CN103789442A - Primer, probe and kit for detecting and typing rickettsia by virtue of real-time FRET-PCR (Fluorescent Resonance Energy Transfer-Polymerase Chain Reaction) and nested PCR - Google Patents
Primer, probe and kit for detecting and typing rickettsia by virtue of real-time FRET-PCR (Fluorescent Resonance Energy Transfer-Polymerase Chain Reaction) and nested PCR Download PDFInfo
- Publication number
- CN103789442A CN103789442A CN201410061800.4A CN201410061800A CN103789442A CN 103789442 A CN103789442 A CN 103789442A CN 201410061800 A CN201410061800 A CN 201410061800A CN 103789442 A CN103789442 A CN 103789442A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- rickettsiae
- probe
- fret
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer, a probe and a kit for detecting and typing a rickettsia by virtue of real-time FRET-PCR (Fluorescent Resonance Energy Transfer-Polymerase Chain Reaction) and nested PCR. The primer and the probe are shown as sequences 1-8. By virtue of designing the primer and the probe of the FRET-PCR, nucleinic acids of all Rickettsiaes can be specifically amplified, thus fast judging positive samples; then two pairs of primers of the nested PCR can be designed by selecting other conservative intervals of the same gene, and the Rickettsiae of the corresponding positive samples can be determined by virtue of nested PCR, agarose gel electrophoresis and sequencing. Therefore, the system not only can fast and specifically detect the rickettsia organisms of all the Rickettsiaes, but also can confirm the Rickettsiae.
Description
Technical field
The present invention set up a set of based on citric acid synthesized enzyme gene, can detect and the system of somatotype all rickettsial kinds.The mode that native system combines by real-time FRET-PCR and nest-type PRC reaches the object of rapid detection and all Rickettsiae kinds of somatotype.
Background technology
Rickettsiae is a kind of bacterium, but the virulent feature of while tool is strict cytozoicus biology, colonizes in various HAEMATOPHAGOUS ARTHROPODS and insect body.Humans and animals is bitten or is contacted its ight soil by infected rickettsial insect vector and infects, and can cause that human and animal generates heat, the clinical symptom such as headache and fash.This disease mostly occurs in the torrid zone and countries and regions, subtropics, and rickettsial infection has at present become worldwide problem.China classifies as the Category B notifiable disease such as epidemic typhus, endemic typhus by the caused transmissible disease of rickettsial infection at present.There is the disease that more than 10 kinds rickettsial infection causes in China, as epidemic typhus, endemic typhus, tsutsugamushi fever, North asia tick borne spotted fever, Heilungkiang tick borne spotted fever, Inner Mongol tick borne spotted fever, Q heat, person monocytic cell's Ehrlichia disease, Human Granulocytic Ehrlichia disease and bartonellosis etc.The strict cytozoicus of Rickettsiae has determined to identify that rickettsial infection is different from traditional bacteriodiagnosis, separates and cultivates as being not easy to.Rickettsiae worldwide in the not high and positive of recall rate Rickettsiae nucleic acid content relatively low, need a kind of efficient and highly sensitive detection method badly.
1. separation and Culture.For bacterial infection, in morbidity body, separate and cultivate the common method that pathogenic agent is its kind of mensuration.Rickettsiae is that a class is between bacterium and virus, closer to the prokaryotic organism of bacterium.The rickettsial common method of separation and Culture has at present: (1) cell cultures.Be the most popular method of current clinical samples initial gross separation Rickettsiae, the most frequently used clone has L929 and vero cell.(2) animal inoculation pvaccination method.For just generation separation, common experimental animal has small white mouse, cavy, big white mouse, suslik etc.(3) chick embryo yolk sac culture method.The householder method of cultivating as animal, cultivates failed low virulent strain and avirulent strain cultivation for animal, also can be used for the pathogenic agent inoculation of going down to posterity in animal body, and it is bacterial isolate body from Field samples directly.Because Rickettsiae is strict cytozoicus, human or animal's microbemia time of simultaneously infecting is shorter and pathogenic bacteria content is very low, makes comparatively difficulty of rickettsial separation and Culture.
2. serology.The detection of Rickettsiae specific antibody is one of Main Diagnosis technology that WHO recommends, but serum antibody generally can detect in morbidity for 5 to 10 days, is mainly IgM type antibody.Single sera specific antibody can be clarified a diagnosis apparently higher than local normal population serum titer or paired sera generation serum conversion (4 times of risings of serum antibody).Serological method carries out according to experiment purpose, experiment condition conventionally.General international standard is that indirect immunofluorescence (IFA) detects serum antibody.(1) indirect immunofluorescence (IFA).The main Rickettsiae specific antigen that adopts detects infection human or animal serum antibody, and same antigen sheet can detect multiple Rickettsiae simultaneously.(2) complement fixation test (CFT) (CF).A kind ofly to have complement to participate in and immunologic detection method take sheep red blood cell (SRBC) and hemolysin as index system.(3) enzyme linked immunosorbent assay (ELISA).Envelope antigen is generally recombinant antigen, can be used for acute case diagnosis and epidemiology survey.Due to the more difficult separation and Culture of Rickettsiae, make in test kit antigen purify not enough and make often to occur in result false positive or cross infection.
3. immunohistochemical methods.Immunohistochemical methods fluoroscopic examination Rickettsiae can be diagnosed disease human or animal's infection before seroconversion.Flesh tissue, formalin are fixed or paraffin-embedded sample all can be used for immunodetection, the Rickettsiae of observing cell peripheral infection under simple microscope has higher susceptibility and specificity, is not especially having the laboratory of fluorescent microscope convenient.But this method is highly professional, and complex operation.
