivate comparatively difficulty.2) Serologic detection.By the theory of antigen and antibodies, judged by the serum antibody of the Detection of antigen human or animal of bag quilt.But due to the cross infection that antigen in test kit is purified not or occurred in testing process, make result often occur false positive.3) molecular Biological Detection.Detect in sample mainly through PCR method and judge with or without Rickettsiae nucleic acid.Rickettsiae has 3 genus, 12 kinds, and the rickettsial pathogenic and metainfective prognosis not belonging to together and plant is obviously different.Therefore, we need badly and set up one and detect quickly and accurately and distinguish the rickettsial method of all kinds.
2. technical scheme
Principle of the present invention and most crucial thinking are the method systems of a kind of High sensitivity of invention, special, rapid detection and all Rickettsiae kinds of somatotype.Guarantee that this system does not increase other non-rickettsial microorganism, other especially close with it pathogenic agent, as Eric's body, coxiella burnetii and incorporeity etc. simultaneously.The present invention selects citric acid synthesized enzyme gene as target gene, and selects relatively conservative zone design primer and probe.Overall thinking is: the primer and the probe that design FRET-PCR dexterously, the nucleic acid of all Rickettsiae kinds that can increase specifically, thus judges positive fast; Then select 2 pairs of primers of other conservative block design nest-type PRCs of homologous genes, and determined the Rickettsiae kind of corresponding positive by nest-type PRC, agarose gel electrophoresis and order-checking.Therefore, the Rickettsiae all kinds being detected that this system can not only be quick, special, and its kind can be determined.
（1） FRET-PCR。First obtain the gltA gene order of all Rickettsiae kinds from NCBI, and select relatively conservative block design primer (FRET-upstream primer and FRET-downstream primer) and probe (FRET-6-FAM probe and FRET-LCRed640 probe).Then sample to be carried out in real time, quantitatively and rapid detection with this primer and probe.For the sample containing Rickettsiae nucleic acid, in FRET-PCR result, its fluorescence curve can occur at 640nm place or strengthen, and in its high resolving power melting curve, its melting summit appears at different temperature places simultaneously.Therefore, can according to the Rickettsiae melting peak temperature differentiation cat Rickettsiae and other kind.(2) nest-type PRC.Based on the inside and outside 2 pairs of primers of gltA gene design (N-upstream primer-1 and N-downstream primer-1, N-upstream primer-2 and N-downstream primer-2), then do nest-type PRC with the sample of the real-time FRET-PCR test positive of this primer pair.First by external primers amplification object fragment, then by the PCR primer of internal primer amplification external primers.Final PCR primer is carried out gene sequencing, finally the standard nucleic acid sequence of sequencing result and each Rickettsiae kind is compared, thus determine its rickettsial kind.
From GenBank(www.ncbi.nlm.nih.gov) obtain the sequence of the citric acid synthesized enzyme gene of following Rickettsiae kind after, by the method for Clustal Multiple Alignment Algorithm, all sequences is compared: Rickettsiaafricae U59733, R.akari U59717, R.australis U59718, R.canadensis U59713, R.conoriiU59730, R.felis JQ674484, R.helvetica U59723, R.honei AF018074, R.japonica U59724, R.massiliae U59719, R.mongolotimonae U59731, R.montana U74756, R.pakeri U59732, R.rhipicephali U59721, R.rickettsii U59734, R.solvaca U59725, R.thphi U59714, R.hoogstraalii FJ767737, R.japonica AY743327, R.prowazekii U59715.Accordingly, the primer of the present invention's design and probe be (Fig. 1-8): specifically sequence is as follows
(1) quantitative FRET-PCR primer and probe
FRET-upstream primer: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 ' (SEQ ID NO.1)
FRET-downstream primer: 5 '-ATCCAGCCTACGGTTCTTGCT-3 ' (SEQ ID NO.2)
6-FAM probe: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 ' (SEQ ID NO.3)
LCRed640 probe: 5 '-LCRed-640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 ' (SEQID NO.4)
(2) nest-type PRC
N-upstream primer-1:5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 ' (SEQ ID NO.5)
N-downstream primer-1:5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 ' (SEQ ID NO.6)
N-upstream primer-2:5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 ' (SEQ ID NO.7)
N-downstream primer-2:5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 ' (SEQ ID NO.8)
Present invention also offers and detect and the rickettsial test kit of somatotype for real-time FRET-PCR and nest-type PRC, comprising:
(1) real-time fluorescence quantitative PCR reagent
The amplification system of 20 μ l comprises: the sample DNA templates of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μM of FRET-upstream primer, 1 μM of FRET-downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP.
(2) nest-type PRC reagent
Nest-type PRC-outside:
The amplification system of 20 μ l comprises: commercialization Taq enzyme, 200 μMs of dNTP of the sample DNA templates of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μM of N-upstream primer-1,1 μM of N-downstream primer-1,2 units;
Nest-type PRC-inside:
The amplification system of 20 μ l comprises: commercialization Taq enzyme, 200 μMs of dNTP of 10 μ l nest-type PRC external primers products, 1xPCR damping fluid, 1 μM of N-upstream primer-2,1 μM of N-downstream primer-2,2 units.
