CN103789416A

CN103789416A - Method and oligonucleotide for detecting FGFR3 gene G380R site mutation

Info

Publication number: CN103789416A
Application number: CN201410006046.4A
Authority: CN
Inventors: 徐建成; 孙翠莲
Original assignee: HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Current assignee: HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Priority date: 2014-01-04
Filing date: 2014-01-04
Publication date: 2014-05-14
Anticipated expiration: 2034-01-04
Also published as: CN103789416B

Abstract

The invention discloses a method and oligonucleotide for detecting FGFR3 gene G380R site mutation, and relates to a pair of specific amplification primers SEQ NO 1 and SEQ NO 2, and a pair of specific detection probes SEQ NO 3 and SEQ NO 4. By adopting the method and oligonucleotide, congenital achondroplasia can be rapidly diagnosed and identified, and the method and oligonucleotide have the advantages of being short in detection cycle, good in specificity, high in accuracy, high in sensitivity, less in condition dependence, low in pollution risk and the like.

Description

Detect method and the oligonucleotide of FGFR3 G380R site mutation

Technical field

The invention belongs to detection in Gene Mutation field, be specifically related to a kind of method and oligonucleotide that detects with sensitivity gene FGFR3G380R site mutation.

Background technology

Fibroblast growth factor receptor3 (FGFR3) belongs to fibroblast growth factor acceptor (fibroblast growth factor receptors, FGFRs) family, be a kind of transmembrane protein that regulates the functions such as growth that has, in skeleton development, play an important role.The FGFR3 assignment of genes gene mapping, in human chromosomal 4p1613, containing 806 amino-acid residues, is a kind of tyrosine kinase receptor, by 1, the outer ligand binding domain of glycosylation modified born of the same parents, 1 hydrophobic transmembrane and 1 kinase catalytic district of intracellular tyrosine occurs and forms.FGFR3 gene is about 1615kb, has 19 exons and 18 introns, wherein exon10 coding FGFR3 cross-film district.

Fetal rickets (achondroplasia, ACH) be heredity disease of skeletal system more common in the short and small deformity of four limbs, be autosomal dominant inheritance, penetrance 100%, patient's outstanding behaviours is growth and the ripe dysplasia of chondroblast, causes entochondrostosis to be obstructed.Achondroplastic Clinical symptoms is: bone growth and development is abnormal, thereby causes short-and slight in figure, a large and distinctive facies of upper and lower extremities cripetura.Achondroplastic gene was defined in karyomit(e) 4p1613 in 1994, in the near future determine again it is the FGFR3 transgenation of heterozygosis.Nearly all achondroplastic patient has identical amino acid to replace in the cross-film district of FGFR3 sudden change.1994, Rousseau etc. by the generation the ACH family of 17 routine sporadic cases and 6 routine consanguinity-less relations being carried out to DNA analysis and confirmed this disease just because of the 1138th origination point sudden change G>A of FGFR3 gene extron 10, be 1138G>A, and cause its coded albumen that Gly380Arg sudden change occurs.FGFR3 Protein G ly380Arg sudden change may be the basic activation of inducing acceptor by stablizing ligand-mediated dimer process, thereby extends cell surface signal, and FGFR3 signal strengthens the extra-inhibitory that causes bone lengthening.

Research discovery, 97% ACH patient causes Gly380Arg sudden change because 1138G>A sudden change occurs FGFR3 gene extron 10.It is rare that a kind of sudden change of Nucleotide and a kind of inherited disease exist so high correlation it very, and therefore, whether we can suddenly change to diagnose and differential diagnosis ACH by detecting 38 Nucleotide of FGFR3 gene 11.Also there are some researches show, the congenital fetal rickets infant that more than 80% carries this sudden change is fresh mutation simultaneously, and its father and mother's gene test is normal.Molecular biology research is verified, and this is sick relevant with father's age, and all neomorphs all occur in father's allelotrope, and this shows to utilize selectively this Disease-causing gene to suddenly change in male sex's clone.Therefore it is also extremely valuable aspect antenatal diagnosis to detect FGFR3 gene G380R.