4. molecular biology.Replace at present pathogen separation as direct diagnosis basis using pcr amplification and order-checking as the Protocols in Molecular Biology of Main Means.Round pcr comprises conventional PCR, nest-type PRC and real-time fluorescence quantitative PCR (real-time quantitative PCR).(1) conventional PCR.Conventionally select genus, group or plant specific gene and increase.As Dermacentroxenus 16SrRNA, typhus fever and Rickettsia spoted fever group 17KD, gltA and outer membrane protein ompB etc.(2) nest-type PRC.As 17KD, gltA, ompB, 56KD nest-type PRC are used to respectively detect typhus fever group and Rickettsia spoted fever group, rickettsia akamushi.(3) real-time fluorescence quantitative PCR.This is to detect at present the nucleic acid detection technique that pathogenic agent is quick, accurate, special, the sensitiveest.Set up the fluorescence quantitative PCR detection technique of typhus fever and Rickettsia spoted fever group as designed primer and probe according to gltA gene order.But current molecular diagnosis method is ripe not enough.Part can contain all Rickettsiae kinds by the detection method of normal PCR and agarose gel electrophoresis, but complex operation is not suitable for the detection of great amount of samples.Existing quantitative PCR only can detect rickettsial Some Species, and can not distinguish the Rickettsiae not of the same race that has Difference in Pathogenicity.
Summary of the invention
1. the technical problem that will solve
Current rickettsial detection method is as follows: the 1) separation of pathogenic bacteria and cultivation.By separating and obtain Rickettsiae from infecting in human or animal body, then inoculating cell etc. cultivating judges.But because rickettsial strict born of the same parents' endoparasitism makes the separation of Rickettsiae cause of disease bacterium and cultivates comparatively difficulty.2) serology detects.By the theory of antigen and antibodies, judge by coated Detection of antigen human or animal's serum antibody.But due to the cross infection that antigen in test kit is purified not or occurred in testing process, make result often occur false positive.3) molecular Biological Detection.Mainly detect in sample and have or not Rickettsiae nucleic acid to judge by PCR method.Rickettsiae has 3 genus, 12 kinds, and the rickettsial pathogenic and metainfective prognosis that does not belong to together and plant is obviously different.Therefore, we need badly and set up one and detect quickly and accurately and distinguish the rickettsial method of all kinds.
2. technical scheme
Principle of the present invention and most crucial thinking are the method systems of sensitive, special, the rapid detection of a kind of height of invention and all Rickettsiae kinds of somatotype.Guarantee this system other non-rickettsial microorganism of not increasing, other especially close with it pathogenic agent, as Eric's body, coxiella burnetii and incorporeity etc. simultaneously.The present invention selects citric acid synthesized enzyme gene as target gene, and selects relatively conservative zone design primer and probe.Overall thinking is: design dexterously primer and the probe of FRET-PCR, and the nucleic acid of all Rickettsiae kinds that can increase specifically, thus judge fast positive; Then select to design 2 pairs of primers of nest-type PRC between other conserved regions of homologous genes, and determine the Rickettsiae kind of corresponding positive by nest-type PRC, agarose gel electrophoresis and order-checking.Therefore, the Rickettsiae that all kinds detected that this system can not only be quick, special, and can determine its kind.
（1）
FRET-PCR。First obtain the gltA gene order of all Rickettsiae kinds from NCBI, and select relatively conservative interval design primer (FRET-upstream primer and FRET-downstream primer) and probe (FRET-6-FAM probe and FRET-LCRed640 probe).Then with this primer and probe, sample is carried out in real time, quantitatively and rapid detection.For the sample that contains Rickettsiae nucleic acid, in FRET-PCR result, its fluorescence curve can occur at 640nm place or strengthen, and in its high resolving power melting curve, its melting summit appears at different temperature places simultaneously.Therefore, can be according to the Rickettsiae that melts peak temperature differentiation cat Rickettsiae and other kind.(2)
nest-type PRC.Based on the inside and outside 2 pairs of primers of gltA gene design (N-upstream primer-1 and N-downstream primer-1, N-upstream primer-2 and N-downstream primer-2), then do nest-type PRC with the sample of the real-time FRET-PCR test positive of this primer pair.First use outside primer amplification object fragment, then use the PCR product of the outside primer of inner primer amplification.Final PCR product is carried out to gene sequencing, finally the standard nucleic acid sequence of sequencing result and each Rickettsiae kind is compared, thereby determine its rickettsial kind.
From GenBank(www.ncbi.nlm.nih.gov) obtain the sequence of citric acid synthesized enzyme gene of following Rickettsiae kind, all sequences is compared by the method for Clustal Multiple Alignment Algorithm: Rickettsia africae U59733, R.akari U59717, R.australis U59718, R.canadensis U59713, R.conorii U59730, R.felis JQ674484, R.helvetica U59723, R.honei AF018074, R.japonica U59724, R.massiliae U59719, R.mongolotimonae U59731, R.montana U74756, R.pakeri U59732, R.rhipicephali U59721, R.rickettsii U59734, R.solvaca U59725, R.thphi U59714, R.hoogstraalii FJ767737, R.japonica AY743327, R.prowazekii U59715.Accordingly, primer and the probe of the present invention's design are (Fig. 1-8): concrete sequence is as follows
(1) quantitative FRET-PCR primer and probe
FRET-upstream primer: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 ' (SEQ ID NO.1)
FRET-downstream primer: 5 '-ATCCAGCCTACGGTTCTTGCT-3 ' (SEQ ID NO.2)
6-FAM probe: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 ' (SEQ ID NO.3)
LCRed640 probe: 5 '-LCRed-640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 ' (SEQ ID NO.4)
(2) nest-type PRC
N-upstream primer-1:5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 ' (SEQ ID NO.5)
N-downstream primer-1:5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 ' (SEQ ID NO.6)
N-upstream primer-2:5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 ' (SEQ ID NO.7)
N-downstream primer-2:5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 ' (SEQ ID NO.8)
The present invention also provides for real-time FRET-PCR and nest-type PRC and has detected and the rickettsial test kit of somatotype, comprising:
(1) real-time fluorescence quantitative PCR reagent
The amplification system of 20 μ l comprises: the sample DNA template of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μ MFRET-upstream primer, 1 μ M FRET-downstream primer, the 6-FAM probe of 0.2 μ M, the LCRed640 probe of 0.2 μ M, the commercialization Taq enzyme of 2 units, 200 μ M dNTP.