Citrate synthase-PCR is specific to be determined.Specificity of the present invention is guaranteed from four aspects:
1) primer designed and probe, through the blast search of GenBank, confirm that the primer of the present invention's design can increase all Rickettsiaes specifically, and the nucleic acid of especially close with it kind pathogenic agent of other non-Rickettsiae that do not increase.Confirmed by BLAST, the primer of FRET-PCR probe and primer and nest-type PRC can increase and detect the nucleic acid of all Rickettsiae kinds specifically;
2) the present invention detects cat Rickettsiae and typhoid fever Rickettsiae standard substance, Ehrlichia positive and incorporeity positive.Result shows, present system can increase cat Rickettsiae and the rickettsial nucleic acid of typhoid fever, and the nucleic acid of do not increase Ehrlichia and incorporeity positive;
3) observe the change of above amplification object fluorescence intensity (640nm) in PCR process, and pcr amplification product is in the size of the band of agarose gel electrophoresis.Fluorescence occurs at 640nm wavelength or strengthens, and display is positive; In agarose gel electrophoresis, RT-PCR shows the stripe size of 167 base pairs (bp) and the outside 444bp and inner 352bp of nest-type PRC;
4) check order to the PCR primer of amplification, the result of order-checking and the standard sequence of GenBank are compared, thus judge its rickettsial kind.
The determination of citrate synthase-PCR sensitivity: the sequence of being synthesized cat Rickettsiae in Rickettsiae and typhoid fever Rickettsiae citric acid synthesized enzyme gene by IDT.According to molecular weight and the absolute weight of synthetics, calculate the absolute number of the gene copy contained by synthetics.Subsequently, synthetics is diluted, prepare the gene of dilution reagent containing 10,000 copy, 1,000 copy, 100 copies, 10 copies, 1 copy of every 10 μ l syntheticss.With present system amplification containing the diluent of different genes concentration, determine that the present invention detects the sensitivity of this gene.Result shows, and this invention can increase single object citric acid synthesized enzyme gene copied in reactive system.
3. beneficial effect
1) the present invention can detect all Rickettsiaes specifically.So far, Rickettsiae can be divided into Rickettsia spoted fever group, typhoid fever group and rickettsia akamushi 3 genus, totally 12 kinds, as R.rickettsia, R.akari, R.conorii, R.sibirica, R.australis, R.felis, R.japonica, R.africae, R.hoogstraalii, R.prowazekii, R.typhi etc.Therefore, it is possible to detect that rickettsial all kinds are very important, especially for the kind that homology difference is larger simultaneously.Meanwhile, detect that all kinds can find new rickettsial kind or strain more easily, and upgrade rickettsial classification timely, thus be familiar with this pathogenic agent better.
2) the present invention can carry out somatotype to Rickettsiae not of the same race.Different Rickettsiae kinds can cause different epidemic diseases, if Rickettsia prowazekii (Rickettsia prowazekii) is epidemic typhus and typhic pathogenic agent, Mohs Rickettsiae (Rickettsia mooseri) is the pathogenic agent of endemic typhus (also claiming tarbadillo), Li Kecishi Rickettsiae (Rickettsia rickettsii) causes the typhic pathogenic agent of Rocky Mountains, and rickettsia akamushi (Rickettsia tsutsugamushi) is the pathogenic agent of tsutsugamushi fever (scrub typhus).Therefore, determine the rickettsial kind of positive sample thus take corresponding treatment and measure of control according to the pathogenic agent feature of correspondence, corresponding prophylactico-therapeutic measures can be taked according to the contagium of different infectious diseases and route of transmission simultaneously, thus the better rickettsial infection of prevention and corntrol.
3) simple operation of the present invention, is suitable for detecting great amount of samples.Due to the cytozoicus that Rickettsiae is strict, and it is relatively low to infect rickettsial human or animal (as blood) rickettsial bacteria content in microbemia and later stage body thereof, this just needs to be tested and appraised more sample or extremely sensitive detection method to make a definite diagnosis infection.In actual applications, as epidemiology survey or detect a large amount of submitted sample, in conjunction with methods such as agarose gel electrophoresis, great workload is needed for regular-PCR.And the present invention first can filter out positive sample from great amount of samples, and then determine its rickettsial kind by nest-type PRC, agarose gel electrophoresis and order-checking.
Rickettsiae is a kind of bacterium, but its strict cytozoicus, the feature such as specific clinical manifestation and shorter microbemia time that lacks determine Rickettsiae detect be different from traditional bacteriological detection.Due to detection time and sample quantitative limitation, polymerase chain reaction (PCR) detects becomes main detection means and method, especially quantitatively FRET-PCR and nest-type PRC.
4) the present invention combines the advantage of quantitative PCR and nest-type PRC, and has abandoned their shortcoming.The present invention can detect all Rickettsiaes special, sensitive and fast and determine the rickettsial kind of relevant positive, and the detection and control for rickettsial infection is provided strong technical support by this.