At present, the clinical method for detection FGFR3G380R site mutation type is generally traditional DNA sequencing and real-time fluorescence quantitative PCR.But traditional DNA sequencing method is as Sanger order-checking and tetra-sodium order-checking, and sense cycle is longer, and complicated operation easily pollutes, and sequencing equipment costliness, and common laboratory is difficult to configuration.And real-time fluorescence quantitative PCR has higher sensitivity and specificity, and can carry out real-time online detection to PCR, the initial content of reflection goal gene FGFR3 in sample, not only can save a large amount of detection times, has also avoided the generation of carryover contamination.Common real time fluorescence quantifying PCR method has SYBR Green I dye method, double cross probe method, Taqman probe method, MGB probe method and molecular beacon method etc.Wherein SYBR Green I is owing to being non-saturable dye, specificity is not as double cross probe method and Taqman probe method, and must judge its specificity by observing solubility curve, in addition can not identify specific double chain DNA sequence, as long as double chain DNA sequence will be in conjunction with luminous, therefore background is higher conventionally, may have false positive and produce while use clinically.Double cross probe method relates to two and masterplate complementation and adjacent specific probe (apart from 1-5bp), upstream probe 3' end mark donor fluorophor, the 5' end mark Red640 acceptor fluorescence group of adjacent downstream probe, cost is comparatively expensive.Molecular beacon method relates to a kind of stem ring double-tagging oligonucleotide probe that is hairpin structure, the nucleic acid array complementation pairing at these probe two ends, the fluorophor that is marked at one end is tightly close with the quenching group that is marked at the other end, when the disadvantage of the method is to hybridize, probe can not be fully combined with template, therefore less stable, the in addition synthetic tense marker process more complicated of probe.Taqman probe method relates to the gene-specific probe (long 20-30bp conventionally) of and masterplate complementation, the 5' end of probe and 3' end respectively mark one report fluorophor and a cancellation fluorophor, but the probe sequence in the method is long, and to make to be positioned at report fluorophor and the cancellation fluorophor at probe two ends distant, thereby cause fluorescent quenching not thorough, and quenching group also can produce the fluorescence of different wave length, this all can make background higher.

Summary of the invention

In order to overcome the deficiency of traditional DNA sequencing method and SYBR Green I dye method, double cross probe method, Taqman probe method and molecular beacon method, the present invention adopts MGB probe method to carry out FGFR3G380R site mutation type and detects, G380R site mutation to FGFR3 gene detects, thereby reaches accurately and rapidly congenital achondroplastic diagnosis and differential diagnosis.

The invention provides the oligonucleotide for detection of FGFR3 gene G380R site mutation in sample, described oligonucleotide comprises:

(1) a pair of specific amplified production SEQ NO1 and SEQ NO2, its base sequence is:

SEQ NO1：GGGTTTTCTCATCACTCTGCG

SEQ NO2：AGTGTGTATGCAGGCATCCT

(2) a pair of specific detection probes SEQ NO3 and SEQ NO4, its base sequence is:

SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。

Further, the working concentration of described amplimer ratio is: SEQ NO1:SEQ NO2=1:1.

Further, the working concentration of described detection probes ratio is: SEQ NO3:SEQ NO4=1:1.

Further, the working concentration of described amplimer and described detection probes ratio is: SEQ NO1:SEQ NO2:SEQ NO3:SEQ NO4=2:2:1:1.

Further, the PCR reaction conditions of described amplimer and described detection probes is: 95 ℃ of 5min denaturations; 95 ℃ of 15sec, 62 ℃ of 30sec, 40 circulations.

Further, utilize described amplimer and described detection probes can determine FGFR3 gene G380R site mutation type in sample: not having sudden change, is wild-type; Heterozygous mutant type; Homozygous mutation type.

The present invention also provides a kind of method that detects FGFR3 gene G380R site mutation in sample, comprises the steps:

(1) extract the DNA in sample;

(2) utilize pair for amplification primer SEQ NO1 and SEQ NO2 and a pair of detection probes SEQ NO3 and SEQ NO4 to increase to the DNA in (1), obtain amplification curve;

(3) determine FGFR3 gene G380R site mutation type: if obtain two amplification curves, be heterozygous mutant type; If obtain an amplification curve, judge its mutation type according to corresponding detection probes: in the time that corresponding detection probes is SEQ NO3, not having FGFR3 gene G380R site mutation, is wild-type, in the time that corresponding detection probes is SEQ NO4, it is homozygous mutation type; If do not have amplification curve to produce, need again to detect, wherein,

SEQ NO1：GGGTTTTCTCATCACTCTGCG

SEQ NO2：AGTGTGTATGCAGGCATCCT

SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。

Further, the amplification reaction condition of step (2) is: 95 ℃ of 5min denaturations; 95 ℃ of 15sec, 62 ℃ of 30sec, 40 circulations.