(2) nest-type PRC reagent
Nest-type PRC-outside:
The amplification system of 20 μ l comprises: the commercialization Taq enzyme of the sample DNA template of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μ MN-upstream primer-1,1 μ M N-downstream primer-1,2 units, 200 μ M dNTP;
Nest-type PRC-inside:
The amplification system of 20 μ l comprises: the outside primer product of 10 μ l nest-type PRCs, 1xPCR damping fluid, 1 μ M N-upstream primer-2,1 μ M N-downstream primer-2, the commercialization Taq enzyme of 2 units, 200 μ M dNTP.
Citrate synthase-PCR is specific to be determined.Specificity of the present invention is guaranteed from four aspects:
1) primer of design and probe be through the blast search of GenBank, the primer of confirming the present invention's design all Rickettsiaes that can increase specifically, and the nucleic acid of especially close with it kind pathogenic agent of other non-Rickettsiae that do not increase.Confirm by BLAST, the primer of FRET-PCR probe and primer and nest-type PRC can increase and detect the nucleic acid of all Rickettsiae kinds specifically;
2) the present invention detects cat Rickettsiae and typhoid fever Rickettsiae standard substance, Ehrlichia positive and incorporeity positive.Result shows, system of the present invention can increase cat Rickettsiae and the rickettsial nucleic acid of typhoid fever, and the nucleic acid of do not increase Ehrlichia and incorporeity positive;
3) variation of observation above amplification object fluorescence intensity (640nm) in PCR process, and pcr amplification product is in the size of the band of agarose gel electrophoresis.Fluorescence occurs or strengthens at 640nm wavelength, shows positive; In agarose gel electrophoresis, RT-PCR shows the stripe size of 167 base pairs (bp) and the outside 444bp of nest-type PRC and inner 352bp;
4) the PCR product of amplification is checked order, the result of order-checking and the standard sequence of GenBank are compared, thereby judge its rickettsial kind.
Determining of citrate synthase-PCR sensitivity: by the cat Rickettsiae in the synthetic Rickettsiae of IDT and the sequence of typhoid fever Rickettsiae citric acid synthesized enzyme gene.According to molecular weight and the absolute weight of synthetics, calculate the absolute number of the contained gene copy of synthetics.Subsequently, synthetics is diluted, prepare the dilution reagent of every 10 μ l syntheticss containing the gene of 10,000 copies, 1,000 copy, 100 copies, 10 copies, 1 copy.Diluent with system amplification of the present invention containing different genes concentration, determines that the present invention detects the sensitivity of this gene.Result shows, this invention single object citric acid synthesized enzyme gene copying that can increase in reactive system.
3. beneficial effect
1) the present invention can detect all Rickettsiaes specifically.So far, Rickettsiae can be divided into Rickettsia spoted fever group, typhoid fever group and 3 genus of rickettsia akamushi, totally 12 kinds, as R.rickettsia, R.akari, R.conorii, R.sibirica, R.australis, R.felis, R.japonica, R.africae, R.hoogstraalii, R.prowazekii, R.typhi etc.Therefore, can detect that rickettsial all kinds are very important, especially for the larger kind of homology difference simultaneously.Meanwhile, detect that all kinds can find new rickettsial kind or strain more easily, and upgrade timely rickettsial classification, thereby be familiar with better this pathogenic agent.
2) the present invention can carry out somatotype to Rickettsiae not of the same race.Different Rickettsiae kinds can cause different epidemic diseases, if Rickettsia prowazekii (Rickettsia prowazekii) is epidemic typhus and typhic pathogenic agent, Mohs Rickettsiae (Rickettsia mooseri) is the endemic typhus pathogenic agent of (also claiming tarbadillo), Li Kecishi Rickettsiae (Rickettsia rickettsii) is to cause the typhic pathogenic agent of Rocky Mountains, and rickettsia akamushi (Rickettsia tsutsugamushi) is the pathogenic agent of tsutsugamushi fever (scrub typhus).Therefore, thereby the rickettsial kind of determining positive sample is taked corresponding treatment and measure of control according to corresponding pathogenic agent feature, can take corresponding prophylactico-therapeutic measures according to the contagium of different infectious diseases and route of transmission, thereby better prevent and control rickettsial infection simultaneously.
3) simple operation of the present invention, is suitable for detecting great amount of samples.Because Rickettsiae is strict cytozoicus, and it is relatively low to infect rickettsial human or animal (as blood) rickettsial bacteria content in microbemia and later stage body thereof, and this just need to be tested and appraised more sample or extremely sensitive detection method is made a definite diagnosis infection.In actual applications, as epidemiology survey or detect a large amount of submitted samples, need great workload for regular-PCR in conjunction with methods such as agarose gel electrophoresis.And the present invention can first filter out positive sample from great amount of samples, and then determine its rickettsial kind by nest-type PRC, agarose gel electrophoresis and order-checking.
Rickettsiae is a kind of bacterium, is different from traditional bacteriological detection but its strict cytozoicus, the features such as specific clinical manifestation and shorter microbemia time that lack have determined that Rickettsiae detects.Due to detection time and sample quantitative limitation, polymerase chain reaction (PCR) detects becomes main detection means and method, especially quantitatively FRET-PCR and nest-type PRC.
4) the present invention combines the advantage of quantitative PCR and nest-type PRC, and has abandoned their shortcoming.The present invention can detect special, sensitive and fast all Rickettsiaes and determine the rickettsial kind of relevant positive, and the detection for rickettsial infection and control are provided strong technical support by this.