Accompanying drawing explanation
Fig. 1. the upstream primer of quantitative FRET-PCR of the present invention.FRET-upstream primer sequence: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 ' (27bp), wherein have one to annex base R.This annexs base R and can to increase A and G base simultaneously, so R.hoogstraalii has a base mismatch, and the Rickettsiae of other kinds and this primer fit like a glove.
Fig. 2. the downstream primer of quantitative FRET-PCR of the present invention.FRET-downstream primer sequence: 5 '-ATCCAGCCTACGGTTCTTGCT-3 ' (21bp), this sequence is the nucleotide sequence obtaining sequence Symmetric Chain in figure.In rickettsial all kinds, R.prowazekii and R.typhi has 1 mispairing, and R.helvetica has 2 mispairing.
Fig. 3. the 6-FAM probe of quantitative FRET-PCR of the present invention.6-FAM probe sequence is: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 ' (21bp), is marked with fluorescence excitation group at its 3 ' end.This probe has 1 mispairing at R.canadensis and R.slovaca, has 2 mispairing at R.prowazekii and R.typhi, and fits like a glove with the Rickettsiae of other kinds.
Fig. 4. the LCRed640 probe of quantitative FRET-PCR of the present invention.The nucleotide sequence of LCRed640 probe in FRET-PCR: 5 '-LCRed-640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 ' (31bp), its 5 ' end mark 640 fluorescence accepts group, and 3 ' end labeled phosphorus acid groups stops it to continue to extend in PCR reaction system downwards.This section of primer sequence is identical with the Rickettsiae citric acid synthesized enzyme gene of all kinds.
Fig. 5. the N-upstream primer-1 of nest-type PRC of the present invention.The nucleotides sequence of nest-type PRC external primers N-upstream primer-1 is classified as: 5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 ' (32bp), and annexs base K containing one in primer.Annex base K can to increase bases G and T simultaneously, make primer can contain more Rickettsiae kind.Primer has 2 base mismatch in R.canadensis, and fits like a glove with the rickettsial nucleotide sequence of other kinds.
Fig. 6. the N-downstream primer-1 of nest-type PRC of the present invention.The nucleotides sequence of nest-type PRC peripheral primer N-downstream primer-1 is classified as: 5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 ' (31bp), and this primer sequence is the Symmetric Chain sequence obtaining nucleotide chain in figure.This primer is the downstream primer of nested PCR amplification exterior portion, and it has 1 base mismatch in R.prowazekii, and all identical with the sequence of other Rickettsiae kinds corresponding gltA gene nucleotide.
Fig. 7. the N-upstream primer-2 of nest-type PRC of the present invention.The nucleotides sequence of this nest-type PRC inner upstream primer N-upstream primer-2 is classified as: 5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 ', long 26 Nucleotide.This primer has 1 base mismatch respectively in R.felis and R.canadensis, has 2 base mismatch in R.hoogstraalii.
Fig. 8. the N-downstream primer-2 of nest-type PRC of the present invention.The nucleotides sequence of this nest-type PRC internal primer N-downstream primer-2 is classified as: 5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 ', and its long 27 bases, annex base Y containing one simultaneously.This annexs base Y and can to increase base C and T simultaneously.This primer is downstream primer, and its sequence is the nucleotide sequence of the Symmetric Chain of figure nucleotide chain.Except merger base position, this primer and R.hoogstraalii have 1 base mismatch.
Fig. 9. the melting curve of Rickettsiae in the present invention.After the present invention terminates, for Rickettsiae not of the same race, the temperature melting peak in its melting curve can be different.As schemed to represent the melting peak in cat Rickettsiae, negative control and other kind of rickettsial melting curve.Rickettsial kind can be tentatively judged by the difference melting peak temperature.As shown in the figure, it is 61.9 DEG C that cat Rickettsiae dissolves peak temperature, and the Rickettsiae of other kind dissolving peak temperature is 57.9 DEG C.
Figure 10. ompB-F and ompB-R primer in embodiment 1.Article " Molecular evidence of Rickettsia felisinfection in dogs from northern territory, Australia " (Hii SF et al., ParasitVectors.2011; OmpB-F and ompB-R primer 4:198).The primer of this article can only detect the rickettsial nucleic acid of cat, and can not contain other kinds of Rickettsiae.
Figure 11. primer CS-78, CS-323, CS-239 and CS-1069 and primer CS-5 and CS-6 in embodiment 1.(1) article " A novel Rickettsia infecting Amblyomma dubitatum ticks in Brazil " (Almeida APet al., Ticks Tick Borne Dis.2011; 2 (4): 209-212) primer CS-78, CS-323, CS-239 and CS-1069 in.This cover primer needs and agarose gel electrophoresis combines, workload when this can strengthen detection, great amount of samples especially.
(2) article " Rickettsia Species Infecting Amblyomma cooperi Ticks from an Area in theState of Sa ~ o Paulo; Brazil; Where Brazilian Spotted Fever Is Endemic " (LabrunaMB et al., J Clin Microbiol.2004; 42 (1): 90-98.) primer CS-5 and CS-6 in.Primer in this article and probe just detect the existence of Rickettsiae in tick, not by the detection of more animal species samples.