The present invention also provides a kind of test kit that detects FGFR3 gene G380R site mutation in sample, described test kit comprises sample DNA extraction agent, erythrocyte cracked liquid, dehydrated alcohol, qPCR amplification reaction solution, positive reference substance, negative control product and blank product, described qPCR amplification reaction solution comprises pair for amplification primer SEQ NO1 and SEQ NO2 and a pair of detection probes SEQ NO3 and SEQ NO4, it is characterized in that

SEQ NO1：GGGTTTTCTCATCACTCTGCG

SEQ NO2：AGTGTGTATGCAGGCATCCT

SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。

Further, described erythrocyte cracked liquid comprises NH ₄cl, NaHCO ₃, EDTA-Na ₂and ddH ₂o .

Beneficial effect: the present invention increases to goal gene by a pair of specificity amplification primer and MGB probe, condition relies on few, general PCR Lab equipment can meet, very directly perceived to the analysis of result, need not compare complicated order-checking collection of illustrative plates, directly can make and analyze this loci gene type according to amplification curve.Fluorescence quantitative PCR method of the present invention (MGB probe) sense cycle is short, in three hours, can obtain a result, and detection sensitivity improves greatly with respect to DNA sequencing method, use MGB probe can also greatly reduce the interference of background signal, can also greatly stablize the hybridization of probe and template, rising probe Tm value, make shorter probe can reach equally higher Tm value, allow to adopt shorter probe also to simplify design and the cost of probe, meanwhile MGB probe is more satisfactory for allelic differentiation, can detect single base mutation, and there is extraordinary accuracy and specificity.

In addition, traditional DNA sequencing method checks order as Sanger order-checking and tetra-sodium, or can not distinguish exactly genotype, although or can distinguish genotype, relatively wasting time and energy, sense cycle is long.The more important thing is, traditional DNA sequencing method can not be determined the initial copy number of sample different genotype exactly.And the existence that the present invention not only can identify FGFR3 gene G380R site mutation type is soon whether, and judge that rapidly sample is as homozygous mutation type, heterozygous mutant type, or wild-type, but also can determine the initial copy number of different genotype in sample.These detection information contribute to clinician quickly congenital fetal rickets (ACH) to be made to diagnosis and differential diagnosis very much, also can the antenatal diagnosis for ACH by the present invention.

Meanwhile, in view of the present invention utilizes two specific detection probes, both contain different fluorophors, therefore, single tube detection can be carried out, two pipe detections need not be carried out, so just can save sample DNA and detection reagent consumption, thereby reduction testing cost, also reduces the pollution that may suffer in testing process simultaneously, improves detection accuracy.

Accompanying drawing explanation

Fig. 1 is FGFR3 gene exon10 standard sequence.

Fig. 2 is the real-time fluorescence PCR detected result of sample A.

Fig. 3 is the real-time fluorescence PCR detected result of sample B.

Fig. 4 is the real-time fluorescence PCR detected result of sample C.

Fig. 5 is the Sanger sequencer map of sample A.

Fig. 6 is the Sanger sequencer map of sample B.

Fig. 7 is the Sanger sequencer map of sample C.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be noted that, unaccounted normal condition and method in embodiment, conventionally according to the conventional employing method of affiliated field experimenter: for example, Ao Sibai and James Kingston chief editor's " fine works molecular biology experiment guide " the 4th edition, or the step of advising according to manufacturer and condition.

Embodiment 1 detects oligonucleotide and the test kit of FGFR3 gene G380R site mutation

For detection of the oligonucleotide of FGFR3 gene G380R site mutation in sample, described oligonucleotide comprises a pair of specific amplified production SEQ NO1 and SEQ NO2, and its base sequence is:

SEQ NO1：GGGTTTTCTCATCACTCTGCG

SEQ NO2：AGTGTGTATGCAGGCATCCT，

And a pair of specific detection probes SEQ NO3 and SEQ NO4, its base sequence is:

SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB

Wherein SEQ NO3 and SEQ NO4 3 ' end mark MGB, for strengthening detection specificity.

A kind of test kit that detects FGFR3 gene G380R site mutation in sample, described test kit comprises sample DNA extraction agent, erythrocyte cracked liquid, dehydrated alcohol, qPCR amplification reaction solution, positive reference substance, negative control product and blank product, shown in specific as follows

10 × erythrocyte splitting liquid formula is: NH ₄cl82g, NaHCO ₃8.4g, EDTA-Na ₂3.72g, adds ddH ₂o is settled to 1000ml.

QPCR amplification reaction solution: THUNDERBIRD qPCR Mix12.5ul, pair for amplification primer SEQ NO1 and the each 0.8ul of SEQ NO2, a pair of detection probes SEQ NO3 and the each 0.4ul of SEQ NO4, ddH ₂o8.1ul, wherein,

SEQ NO1：GGGTTTTCTCATCACTCTGCG

SEQ NO2：AGTGTGTATGCAGGCATCCT，

SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。

Positive reference substance: the solution that contains FGFR3 gene G380R mutant nucleotide sequence.