Accompanying drawing explanation
Fig. 1. the upstream primer of quantitative FRET-PCR of the present invention.FRET-upstream primer sequence: 5 ' TTRCAAATAGCAATAGAACTTGAAGCT-3 ' (27bp), wherein have one to annex base R.This annexs base R can increase A and G base simultaneously, so R.hoogstraalii has a base mismatch, and the Rickettsiae of other kinds and this primer fit like a glove.
Fig. 2. the downstream primer of quantitative FRET-PCR of the present invention.(21bp), this sequence is the nucleotide sequence that obtains sequence Symmetric Chain in figure to FRET-downstream primer sequence: 5 '-ATCCAGCCTACGGTTCTTGCT-3 '.In rickettsial all kinds, R.prowazekii and R.typhi have 1 mispairing, and R.helvetica has 2 mispairing.
Fig. 3. the 6-FAM probe of quantitative FRET-PCR of the present invention.6-FAM probe sequence is: 5 ' ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 ' (21bp), are marked with fluorescence excitation group at its 3 ' end.This probe has 1 mispairing at R.canadensis and R.slovaca, has 2 mispairing at R.prowazekii and R.typhi, and fits like a glove with the Rickettsiae of other kinds.
Fig. 4. the LCRed640 probe of quantitative FRET-PCR of the present invention.The nucleotide sequence of LCRed640 probe in FRET-PCR: 5 ' LCRed-640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 ' (31bp), its 5 ' end mark, 640 fluorescence are accepted group, and 3 ' end labeled phosphorus acid groups stops it in PCR reaction system, to continue to extend downwards.The Rickettsiae citric acid synthesized enzyme gene of this section of primer sequence and all kinds is identical.
Fig. 5. N-upstream primer-1 of nest-type PRC of the present invention.The nucleotides sequence of the outside primer N-of nest-type PRC upstream primer-1 is classified as: 5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 ' (32bp), and contains one and annexs base K in primer.Annex base K can increase bases G and T simultaneously, make primer can contain more Rickettsiae kind.Primer has 2 base mismatch in R.canadensis, and fits like a glove with the rickettsial nucleotide sequence of other kinds.
Fig. 6. N-downstream primer-1 of nest-type PRC of the present invention.The nucleotides sequence of nest-type PRC peripheral primer N-downstream primer-1 is classified as: (31bp), this primer sequence is the Symmetric Chain sequence that obtains nucleotide chain in figure to 5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 '.This primer is the downstream primer of nest-type PRC amplification exterior portion, and it has 1 base mismatch in R.prowazekii, and all identical with the sequence of the corresponding gltA gene nucleotide of other Rickettsiae kinds.
Fig. 7. N-upstream primer-2 of nest-type PRC of the present invention.The nucleotides sequence of the inner upstream primer N-of this nest-type PRC upstream primer-2 is classified as: 5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 ', long 26 Nucleotide.This primer has respectively 1 base mismatch in R.felis and R.canadensis, has 2 base mismatch in R.hoogstraalii.
Fig. 8. N-downstream primer-2 of nest-type PRC of the present invention.The nucleotides sequence of the inner primer N-of this nest-type PRC downstream primer-2 is classified as: 5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 ', its long 27 bases, contain one simultaneously and annex base Y.This annexs base Y can increase base C and T simultaneously.This primer is downstream primer, and its sequence is the nucleotide sequence of the Symmetric Chain of nucleotide chain in figure.Except annexing base site, this primer and R.hoogstraalii have 1 base mismatch.
Fig. 9. the melting curve of Rickettsiae in the present invention.After the present invention finishes, for Rickettsiae not of the same race, the temperature that melts peak in its melting curve can be different.Represent the melting peak in cat Rickettsiae, negative control and other kind of rickettsial melting curve as schemed.Can tentatively judge rickettsial kind by the difference that melts peak temperature.As shown in the figure, it is 61.9 ℃ that cat Rickettsiae dissolves peak temperature, and the Rickettsiae of other kind dissolving peak temperature is 57.9 ℃.
Figure 10. ompB-F and ompB-R primer in embodiment 1.Article " Molecular evidence of Rickettsia felis infection in dogs from northern territory, Australia " (Hii SF et al., Parasit Vectors.2011; OmpB-F 4:198) and ompB-R primer.The primer of this article can only detect the rickettsial nucleic acid of cat, and can not contain other kinds of Rickettsiae.
Figure 11. primer CS-78, CS-323, CS-239 and CS-1069 and primer CS-5 and CS-6 in embodiment 1.(1) article " A novel Rickettsia infecting Amblyomma dubitatum ticks in Brazil " (Almeida AP et al., Ticks Tick Borne Dis.2011; 2 (4): 209-212) primer CS-78, CS-323, CS-239 and CS-1069 in.This cover primer needs and agarose gel electrophoresis combines, and this can strengthen the workload while detection, especially in the face of great amount of samples.
(2) article " Rickettsia Species Infecting Amblyomma cooperi Ticks from an Area in the State of Sa～o Paulo; Brazil; Where Brazilian Spotted Fever Is Endemic " (Labruna MB et al., J Clin Microbiol.2004; 42 (1): 90-98.) primer CS-5 and CS-6 in.Primer in this article and probe have just detected the existence of Rickettsiae in tick, not by the detection of more animal species samples.
Figure 12: the quantitative FRET-PCR product of the present invention is at the pillar location of agarose gel electrophoresis.Totally 11 swimming lanes in figure, wherein 1 swimming lane is standard substance, the negative sample of 8 swimming lane, the positive sample of all the other swimming lanes.The standard substance stripe size that this test is used, as figure mark, is followed successively by 100bp, 250bp, 500bp, 750bp etc. from top to bottom.In the present invention, the stripe size of FRET-PCR product is 167bp.