Figure 12: the quantitative FRET-PCR product of the present invention is at the pillar location of agarose gel electrophoresis.Totally 11 swimming lanes in figure, wherein 1 swimming lane is standard substance, and 8 swimming lanes are negative sample, and all the other swimming lanes are positive.The standard substance stripe size that this test uses, as figure mark, is followed successively by 100bp, 250bp, 500bp, 750bp etc. from top to bottom.In the present invention, the stripe size of FRET-PCR product is 167bp.
Figure 13. the pillar location of nest-type PRC internal primer of the present invention and external primers PCR primer.Nest-type PRC to increase object band in two steps with inside and outside two pairs of primers, first by external primers amplification object fragment, then increases with internal primer as template with its product.Totally 12 swimming lanes in figure, wherein 1,12 swimming lanes are standard substance, and 2-6 swimming lane is the product of external primers amplification, and 7-11 swimming lane is internal primer amplified production.In the sample to which, 2(7), 5(10), 6(11) swimming lane is positive, 3(8), 4(9) swimming lane is negative sample.This tests the stripe size of standard substance used as shown in the figure, is followed successively by 100bp from top to bottom, 250bp, 500bp, 750bp etc.In nested PCR product, the stripe size of external product is 444bp, and the stripe size of inner product is 352bp.
Embodiment
1. the nucleotide sequence of Rickettsiae PCR detection method the primer and probe is as follows:
（1）FRET-PCR
FRET-upstream primer: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 '
FRET-downstream primer: 5 '-ATCCAGCCTACGGTTCTTGCT-3 '
6-FAM probe: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 '
LCRed640 probe: 5 '-LCRed640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 '
(2) nest-type PRC
N-upstream primer-1:5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 '
N-downstream primer-1:5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 '
N-upstream primer-2:5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 '
N-downstream primer-2:5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 '
2. prepare the standard quantitative reagent of PCR.The sequence of the gene gltA of Rickettsiae kind (cat Rickettsiae, typhoid fever Rickettsiae) is synthesized by IDT.According to molecular weight and the absolute weight of synthetics, calculate the absolute number of the gene copy contained by synthetics.Subsequently, dilute synthetics, the dilution reagent preparing every 10 μ l syntheticss contains 10000 copies, 1000 copies, 100 copies, 10 copies, 1 gene copied, respectively as the standard quantitative reagent of PCR;
3. prepare the DNA profiling of measuring samples.The present invention's detection template used comprises people's whole blood, dog whole blood, flea, tick, louse and mosquito.
1) flea, tick and louse is gathered with it after Species estimation from cat and dog; be stored in the test tube containing the agent of 400ul nuclease protection with single individuality; after PRECELLUS pulverizer is pulverized for 60 seconds, with commercialization nucleic acid extraction kit, nucleic acid extraction is carried out to all samples.The relevant operational flow of nucleic acid extraction operates according to the working instructions of corresponding reagent box, and finally uses T 10e 0.1(containing 10mM Tris-HCl, 0.1mM EDTA, pH8.5) wash-out nucleic acid to 100ul as pcr amplification template.
2) whole blood sample of collector and dog is in containing in the heparin tube of EDTA, carries out nucleic acid purification with commercialization nucleic acid extraction kit to associated sample.The dependent program of nucleic acid extraction operates according to the working instructions of corresponding commercial kit, is finally eluted in 200 μ l T 10e 0.1as the amplification template of PCR in elutriant;
3) the single mosquito be captured, after belonging to kind of qualification, is stored in the test tube containing 400 microlitre nuclease protection agent immediately, after PRECELLUS pulverizer is pulverized for 30 seconds, for DNA purifying; Illustrate that the mosquito sample after to pulverizing carries out nucleic acid purification according to commercial kit relating operation, be finally eluted in 80 μ l T 10e 0.1as the amplification template of PCR in elutriant;
4.PCR amplification system.
1) real-time fluorescence quantitative PCR
The amplification system of 20 μ l comprises: the sample DNA templates of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μM of FRET-upstream primer, 1 μM of FRET-downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the commercialization Taq enzyme of 2 units, 200 μMs of dNTP.
2) nest-type PRC
Nest-type PRC-outside: the amplification system of 20 μ l comprises: commercialization Taq enzyme, 200 μMs of dNTP of the sample DNA templates of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μM of N-upstream primer-1,1 μM of N-downstream primer-1,2 units.
Nest-type PRC-inside: the amplification system of 20 μ l comprises: commercialization Taq enzyme, 200 μMs of dNTP of 10 μ l nest-type PRC external primers products, 1xPCR damping fluid, 1 μM of N-upstream primer-2,1 μM of N-downstream primer-2,2 units.
5.PCR amplification cycles parameter.
1）FRET-PCR