Negative control product: the solution that does not contain FGFR3 gene order.

Blank product: 2 μ l physiological saline or do not add any material.

Embodiment 2: testing process

(1) blood DNA extracts: get 500ul whole blood, put in the centrifuge tube of 1.5ml, add 1ml erythrocyte cracked liquid.Spin upside down, make to mix completely, it is centrifugal that rotary pulse was put into whizzer after 15 seconds, and centrifugation rate is 5000rpm, 10min.Outwell upper strata liquid, color precipitation is arranged at visible centrifuge tube bottom.Add 500ul erythrocyte cracked liquid, repeat this cleavage step once.Centrifugal 5000rpm, 5min, finally discard with transfer pipet all upper stratas liquid that exhausts, so that the color precipitation of centrifuge tube bottom no longer remains lysate, in precipitation, add 60ul nucleic acid extraction liquid (piping and druming repeatedly before getting), mix with rifle head, 100 ℃ of metal baths 10 minutes, 12000rpm, 5min, get supernatant, obtain sample DNA solution.In the time not using immediately, sample DNA solution is preserved stand-by at-20 ℃.

(2) real-time fluorescence PCR amplification:

The qPCR amplification reaction solution of sample DNA is 25ul:THUNDERBIRD qPCR Mix12.5ul, pair for amplification primer SEQ NO1 and the each 0.8ul of SEQ NO2, a pair of detection probes SEQ NO3 and the each 0.4ul of SEQ NO4, ddH ₂o8.1ul.Specific configuration is as shown in the table.

Real-time fluorescence PCR amplification reaction condition: 95 ℃ of 5min denaturations; 95 ℃ of 15sec, 62 ℃ of 30sec, 40 circulations, after reaction finishes, obtain amplification curve.

Determine FGFR3 gene G380R site mutation type according to obtained amplification curve: if obtain two amplification curves, be heterozygous mutant type, i.e. Gly/Arg type; If obtain an amplification curve, judge its mutation type according to corresponding detection probes: in the time that corresponding detection probes is SEQ NO3, not having FGFR3 gene G380R site mutation, is wild-type, i.e. Gly/Gly type; In the time that corresponding detection probes is SEQ NO4, be homozygous mutation type, i.e. Arg/Arg type; If do not have amplification curve to produce, need again to detect.

Embodiment 3: sample detection checking

Choose clinical sample 7 examples, numbering 1-7, wherein sample 1-5 is that clinical diagnosis is ACH patient, and sample 6 is from No. 5 wives patient, and No. 5 wife patient does not suffer from ACH, and conceived 20 weeks, sample 7 was No. 5 wives' patient amniotic fluid.Implementation step is as follows:

(1) 1-6 sample is peripheral blood, according to blood DNA extraction method described in embodiment 2, extracts DNA, and No. 7 sample uses the QIAamp DNA extraction test kit of QIAGEN company to extract chorion cast-off cells DNA in amniotic fluid.

(2) according to real-time fluorescence PCR amplification method described in embodiment 2,1-7 sample DNA is carried out to real-time fluorescence PCR detection, this 7 routine sample F GFR3 gene exon10 is carried out to Sanger sequencing analysis simultaneously.Real-time fluorescence PCR (qPCR) detected result and Sanger sequencing analysis result are as shown in the table:

From result in table, detected result of the present invention and Sanger sequencing result are in full accord, also conform to clinical diagnosis result.Wherein c.1138G>A No. 7 sample result prompting fetuses carry Disease-causing gene, carry out subsequently B ultrasonic detection and find that fetus biparietal diameter value is on the low side, with pregnant Zhou Bufu, further be diagnosed as ACH, suggestion induced labor under physician guidance, family members agree to, induced labor smoothly.This has confirmed accuracy of the present invention and specificity more, also shows to utilize the present invention to detect simultaneously, can carry out as soon as possible disease prevention.

Embodiment 4: sample detection checking

Get clinical blood sample 3 examples, i.e. sample A, B and C, extracts DNA and carries out real-time fluorescence PCR detection according to the method in embodiment 2.

FGFR3 gene exon10 standard sequence as shown in Figure 1, Far Left base (G) in three bases that wherein indicate with square frame is corresponding to the 1138th site in FGFR3 gene order, in the time that this bases G sports A (c.1138G>A), there is G380R sudden change in the albumen of this coded by said gene, albumen the 380th amino-acid residue sports arginine (Arg) by glycine (Gly).