Figure 13. the pillar location of the inner primer of nest-type PRC of the present invention and outside primer PCR product.Inside and outside two pairs of primers object band that increases in two steps for nest-type PRC, first uses outside primer amplification object fragment, then with its product as template and use inner primer amplification.Totally 12 swimming lanes in figure, wherein 1,12 swimming lanes are standard substance, the product that 2-6 swimming lane is outside primer amplification, 7-11 swimming lane is inner primer extension product.In sample, 2(7), 5(10), 6(11) the positive sample of swimming lane, 3(8), 4(9) the negative sample of swimming lane.This stripe size of testing standard substance used as shown in the figure, is followed successively by 100bp, 250bp, 500bp, 750bp etc. from top to bottom.In nest-type PRC product, the stripe size of external product is 444bp, and the stripe size of inner product is 352bp.
Embodiment
1. the nucleotide sequence of Rickettsiae PCR detection method the primer and probe is as follows:
（1）FRET-PCR
FRET-upstream primer: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 '
FRET-downstream primer: 5 '-ATCCAGCCTACGGTTCTTGCT-3 '
6-FAM probe: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 '
LCRed640 probe: 5 '-LCRed640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 '
(2) nest-type PRC
N-upstream primer-1:5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 '
N-downstream primer-1:5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 '
N-upstream primer-2:5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 '
N-downstream primer-2:5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 '
2. the standard quantitative reagent that preparation PCR uses.Synthesized the sequence of the gene gltA of Rickettsiae kind (cat Rickettsiae, typhoid fever Rickettsiae) by IDT.According to molecular weight and the absolute weight of synthetics, calculate the absolute number of the contained gene copy of synthetics.Subsequently, synthetics is diluted, the dilution reagent of preparing every 10 μ l syntheticss contains respectively 10000 copies, 1000 copies, 100 copies, 10 copies, 1 gene copying, the standard quantitative reagent of using as PCR;
3. prepare the DNA profiling of sample to be checked.The present invention's detection template used comprises people's whole blood, dog whole blood, flea, tick, louse and mosquito.
1) gather flea, tick and louse with it after kind is identified from cat and dog; be stored in single individuality in the test tube that contains the agent of 400ul nuclease protection; after PRECELLUS pulverizer 60 seconds is pulverized, all samples is carried out to nucleic acid extracting with commercialization nucleic acid extraction kit.The relating operation flow process of nucleic acid extraction operates according to the working instructions of corresponding reagent box, and finally uses T
10e
0.1(containing 10mM Tris-HCl, 0.1mM EDTA, pH8.5) wash-out nucleic acid to 100ul as pcr amplification template.
2) whole blood sample of collector and dog is in containing in the heparin tube of EDTA, associated sample carried out to nucleic acid purification with commercialization nucleic acid extraction kit.The dependent program of nucleic acid extraction, according to the working instructions operation of corresponding commercial kit, is finally eluted in 200 μ l T
10e
0.1in elutriant as the amplification template of PCR;
3) the single mosquito being captured, after belonging to kind of evaluation, is stored in the test tube that contains 400 microlitre nuclease protection agent immediately, after PRECELLUS pulverizer is pulverized for 30 seconds, for DNA purifying; According to the explanation of commercial kit relating operation, the mosquito sample after pulverizing is carried out to nucleic acid purification, be finally eluted in 80 μ l T
10e
0.1in elutriant as the amplification template of PCR;
4.PCR amplification system.
1) real-time fluorescence quantitative PCR
The amplification system of 20 μ l comprises: the sample DNA template of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μ MFRET-upstream primer, 1 μ M FRET-downstream primer, the 6-FAM probe of 0.2 μ M, the LCRed640 probe of 0.2 μ M, the commercialization Taq enzyme of 2 units, 200 μ M dNTP.
2) nest-type PRC
Nest-type PRC-outside: the amplification system of 20 μ l comprises: the commercialization Taq enzyme of the sample DNA template of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μ M N-upstream primer-1,1 μ M N-downstream primer-1,2 units, 200 μ M dNTP.
Nest-type PRC-inside: the amplification system of 20 μ l comprises: the outside primer product of 10 μ l nest-type PRCs, 1xPCR damping fluid, 1 μ M N-upstream primer-2,1 μ M N-downstream primer-2, the commercialization Taq enzyme of 2 units, 200 μ M dNTP.
5.PCR amplification cycles parameter.
1）FRET-PCR
Pcr amplification comprises: the rigorous circulation of height, 40 melting circulation and 1 coolings of owing rigorous fluorescence acquisition circulation, 1 lasting fluorescence acquisition of denaturation, 18 lapses of temperature circulate.Denaturation: 95 ℃ of 1x2min@; The rigorous circulation of height of 18 lapses of temperature: 95 ℃ of 6x1sec@, 70 ℃ of 12sec@, 72 ℃ of 8sec@; 95 ℃ of 9x1sec@, 68 ℃ of 12sec@, 72 ℃ of 8sec@; 95 ℃ of 3x1sec@, 66 ℃ of 12sec@, 72 ℃ of 8sec@; Owe rigorous fluorescence for 40 and obtain circulation: 95 ℃ of 40x1sec@, 57 ℃ of 8sec@(collecting fluorescence at this), 67 ℃ of 30sec@, 72 ℃ of and30sec@; 1 melts circulation: 95 ℃ of 1x1sec@, 38 ℃ of 10sec@, 85 ℃ of lasting fluorescence of collecting of@; Cooling circulation: 38 ℃ of 1x1sec@.