Pcr amplification comprises: the rigorous circulation of height of denaturation, 18 lapses of temperature, 40 owe rigorous fluorescence obtains circulation, 1 lasting fluorescence obtains melting circulation and 1 down cycles.Denaturation: 1x2min@95 DEG C; The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@70 DEG C, 8sec@72 DEG C; 9x1sec@95 DEG C, 12sec@68 DEG C, 8sec@72 DEG C; 3x1sec@95 DEG C, 12sec@66 DEG C, 8sec@72 DEG C; Owe rigorous fluorescence for 40 and obtain circulation: 40x1sec@95 DEG C, 8sec@57 DEG C (collecting fluorescence at this), 30sec@67 DEG C, and30sec@72 DEG C; 1 melts circulation: 1x1sec@95 DEG C, 10sec@38 DEG C ,@85 DEG C of persistent collection fluorescence; Down cycles: 1x1sec@38 DEG C.
2) nest-type PRC (the following identical PCR cycling program of inside and outside nest-type PRC two portions reaction)
Pcr amplification comprises: the rigorous circulation of height, 40 fluorescence acquisitions of owing rigorous of denaturation, 18 lapses of temperature circulate and 1 down cycles.Denaturation: 1x2min@95 DEG C; The rigorous circulation of height of 18 lapses of temperature: 6x1sec@95 DEG C, 12sec@70 DEG C, 8sec@72 DEG C; 9x1sec@95 DEG C, 12sec@68 DEG C, 8sec@72 DEG C; 3x1sec@95 DEG C, 12sec@66 DEG C, 8sec@72 DEG C; Owe rigorous fluorescence for 40 and obtain circulation: 40x1sec@95 DEG C, 8sec@57 DEG C, 30sec@67 DEG C, and30sec@72 DEG C; Down cycles: 1x1sec@38 DEG C.
The judgement of 6.PCR result.
The preparation process of DNA profiling is equipped with feminine gender and the positive control of DNA extraction, and pcr amplification object subsequently comprises the DNA profiling of testing sample, the feminine gender of DNA extraction and positive control.This invention has the specificity of height, all rickettsial nucleic acid can not only be detected, and can determine the Rickettsiae kind of respective sample.Positive and positive control have appearance or the enhancing of fluorescence in the amplified fluorescence curve of FRET-PCR, and have melting peak to occur in melting curve.For the Rickettsiae of different genera, its temperature melting peak can be variant.The stripe size of PCR primer in agarose gel electrophoresis is different, and FRET-PCR object stripe size appears at 167bp, and nest-type PRC external product stripe size is 444bp, inner product is 352bp.1) FRET-PCR is for positive and positive control, and fluorescence occurs at 640nm or strengthens; Have in melting curve and melt peak appearance, and different temperature value places (Fig. 9) is appeared at for its melting summit of Rickettsiae of cat Rickettsiae and other kind.2) first nest-type PRC uses external primers (N-upstream primer-2 and N-downstream primer-2) amplification positive; Then use the PCR primer of external primers as template, with internal primer (N-upstream primer-1 and N-downstream primer-1) amplification object nucleic acid.And the two stripe size at agarose gel electrophoresis is: external primers 444bp, internal primer 352bp.
Embodiment 1: detection method compares with associated molecule detection method
The present invention can be quick, accurate, special the various species sample of detection in Rickettsiae nucleic acid, and determine its rickettsial kind.
1) the present invention can detect all Rickettsiae kinds.Rickettsiae can be divided into Spotted Fever (spotted fevergroup SFG), typhus fever (typhus group) and tsutsugamushi fever (scrub typhus group) etc., and different diseases can be caused for different kinds, if Rickettsia prowazekii (Rickettsia prowazekii) is epidemic typhus and typhic pathogenic agent, Mohs Rickettsiae (Rickettsia mooseri) is the pathogenic agent of endemic typhus (also claiming tarbadillo), Li Kecishi Rickettsiae (Rickettsia rickettsii) is the typhic pathogenic agent of Rocky Mountains, and rickettsia akamushi is the pathogenic agent of tsutsugamushi fever (scrub typhus).A lot of detection method can only detect Spotted Fever or typhus fever at present; and all Rickettsiaes can not be detected; as " Molecular evidence ofRickettsia felis infection in dogs from northern territory; Australia " (Hii SF etc., Parasit Vectors.2011Oct11; 4:198.doi:10.1186/1756-3305-4-198) in ompB-F and ompB-R(Figure 10 .) whether be positive, so operation is comparatively loaded down with trivial details if just can only detect all Spotted Fevers and not carrying out quick judgement sample by PCR fluorescence radiation.
2) the present invention can rapid detection thus reduce workload.For regular-PCR, the presence or absence of object band in PCR primer must be judged by agarose gel electrophoresis, just need and loaded down with trivial details work for screening positive from a large amount of sample, speed and the accuracy of pattern detection will certainly be affected thus.As " A novel Rickettsia infecting Amblyommadubitatum ticks in Brazil " (Almeida AP et al., Ticks Tick Borne Dis.2011; 2 (4): 209-12) the primer CS-78(forward in) and CS-323(reverse) and primer CS-239 and CS-1069(Figure 11 .) be exactly to be come in judgement sample whether containing Rickettsiae related species by regular-PCR and electrophoresis.
3) the present invention detects rickettsial related species from the dissimilar sample of more species.Need from the sample from multiple species, detect that object nucleic acid just more can illustrate its feasibility for a kind of detection method, the diagnosis and detection infected for relevant Li Kecishi provides technical support.As " Rickettsia Species infecting Amblyomma cooperiticks from an area in the state of Sa ~ o Paulo; Brazil; where Brazilian spotted feveris endemic " (Labruna MB et al., J Clin Microbiol.2004; 42 (1): 90-98.) the primer CS-5(forward in) and CS-6(reverse) (figure-11) and probe 5 ' 6-FAM d (CATTGTGCCATCCAGCCTACGGT) BHQ-13 ' from tick, just detect the associated nucleic acid of Rickettsiae kind, the sample not by other kinds is determined.