For sample A, as shown in Figure 2, owing to only producing an amplification curve, and corresponding detection probes is SEQ NO3 to its real-time fluorescence PCR detected result, and therefore sample A is wild-type, i.e. Gly/Gly type.The Sanger sequencing result of sample A as shown in Figure 5 simultaneously.

For sample B, as shown in Figure 3, owing to only producing an amplification curve, and corresponding detection probes is SEQ NO4 to its real-time fluorescence PCR detected result, and therefore B sample is homozygous mutation type, i.e. Arg/Arg type.The Sanger sequencing result of sample B as shown in Figure 6 simultaneously.

For sample C, as shown in Figure 4, owing to producing two amplification curves, therefore C sample is heterozygous mutant type to its real-time fluorescence PCR detected result, i.e. Gly/Arg type.The Sanger sequencing result of sample C as shown in Figure 7 simultaneously.

Sequence in standard sequence in Fig. 1 and Fig. 5, Fig. 6 and Fig. 7 is compared, and the real-time fluorescence PCR detected result that known the present invention adopts is consistent with Sanger sequencing analysis result.This has verified accuracy and the specificity of detected result of the present invention again.

SEQUENCE LISTING

Ai Dikang medical test center, <110> Hangzhou company limited

<120> detects method and the oligonucleotide of FGFR3 G380R site mutation

<130>

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> artificial sequence

<400> 1

gggttttctc atcactctgc g 21

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

agtgtgtatg caggcatcct 20

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

aagaagccca ccccgtagct 20

<210> 4

<211> 20

<212> DNA

<213> artificial sequence

<400> 4

aagaagccca ccctgtagct 20

Claims

1. for detection of the oligonucleotide of FGFR3 gene G380R site mutation in sample, it is characterized in that, described oligonucleotide comprises:

(1) a pair of specific amplified production SEQ NO 1 and SEQ NO 2, its base sequence is:

SEQ NO 1：GGGTTTTCTCATCACTCTGCG

SEQ NO 2：AGTGTGTATGCAGGCATCCT

(2) a pair of specific detection probes SEQ NO 3 and SEQ NO 4, its base sequence is:

SEQ NO 3：FAM- AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO 4：HEX- AAGAAGCCCACCCTGTAGCT-MGB。

2. oligonucleotide as claimed in claim 1, is characterized in that, the working concentration ratio of described amplimer is:

SEQ NO 1: SEQ NO 2=1:1。

3. oligonucleotide as claimed in claim 1, is characterized in that, the working concentration ratio of described detection probes is:

SEQ NO 3: SEQ NO 4=1:1。

4. oligonucleotide as claimed in claim 1, is characterized in that, the working concentration ratio of described amplimer and described detection probes is:

SEQ NO 1: SEQ NO 2: SEQ NO 3 : SEQ NO 4=2:2:1:1。

5. oligonucleotide as claimed in claim 1, is characterized in that, the PCR reaction conditions of described amplimer and described detection probes is: 95 ℃ of 5min denaturations; 95 ℃ of 15sec, 62 ℃ of 30sec, 40 circulations.

6. oligonucleotide as claimed in claim 1, is characterized in that, utilizes described amplimer and described detection probes can determine FGFR3 gene G380R site mutation type in sample: not having sudden change, is wild-type; Heterozygous mutant type; Homozygous mutation type.

7. a method that detects FGFR3 gene G380R site mutation in sample, comprises the steps:

(1) extract the DNA in sample;

(2) utilize pair for amplification primer SEQ NO 1 and SEQ NO 2 and a pair of detection probes SEQ NO 3 and SEQ NO 4 to increase to the DNA in (1), obtain amplification curve;

(3) determine FGFR3 gene G380R site mutation type: if obtain two amplification curves, be heterozygous mutant type; If obtain an amplification curve, judge its mutation type according to corresponding detection probes: in the time that corresponding detection probes is SEQ NO 3, not having FGFR3 gene G380R site mutation, is wild-type, in the time that corresponding detection probes is SEQ NO 4, it is homozygous mutation type; If do not have amplification curve to produce, need again to detect, it is characterized in that,

SEQ NO 1：GGGTTTTCTCATCACTCTGCG

SEQ NO 2：AGTGTGTATGCAGGCATCCT

SEQ NO 3：FAM- AAGAAGCCCACCCCGTAGCT-MGB

SEQ NO 4：HEX- AAGAAGCCCACCCTGTAGCT-MGB。

8. method as claimed in claim 7, is characterized in that, the amplification reaction condition of step (2) is: 95 ℃ of 5min denaturations; 95 ℃ of 15sec, 62 ℃ of 30sec, 40 circulations.