2) nest-type PRC (the following identical PCR cycling program of inside and outside nest-type PRC two portions reaction)
Pcr amplification comprises: the rigorous circulation of height, 40 fluorescence acquisition circulation and 1 coolings of owing rigorous of denaturation, 18 lapses of temperature circulate.Denaturation: 95 ℃ of 1x2min@; The rigorous circulation of height of 18 lapses of temperature: 95 ℃ of 6x1sec@, 70 ℃ of 12sec@, 72 ℃ of 8sec@; 95 ℃ of 9x1sec@, 68 ℃ of 12sec@, 72 ℃ of 8sec@; 95 ℃ of 3x1sec@, 66 ℃ of 12sec@, 72 ℃ of 8sec@; Owe rigorous fluorescence for 40 and obtain circulation: 95 ℃ of 40x1sec@, 57 ℃ of 8sec@, 67 ℃ of 30sec@, 72 ℃ of and30sec@; Cooling circulation: 38 ℃ of 1x1sec@.
The judgement of 6.PCR result.
The preparation process of DNA profiling is equipped with feminine gender and the positive control of DNA extraction, and pcr amplification object subsequently comprises the DNA profiling of testing sample, feminine gender and the positive control of DNA extraction.This invention has the specificity of height, all rickettsial nucleic acid can not only be detected, and can determine the Rickettsiae kind of respective sample.Positive and positive control have appearance or the enhancing of fluorescence in the amplified fluorescence curve of FRET-PCR, and in melting curve, have the peak of melting to occur.For the Rickettsiae of different genera, its temperature that melts peak can be variant.The stripe size difference of PCR product in agarose gel electrophoresis, FRET-PCR object stripe size appears at 167bp, and nest-type PRC external product stripe size is that 444bp, inner product are 352bp.1) FRET-PCR is for positive and positive control, and fluorescence occurs or strengthens at 640nm; In melting curve, have and melt peak appearance, and appear at different temperature value places (Fig. 9) for its melting summit of Rickettsiae of cat Rickettsiae and other kind.2) first nest-type PRC uses outside primer (N-upstream primer-2 and N-downstream primer-2) amplification positive; Then use the PCR product of outside primer as template, with inner primer (N-upstream primer-1 and N-downstream primer-1) amplification object nucleic acid.And the two stripe size at agarose gel electrophoresis is: outside primer 444bp, inner primer 352bp.
Embodiment 1: the comparison of detection method of the present invention and associated molecule detection method
The present invention can be quick, accurate, special the various species samples of detection in Rickettsiae nucleic acid, and determine its rickettsial kind.
1) the present invention can detect all Rickettsiae kinds.Rickettsiae can be divided into Spotted Fever (spotted fever group SFG), typhus fever (typhus group) and tsutsugamushi fever (scrub typhus group) etc., and can cause different diseases for different kinds, if Rickettsia prowazekii (Rickettsia prowazekii) is epidemic typhus and typhic pathogenic agent, Mohs Rickettsiae (Rickettsia mooseri) is the endemic typhus pathogenic agent of (also claiming tarbadillo), Li Kecishi Rickettsiae (Rickettsia rickettsii) is the typhic pathogenic agent of Rocky Mountains, and rickettsia akamushi is the pathogenic agent of tsutsugamushi fever (scrub typhus).At present a lot of detection methods can only detect Spotted Fever or typhus fever; and can not detect all Rickettsiaes; as " Molecular evidence of Rickettsia felis infection in dogs from northern territory; Australia " (Hii SF etc., Parasit Vectors.2011Oct11; 4:198.doi:10.1186/1756-3305-4-198) in ompB-F and ompB-R(Figure 10 .) just can only detect all Spotted Fevers and can not by PCR fluorescence radiation come quick judgement sample whether positive, so operation comparatively loaded down with trivial details.
2) thus the present invention can rapid detection reduces workload.For regular-PCR, must judge having or not of object band in PCR product by agarose gel electrophoresis, just need and loaded down with trivial details work for screen positive from a large amount of samples, will certainly affect thus speed and the accuracy of pattern detection.As " A novel Rickettsia infecting Amblyomma dubitatum ticks in Brazil " (Almeida AP et al., Ticks Tick Borne Dis.2011; 2 (4): 209-12) the primer CS-78(forward in) with CS-323(reverse) and primer CS-239 and CS-1069(Figure 11 .) be exactly to carry out whether to contain in judgement sample the relevant kind of Rickettsiae by regular-PCR and electrophoresis.
3) the present invention has detected rickettsial relevant kind from the dissimilar sample of more species.Need to from the sample from multiple species, detect that for a kind of detection method object nucleic acid just more can illustrate its feasibility, the diagnosis and detection infecting for relevant Li Kecishi provides technical support.As " Rickettsia Species infecting Amblyomma cooperi ticks from an area in the state of Sa～o Paulo; Brazil; where Brazilian spotted fever is endemic " (Labruna MB et al., J Clin Microbiol.2004; 42 (1): 90-98.) the primer CS-5(forward in) and CS-6(reverse) (figure-11) and probe 5 ' 6-FAM d (CATTGTGCCATCCAGCCTACGGT) BHQ-13 ' associated nucleic acid of Rickettsiae kind just from tick, detected, fail to determine by the sample of other kinds.
Embodiment 3: detect the cat Rickettsiae in human blood sample.
Obtain 822 parts of people's whole blood samples from Yangzhou hospital, be placed in the business heparin tube that contains EDTA.Then with business nucleic acid extraction kit and according to instructions book operation, people's whole blood sample is carried out to nucleic acid extraction, as pcr amplification template.Then the mode combining by FRET-PCR and nest-type PRC is judged positive and is determined its rickettsial kind.Result shows, detects 1 part of Rickettsiae positive in 822 parts of people's whole blood samples.This be Yangzhou be also first China first confirmer infect the rickettsial case of cat.
Embodiment 4: detect the Rickettsiae in dog blood sample.