Embodiment 3: detect the cat Rickettsiae in human blood sample.
Obtain people's whole blood sample 822 parts from Yangzhou hospital, be placed in the business heparin tube containing EDTA.Then extract test kit with Commercial nucleic acid and nucleic acid extraction carried out to people's whole blood sample, as pcr amplification template according to instructions book operation.Then the mode combined by FRET-PCR and nest-type PRC is judged positive and is determined its rickettsial kind.Result shows, and detects 1 part of Rickettsiae positive in 822 parts of people's whole blood samples.This to be Yangzhou be also first China first confirmer infects the rickettsial case of cat.
Embodiment 4: detect the Rickettsiae in dog blood sample.
Dog whole blood 146 parts is taked altogether from Kunming, Yunnan Province and Shanghai City pets hospital and animal outpatient service.Wherein 162 parts, Kunming, 84 parts, Shanghai.Use the present invention to detect all samples, result shows, and has the sample of 8 dogs to infect Rickettsiae.In the rickettsial dog of infection, there are 6 from Kunming, Yunnan Province, have 2 from Shanghai City.Positive is found after order-checking Species estimation, 6 positive are had to be cat Rickettsiae, and other 2 positive are new Rickettsiae bacterial strain, and this novel strain is submitted to NCBI(http: //www.ncbi.nlm.nih.gov), and obtain corresponding numbering (GenBank NO.:KJ440515 and KJ440516).This is not only in Kunming and Shanghai City, is also at the China rickettsial report of cat first simultaneously, have also discovered new Rickettsiae bacterial strain simultaneously.
Embodiment 5: detect the Rickettsiae in Nicaragua's dog blood sample.
Gather 39 parts of dog whole blood samples from the Caribbean Sea, Central America island country-Nicaragua, and detect by the inventive method.Result shows, and wherein have 2 dogs to infect Rickettsiae, and this Rickettsiae belongs to cat Rickettsiae.This is this national reported first cat Rickettsiae, is also that this country finds cat Rickettsiae first in dog blood sample simultaneously.
Embodiment 6: detect the Rickettsiae in Costa Rican dog blood sample.
Gather dog whole blood sample 40 parts from the island country-Costa Rica in Central America, and detect its rickettsial infection state by present system system.Result shows, and sample all shows feminine gender, does not namely have rickettsial infection.Simultaneously with these 40 parts of dog whole blood samples, detect Ehrlichia and anaplasmosis substance respectively by the primer of Ehrlichia (Ehrlichia) and incorporeity (Anaplasma) and probe.Result shows, and the individuality infecting Ehrlichia reaches 36, has 3 increment product to infect incorporeity simultaneously.This result also illustrate that simultaneously, and what the present invention not only can be special detects all rickettsial kinds, and the non-Rickettsiae kind that can not increase, and especially higher with its homology kind, as Ehrlichia, incorporeity etc.
Embodiment 7: detect the Rickettsiae in flea, tick, louse sample.
Gathering 60 fleas with it from the vagrant cat of Yangzhou, is all ctenocephalides felis through Species estimation; Gathering 146 ticks and 47 louse with it from the business dog of Yangzhou dog field, is all brown dog tick through Species estimation tick.To carry out after nucleic acid extraction, as pcr amplification template, then detecting all samples with the present invention to whole sample with commercialization nucleic acid extraction kit.Result shows, and have 57 to infect Rickettsiae, and all Rickettsiaes is cat Rickettsiae in 60 fleas; Have 15 in all tick samples for positive, wherein 14 is cat Rickettsiae, has 1 Rickettsiae carried to be new bacterial strain (GenBank NO.:KJ440521); Have 6 in 47 louse for positive, wherein have 3 for cat Rickettsiae, other 3 is new Rickettsiae bacterial strain (GenBank NO.:KJ440517, KJ440518, KJ440522).This is Operation in Yangzhou Area reported first flea, louse and ixodes infestation Rickettsiae, is also that China detects the rickettsial report of cat first from flea, louse and tick simultaneously, and has found new Rickettsiae bacterial strain.
Embodiment 8: detect the Rickettsiae in mosquito sample.
Catch 428 mosquitoes from Yangzhou and check the inventive method, thus provide theory support for the sample application scope that the present invention is more wide.After nucleic acid extraction being carried out to all mosquito samples with commercialization nucleic acid extraction kit, detect mosquito sample by the inventive method and whether carry Rickettsiae pathogenic agent.Result shows, has 153 mosquitoes to carry Rickettsiae pathogenic agent in 428 mosquitoes.Wherein, the Rickettsiae having 150 mosquitoes to carry is cat Rickettsiae, and remaining 3 mosquito carries three kinds of new Rickettsiae bacterial strains (GenBank NO.:KJ440519, KJ440520, KJ440523).This is that rickettsial report, first mosquito carry rickettsial report to Yangzhou first, also be simultaneously China reported first cat Rickettsiae, reported first mosquito carries cat Rickettsiae pathogenic agent report, and found new Rickettsiae bacterial strain.