Take altogether 146 parts of dog whole bloods from Kunming, Yunnan Province and Shanghai City pets hospital and animal outpatient service.Wherein 162 parts, Kunming, 84 parts, Shanghai.Use the present invention to detect all samples, result shows, has the sample of 8 dogs to infect Rickettsiae.Infecting in rickettsial dog, there are 6 from Kunming, Yunnan Province, there are 2 from Shanghai City.Positive after identifying, order-checking kind is found, having 6 positive is cat Rickettsiae, and other 2 positive are new Rickettsiae bacterial strain, and this novel strain is submitted to NCBI(http: //www.ncbi.nlm.nih.gov), and obtained corresponding numbering (GenBank NO.:KJ440515 and KJ440516).This is not only in Kunming and Shanghai City, is also at the China rickettsial report of cat first simultaneously, has also found new Rickettsiae bacterial strain simultaneously.
Embodiment 5: detect the Rickettsiae in Nicaragua's dog blood sample.
Gather 39 parts of dog whole blood samples from the Caribbean Sea, Central America island country-Nicaragua, and detect by the inventive method.Result shows, wherein have 2 dogs to infect Rickettsiae, and this Rickettsiae belongs to cat Rickettsiae.This is this country's reported first cat Rickettsiae, is also that this country finds cat Rickettsiae first in dog blood sample simultaneously.
Embodiment 6: detect the Rickettsiae in Costa Rican dog blood sample.
Gather 40 parts of dog whole blood samples from the island country in Central America-Costa Rica, and detect its rickettsial infection state with system of systems of the present invention.Result demonstration, sample all shows feminine gender, there is no rickettsial infection.Use this 40 parts of dog whole blood samples simultaneously, detect respectively Ehrlichia and anaplasmosis substance by primer and the probe of Ehrlichia (Ehrlichia) and incorporeity (Anaplasma).Result demonstration, the individuality that infects Ehrlichia reaches 36, has 3 duplicate samples to infect incorporeity simultaneously.This result while has also illustrated, what the present invention not only can be special detects all rickettsial kinds, and the non-Rickettsiae kind that can not increase, and especially higher with its homology kind, as Ehrlichia, incorporeity etc.
Embodiment 7: detect the Rickettsiae in flea, tick, louse sample.
Gather 60 fleas with it from the vagrant cat of Yangzhou, identify to be all ctenocephalides felis through kind; Gather 146 ticks and 47 louse with it from the business dog of Yangzhou dog field, identify that through kind tick is all brown dog tick.Whole samples are carried out after nucleic acid extracting, as pcr amplification template, then detecting all samples with the present invention with commercialization nucleic acid extraction kit.Result shows, have 57 to infect Rickettsiae, and all Rickettsiaes is cat Rickettsiae in 60 fleas; In all tick samples, have 15 positive, wherein 14 is cat Rickettsiae, having 1 Rickettsiae carrying is new bacterial strain (GenBank NO.:KJ440521); In 47 louse, have 6 positive, wherein have 3 for cat Rickettsiae, other 3 is new Rickettsiae bacterial strain (GenBank NO.:KJ440517, KJ440518, KJ440522).This is Operation in Yangzhou Area reported first flea, louse and ixodes infestation Rickettsiae, is also that China detects the rickettsial report of cat first from flea, louse and tick simultaneously, and has found new Rickettsiae bacterial strain.
Embodiment 8: detect the Rickettsiae in mosquito sample.
Catch 428 mosquitoes check the inventive method from Yangzhou, thereby provide theory support for the more wide sample application scope of the present invention.All mosquito samples are carried out after nucleic acid extraction with commercialization nucleic acid extraction kit, detect mosquito sample by the inventive method and whether carried Rickettsiae pathogenic agent.Result shows in 428 mosquitoes, have 153 mosquitoes to carry Rickettsiae pathogenic agent.Wherein, having the Rickettsiae that 150 mosquitoes are carried is cat Rickettsiae, and remaining 3 mosquito has been carried three kinds of new Rickettsiae bacterial strains (GenBank NO.:KJ440519, KJ440520, KJ440523).This be Yangzhou first rickettsial report, mosquito is carried rickettsial report first, also be that China reported first cat Rickettsiae, reported first mosquito are carried cat Rickettsiae pathogenic agent report, and found new Rickettsiae bacterial strain simultaneously.
Claims (2)
1. detect and the rickettsial primer of somatotype and probe for real-time FRET-PCR and nest-type PRC, it is characterized in that, by FRET-PCR primer, probe, and nest-type PRC primer composition, the concrete sequence of described primer, probe is as follows:
(1) FRET-PCR primer, probe:
FRET-upstream primer: 5 '-TTRCAAATAGCAATAGAACTTGAAGCT-3 '
FRET-downstream primer: 5 '-ATCCAGCCTACGGTTCTTGCT-3 '
6-FAM probe: 5 '-ATCGCTCTTAAAGATGAATATTTTATTGAG-6-FAM-3 '
LCRed640 probe: 5 '-LCRed-640-GAAAATTATATCCAAATGTTGATTTTTATTC-phosphoric acid-3 ';
(2) nest-type PRC:
N-upstream primer-1:5 '-AGTAAATCCAATAATAAAAAATGCKCTTAATA-3 '
N-downstream primer-1:5 '-ATTTTCTCTCAATAAAATATTCATCTTTAAG-3 '
N-upstream primer-2:5 '-ATGAGCAGAATGCTTCTACTTCAACA-3 '
N-downstream primer-2:5 '-AGCTTCAAGTTCTATTGCTATTTGYAA-3 '.