Claims (2)

1. detect for real-time FRET-PCR and nest-type PRC and the rickettsial primer of somatotype and probe, it is characterized in that, by FRET-PCR primer, probe, and nest-type PRC primer forms, and the concrete sequence of described primer, probe is as follows:
(1) FRET-PCR primer, probe:
FRET-upstream primer: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 '
FRET-downstream primer: 5 '-ATCCAGCCTACGGTTCTTGCT-3 '
6-FAM probe: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 '
LCRed640 probe: 5 '-LCRed-640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 ';
(2) nest-type PRC primer:
N-upstream primer-1:5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 '
N-downstream primer-1:5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 '
N-upstream primer-2:5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 '
N-downstream primer-2:5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 '.
2. detect and the rickettsial test kit of somatotype for real-time FRET-PCR and nest-type PRC, it is characterized in that being made up of following:
1) real-time fluorescence quantitative PCR reagent,
Namely the amplification system of 10 μ l comprises: 1xPCR damping fluid, 1 μM of FRET-upstream primer, 1 μM of FRET-downstream primer, the 6-FAM probe of 0.2 μM, the LCRed640 probe of 0.2 μM, the Taq enzyme of 2 units, 200 μMs of dNTP;
2) nest-type PRC reagent
Wherein nest-type PRC-outside
The amplification system of 10 μ l comprises: Taq enzyme, 200 μMs of dNTP of 1xPCR damping fluid, 1 μM of N-upstream primer-1,1 μM of N-downstream primer-1,2 units;
Wherein nest-type PRC-inside
The amplification system of 10 μ l comprises: Taq enzyme, 200 μMs of dNTP of 1xPCR damping fluid, 1 μM of N-upstream primer-2,1 μM of N-downstream primer-2,2 units.
CN201410061800.4A 2014-02-24 2014-02-24 A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit Expired - Fee Related CN103789442B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410061800.4A CN103789442B (en) 2014-02-24 2014-02-24 A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410061800.4A CN103789442B (en) 2014-02-24 2014-02-24 A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit

Publications (2)

Publication Number Publication Date
CN103789442A CN103789442A (en) 2014-05-14
CN103789442B true CN103789442B (en) 2015-08-19

Family

ID=50665493

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410061800.4A Expired - Fee Related CN103789442B (en) 2014-02-24 2014-02-24 A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit

Country Status (1)

Country Link
CN (1) CN103789442B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104513865B (en) * 2014-11-25 2016-02-24 扬州大学 Reverse transcription PCR detects test kit and the detection method thereof of Chikungunya virus
CN108034738A (en) * 2018-01-18 2018-05-15 王素华 A kind of rickettsia nest-type PRC specific primer and detection kit and nested PCR detection method
CN114934043A (en) * 2022-05-06 2022-08-23 山东康华生物医疗科技股份有限公司 Primer probe composition and kit for detecting canis and preparation method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Borrelia, Rickettsia, and Ehrlichia Species in Bat Ticks, France, 2010;Cristina Socolovschi et al.;《Emerging Infectious Diseases》;20121231;第18卷(第12期);1966-1975 *
Detection of Rickettsial DNA in Ixodid Ticks Recovered from Dogs and Cats in Japan;Hiroko HIRAOKA et al.;《J. Vet. Med. Sci. 》;20051231;第67卷(第12期);第1217页右栏第2段-1218页第1段 *
Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan;Ishikura M et al.;《Microbiol Immunol.》;20031231;第47卷(第11期);823-832 *

Also Published As

Publication number Publication date
CN103789442A (en) 2014-05-14

Similar Documents

Publication Publication Date Title
Wagemakers et al. Borrelia miyamotoi: a widespread tick-borne relapsing fever spirochete
Rao et al. Leptospirosis in India and the rest of the world
Smirnova et al. Current methods of human and animal brucellosis diagnostics
Wölfel et al. Diagnostics of tick-borne rickettsioses in Germany: a modern concept for a neglected disease
CN100580091C (en) Zoonosis tuberculosis fluorescence PCR rapid diagnosis kit
Nogueras et al. The role of dogs in the eco-epidemiology of Rickettsia typhi, etiological agent of murine typhus
Gupta et al. Diagnostic evaluation of serological assays and different gene based PCR for detection of Brucella melitensis in goat
Qi et al. Development of a rapid and visual nucleotide detection method for a Chinese epidemic strain of Orientia tsutsugamushi based on recombinase polymerase amplification assay and lateral flow test
Tulsiani et al. Emerging tropical diseases in Australia. Part 1. Leptospirosis
CN102286617B (en) Real-time fluorescence quantitative polymerase chain reaction (PCR) kit for incorporeity and rickettsia
CN108048584A (en) The brucellar probe of RAA Fluorometric assays and kit
Hosseini-Chegeni et al. Molecular detection of spotted fever group Rickettsia (Rickettsiales: Rickettsiaceae) in ticks of Iran
CN103789442B (en) A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit
CN101550452B (en) Human bocavirus real-time fluorescence PCR detection reagent kit
CN102703609B (en) Onsite quick detection kit of channel catfish virus and detection method thereof
CN103952472B (en) For the primer of Streptococcus iniae LAMP-LFD Visual retrieval and the application of probe and primer and probe
Husin et al. Current tools for the diagnosis and detection of spotted fever group Rickettsia
Gupta et al. Single-step PCR for detection of Brucella melitensis from tissue and blood of goats
Makgabo et al. Unravelling the diversity of Anaplasma species circulating in selected African wildlife hosts by targeted 16S microbiome analysis
Zhang et al. Studies on bluetongue disease in the People’s Republic of China
CN106434994A (en) Rapid detecting mycoplasma ovipneumoniae method
Zhang et al. Detection of Anaplasma marginale in Hyalomma asiaticum ticks by PCR assay
Kamusoko et al. Purification and amplification of DNA from cellulolytic bacteria: Application for biogas production from crop residues
CN1928562B (en) Enzyme linked immunoreaction reagent kit for detecting rabies virus
CN109856396A (en) Detect enzyme linked immunological kit and its application of mouth disease virus infection antibody

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20150819

Termination date: 20180224