2. detect and the rickettsial test kit of somatotype for real-time FRET-PCR and nest-type PRC, it is characterized in that by forming below:
1) real-time fluorescence quantitative PCR reagent
The amplification system of 20 μ l comprises: the sample DNA template of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μ MFRET-upstream primer, 1 μ M FRET-downstream primer, the 6-FAM probe of 0.2 μ M, the LCRed640 probe of 0.2 μ M, the Taq enzyme of 2 units, 200 μ M dNTP;
2) nest-type PRC reagent
Nest-type PRC-outside:
The amplification system of 20 μ l comprises: the Taq enzyme of the sample DNA template of 10 μ l or quantitative criterion reagent, 1xPCR damping fluid, 1 μ MN-upstream primer-1,1 μ M N-downstream primer-1,2 units, 200 μ M dNTP;
Nest-type PRC-inside:
The amplification system of 20 μ l comprises: the outside primer product of 10 μ l nest-type PRCs, 1xPCR damping fluid, 1 μ M N-upstream primer-2,1 μ M N-downstream primer-2, the Taq enzyme of 2 units, 200 μ M dNTP.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410061800.4A CN103789442B (en) | 2014-02-24 | 2014-02-24 | A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410061800.4A CN103789442B (en) | 2014-02-24 | 2014-02-24 | A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103789442A true CN103789442A (en) | 2014-05-14 |
| CN103789442B CN103789442B (en) | 2015-08-19 |
Family
ID=50665493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410061800.4A Expired - Fee Related CN103789442B (en) | 2014-02-24 | 2014-02-24 | A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103789442B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016082691A1 (en) * | 2014-11-25 | 2016-06-02 | 扬州大学 | Kit for rt-pcr detection of chikungunya and test method thereof |
| CN108034738A (en) * | 2018-01-18 | 2018-05-15 | 王素华 | A kind of rickettsia nest-type PRC specific primer and detection kit and nested PCR detection method |
| CN114934043A (en) * | 2022-05-06 | 2022-08-23 | 山东康华生物医疗科技股份有限公司 | Primer probe composition and kit for detecting canis and preparation method thereof |
-
2014
- 2014-02-24 CN CN201410061800.4A patent/CN103789442B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| CRISTINA SOCOLOVSCHI ET AL.: "Borrelia, Rickettsia, and Ehrlichia Species in Bat Ticks, France, 2010", 《EMERGING INFECTIOUS DISEASES》, vol. 18, no. 12, 31 December 2012 (2012-12-31), pages 1966 - 1975 * |
| HIROKO HIRAOKA ET AL.: "Detection of Rickettsial DNA in Ixodid Ticks Recovered from Dogs and Cats in Japan", 《J. VET. MED. SCI. 》, vol. 67, no. 12, 31 December 2005 (2005-12-31) * |
| ISHIKURA M ET AL.: "Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan", 《MICROBIOL IMMUNOL.》, vol. 47, no. 11, 31 December 2003 (2003-12-31), pages 823 - 832, XP002384860 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016082691A1 (en) * | 2014-11-25 | 2016-06-02 | 扬州大学 | Kit for rt-pcr detection of chikungunya and test method thereof |
| CN108034738A (en) * | 2018-01-18 | 2018-05-15 | 王素华 | A kind of rickettsia nest-type PRC specific primer and detection kit and nested PCR detection method |
| CN114934043A (en) * | 2022-05-06 | 2022-08-23 | 山东康华生物医疗科技股份有限公司 | Primer probe composition and kit for detecting canis and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103789442B (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yagupsky et al. | Laboratory diagnosis of human brucellosis | |
| Luce-Fedrow et al. | Strategies for detecting rickettsiae and diagnosing rickettsial diseases | |
| Wagemakers et al. | Borrelia miyamotoi: a widespread tick-borne relapsing fever spirochete | |
| Al Dahouk et al. | New developments in the diagnostic procedures for zoonotic brucellosis in humans | |
| Smirnova et al. | Current methods of human and animal brucellosis diagnostics | |
| Wölfel et al. | Diagnostics of tick-borne rickettsioses in Germany: a modern concept for a neglected disease | |
| CN100580091C (en) | Zoonosis tuberculosis fluorescence PCR rapid diagnosis kit | |
| Nogueras et al. | The role of dogs in the eco-epidemiology of Rickettsia typhi, etiological agent of murine typhus | |
| Bertasio et al. | Serological survey and molecular typing reveal new Leptospira serogroup pomona strains among pigs of northern Italy | |
| CN102002531A (en) | Toxoplasma gondii detection kit and application thereof | |
| US20200232015A1 (en) | Method for detecting brucella infection and application thereof | |
| Qi et al. | Development of a rapid and visual nucleotide detection method for a Chinese epidemic strain of Orientia tsutsugamushi based on recombinase polymerase amplification assay and lateral flow test | |
| Khaki | Clinical laboratory diagnosis of human leptospirosis | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| Hosseini-Chegeni et al. | Molecular detection of spotted fever group Rickettsia (Rickettsiales: Rickettsiaceae) in ticks of Iran | |
| Tulsiani et al. | Emerging tropical diseases in Australia. Part 1. Leptospirosis | |
| CN102286617B (en) | Real-time fluorescence quantitative polymerase chain reaction (PCR) kit for incorporeity and rickettsia | |
| CN101550452B (en) | Human bocavirus real-time fluorescence PCR detection reagent kit | |
| CN103789442B (en) | A kind of FRET-PCR in real time and nest-type PRC detect and the rickettsial primer of somatotype, probe and test kit | |
| Husin et al. | Current tools for the diagnosis and detection of spotted fever group Rickettsia | |
| Gupta et al. | Single-step PCR for detection of Brucella melitensis from tissue and blood of goats | |
| Zhang et al. | Studies on bluetongue disease in the People’s Republic of China | |
| CN106434994A (en) | Rapid detecting mycoplasma ovipneumoniae method | |
| Kamusoko et al. | Purification and amplification of DNA from cellulolytic bacteria: Application for biogas production from crop residues | |
| Makgabo et al. | Unravelling the diversity of Anaplasma species circulating in selected African wildlife hosts by targeted 16S microbiome analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150819 Termination date: 20180224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |