CN103789416B - Detect method and the oligonucleotide of FGFR3 G380R site mutation - Google Patents

Detect method and the oligonucleotide of FGFR3 G380R site mutation Download PDF

Info

Publication number
CN103789416B
CN103789416B CN201410006046.4A CN201410006046A CN103789416B CN 103789416 B CN103789416 B CN 103789416B CN 201410006046 A CN201410006046 A CN 201410006046A CN 103789416 B CN103789416 B CN 103789416B
Authority
CN
China
Prior art keywords
seq
pair
sample
detection probes
oligonucleolide primers
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410006046.4A
Other languages
Chinese (zh)
Other versions
CN103789416A (en
Inventor
徐建成
孙翠莲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Original Assignee
HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd filed Critical HANGZHOU ADICON CLINICAL LABORATORY CENTER Co Ltd
Priority to CN201410006046.4A priority Critical patent/CN103789416B/en
Publication of CN103789416A publication Critical patent/CN103789416A/en
Application granted granted Critical
Publication of CN103789416B publication Critical patent/CN103789416B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of method and the oligonucleotide that detect FGFR3 gene G380R site mutation with sensitivity, they all relate to a pair specificity amplification primer SEQ NO 1 and SEQ NO 2, and a pair specificity detection probe SEQ NO 3 and SEQ NO 4.The present invention can diagnose rapidly and differentiate Congenital Human Cytomegalovirus infection, has sense cycle short, and specificity is good, and accuracy is high, highly sensitive, and condition relies on few, the advantages such as Pollution risk is low.

Description

Detect method and the oligonucleotide of FGFR3 G380R site mutation
Technical field
The invention belongs to detection in Gene Mutation field, be specifically related to a kind of method and the oligonucleotide that detect gene FGFR3G380R site mutation with sensitivity.
Background technology
Fibroblast growth factor receptor3 (FGFR3) belongs to fibroblast growth factor acceptor (fibroblast growth factor receptors, FGFRs) family, be a kind of transmembrane protein with functions such as adjustment growths, play an important role in skeleton development.The FGFR3 assignment of genes gene mapping, in human chromosomal 4p1613, containing 806 amino-acid residues, is a kind of tyrosine kinase receptor, by 1, the outer ligand binding domain of glycosylation modified born of the same parents, 1 hydrophobic transmembrane and 1 intracellular tyrosine kinase catalytic domain occurs and forms.FGFR3 gene is about 1615kb, has 19 exons and 18 introns, wherein exon10 coding FGFR3 cross-film district.
Fetal rickets (achondroplasia, ACH) be heredity disease of skeletal system more common in the short and small deformity of four limbs, in autosomal dominant inheritance, penetrance 100%, patient's outstanding behaviours is the growth of chondroblast and ripe dysplasia, causes entochondrostosis to be obstructed.Achondroplastic Clinical symptoms is: bone growth and development is abnormal, thus causes the large and distinctive facies of the short-and slight in figure of upper and lower extremities cripetura, head.Achondroplastic gene was defined in karyomit(e) 4p1613 in 1994, in the near future determined again it is the FGFR3 transgenation of heterozygosis.Nearly all achondroplastic patient has identical amino acid to replace in the cross-film district that FGFR3 suddenlys change.1994, by carrying out DNA analysis to the ACH family of 17 routine sporadic cases and 6 routine consanguinity-less relations, Rousseau etc. confirm that the generation of this disease is just because of FGFR3 gene extron 10 the 1138th origination point sudden change G>A, i.e. 1138G>A, and cause the albumen coded by it that Gly380Arg sudden change occurs.FGFR3 Protein G ly380Arg sudden change may be the basic activation carrying out inducing receptor by stablizing ligand-mediated dimer process, thus extends cell-surface signal, and FGFR3 signal strengthens the extra-inhibitory causing bone lengthening.
Research finds, the ACH patient of 97% causes Gly380Arg to suddenly change because 1138G>A sudden change occurs FGFR3 gene extron 10.It is very rare to there is so high dependency in a kind of sudden change of Nucleotide and a kind of inherited disease, and therefore, whether we can be suddenlyd change by detection FGFR3 gene 11 38 Nucleotide is diagnosed and differential diagnosis ACH.Also there are some researches show, more than the 80% Congenital Human Cytomegalovirus infection infant carrying this sudden change is fresh mutation, and its father and mother's gene test is normal simultaneously.Molecular biology research has confirmed that this is sick relevant with the age of father, and all neomorphs all occur in the allelotrope of father, and this shows in male cells system, utilize this Disease-causing gene to suddenly change selectively.Therefore it is also extremely valuable in antenatal diagnosis to detect FGFR3 gene G380R.
At present, the clinical method for detecting FGFR3G380R site mutation type is generally traditional DNA sequencing and real-time fluorescence quantitative PCR.But traditional DNA sequencing method is as Sanger order-checking and Manganic pyrophosphate complex initiation, and sense cycle is longer, complicated operation, easily pollutes, and sequencing equipment is expensive, and common laboratory is difficult to configuration.And real-time fluorescence quantitative PCR has higher sensitivity and specificity, and can carry out real-time online detection to PCR, reflection goal gene FGFR3 initial content in the sample to which, can not only save a large amount of detection times, also avoid the generation of carryover contamination.Common real time fluorescence quantifying PCR method has SYBR Green I dye method, double cross probe method, Taqman probe method, MGB probe method and molecular beacon method etc.Wherein SYBR Green I is owing to being non-saturable dye, specificity is not as double cross probe method and Taqman probe method, and its specificity must be judged by observing solubility curve, in addition specific double chain DNA sequence can not be identified, as long as double chain DNA sequence will in conjunction with luminescence, therefore background is higher usually, may have false positive and produce when using clinically.Double cross probe method relates to the complementary and adjacent specific probes (distance 1-5bp) of two and masterplate, upstream probe 3' end mark donor fluorophore, the 5' end of adjacent downstream probe marks Red640 acceptor fluorophore, and cost is costly.Molecular beacon method relates to a kind of stem ring double-tagging oligonucleotide probe in hairpin structure, the nucleic acid array complementation pairing at these probe two ends, the fluorophor being marked at one end is tightly close with the quenching group being marked at the other end, when the disadvantage of the method is to hybridize, probe can not fully be combined with template, therefore less stable, in addition probe synthesis tense marker process more complicated.Taqman probe method relates to the gene-specific probe (usual long 20-30bp) of and masterplate complementation, 5' end and the 3' end of probe marked a reporter fluorescence group and a quenching fluorescence group respectively, but the probe sequence in the method is longer make to be positioned at the reporter fluorescence group at probe two ends and quenching fluorescence group distant, thus cause fluorescent quenching not thorough, and quenching group also can produce the fluorescence of different wave length, this all can make background higher.
Summary of the invention
In order to overcome the deficiency of traditional DNA sequencing method and SYBR Green I dye method, double cross probe method, Taqman probe method and molecular beacon method, the present invention adopts MGB probe method to carry out FGFR3G380R site mutation type and detects, the G380R site mutation of FGFR3 gene is detected, thus reaches the diagnosis and differential diagnosis to Congenital Human Cytomegalovirus infection accurately and rapidly.
The invention provides the oligonucleotide for detecting FGFR3 gene G380R site mutation in sample, described oligonucleotide comprises:
(1) a pair specific amplified production SEQ NO1 and SEQ NO2, its base sequence is:
SEQ NO1：GGGTTTTCTCATCACTCTGCG
SEQ NO2：AGTGTGTATGCAGGCATCCT
(2) a pair specific detection probes SEQ NO3 and SEQ NO4, its base sequence is:
SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。
Further, the working concentration ratio of described amplimer is: SEQ NO1:SEQ NO2=1:1.
Further, the working concentration ratio of described detection probes is: SEQ NO3:SEQ NO4=1:1.
Further, the working concentration ratio of described amplimer and described detection probes is: SEQ NO1:SEQ NO2:SEQ NO3:SEQ NO4=2:2:1:1.
Further, the PCR reaction conditions of described amplimer and described detection probes is: 95 DEG C of 5min denaturations; 95 DEG C of 15sec, 62 DEG C of 30sec, 40 circulations.
Further, described amplimer and described detection probes is utilized can to determine FGFR3 gene G380R site mutation type in sample: there is not sudden change, is wild-type; Heterozygous mutant; Homozygous mutant.
The present invention also provides a kind of method detecting FGFR3 gene G380R site mutation in sample, comprises the steps:
(1) DNA in sample is extracted;
(2) utilize pair for amplification primer SEQ NO1 and SEQ NO2 and a pair detection probes SEQ NO3 and SEQ NO4 to increase to the DNA in (1), obtain amplification curve;
(3) FGFR3 gene G380R site mutation type is determined: if obtain two amplification curves, be then heterozygous mutant; If obtain an amplification curve, judge its mutation type according to corresponding detection probes: when the detection probes of correspondence is SEQ NO3, then there is not FGFR3 gene G380R site mutation, is wild-type, when the detection probes of correspondence is SEQ NO4, then it is homozygous mutant; If do not have amplification curve to produce, then need again to detect, wherein,
SEQ NO1：GGGTTTTCTCATCACTCTGCG
SEQ NO2：AGTGTGTATGCAGGCATCCT
SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。
Further, the amplification reaction condition of step (2) is: 95 DEG C of 5min denaturations; 95 DEG C of 15sec, 62 DEG C of 30sec, 40 circulations.
The present invention also provides a kind of test kit detecting FGFR3 gene G380R site mutation in sample, described test kit comprises sample DNA extraction agent, erythrocyte cracked liquid, dehydrated alcohol, qPCR amplification reaction solution, positive reference substance, negative controls and blank product, described qPCR amplification reaction solution comprises pair for amplification primer SEQ NO1 and SEQ NO2 and a pair detection probes SEQ NO3 and SEQ NO4, it is characterized in that
SEQ NO1：GGGTTTTCTCATCACTCTGCG
SEQ NO2：AGTGTGTATGCAGGCATCCT
SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。
Further, described erythrocyte cracked liquid comprises NH 4cl, NaHCO 3, EDTA-Na 2and ddH 2o .
Beneficial effect: the present invention is increased to goal gene by a pair specificity amplification primer and MGB probe, condition relies on few, general PCR Lab equipment can meet, very directly perceived to the analysis of result, without the Sequencing chromatogram of comparison complexity, directly can make according to amplification curve and analyze this loci gene type.Fluorescence quantitative PCR method of the present invention (MGB probe) sense cycle is short, can obtain a result in three hours, and greatly improve relative to detection sensitivity DNA sequencing method, use MGB probe greatly can also reduce the interference of background signal, greatly can also stablize the hybridization of probe and template, raise probe Tm value, make the Tm value that shorter probe can reach higher equally, allow to adopt shorter probe to also simplify design and the cost of probe, meanwhile MGB probe is more satisfactory for allelic differentiation, single base mutation can be detected, and there is extraordinary accuracy and specificity.
In addition, traditional DNA sequencing method as Sanger order-checking and Manganic pyrophosphate complex initiation, or can not distinguish genotype exactly, although or can genotype be distinguished, compare and waste time and energy, sense cycle is long.The more important thing is, traditional DNA sequencing method can not determine the initial copy number of sample different genotype exactly.And whether the present invention not only can identify the existence of FGFR3 gene G380R site mutation type soon, and judge that sample is as homozygous mutant rapidly, heterozygous mutant, or wild-type, but also different genotype initial copy number in the sample to which can be determined.These Detection Information contribute to clinician and make diagnosis and differential diagnosis to Congenital Human Cytomegalovirus infection (ACH) quickly very much, also the present invention can be used for the antenatal diagnosis of ACH.
Meanwhile, in view of the present invention utilizes two specific detection probes, both are containing different fluorophors, therefore, can single tube detection be carried out, two pipe detections need not be carried out, so just can save sample DNA and detection reagent consumption, thus reduction testing cost, also reduce the pollution that may suffer in testing process simultaneously, improve detection accuracy.
Accompanying drawing explanation
Fig. 1 is FGFR3 gene exon10 standard sequence.
Fig. 2 is the real-time PCR detection result of sample A.
Fig. 3 is the real-time PCR detection result of sample B.
Fig. 4 is the real-time PCR detection result of sample C.
Fig. 5 is the Sanger sequencer map of sample A.
Fig. 6 is the Sanger sequencer map of sample B.
Fig. 7 is the Sanger sequencer map of sample C.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be noted that, unaccounted normal condition and method in embodiment, usually according to the conventional employing method of affiliated field experimenter: such as, " the fine works molecular biology experiment guide " the 4th edition of Ao Sibai and James Kingston chief editor, or the step of advising according to manufacturer and condition.
Embodiment 1 detects oligonucleotide and the test kit of FGFR3 gene G380R site mutation
For detecting the oligonucleotide of FGFR3 gene G380R site mutation in sample, described oligonucleotide comprises a pair specific amplified production SEQ NO1 and SEQ NO2, and its base sequence is:
SEQ NO1：GGGTTTTCTCATCACTCTGCG
SEQ NO2：AGTGTGTATGCAGGCATCCT，
And a pair specific detection probes SEQ NO3 and SEQ NO4, its base sequence is:
SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB
Wherein marked MGB, for strengthening detection specificity at the 3 ' end of SEQ NO3 and SEQ NO4.
A kind of test kit detecting FGFR3 gene G380R site mutation in sample, described test kit comprises sample DNA extraction agent, erythrocyte cracked liquid, dehydrated alcohol, qPCR amplification reaction solution, positive reference substance, negative controls and blank product, shown in specific as follows
10 × erythrocyte splitting liquid formula is: NH 4cl82g, NaHCO 38.4g, EDTA-Na 23.72g, adds ddH 2o is settled to 1000ml.
QPCR amplification reaction solution: THUNDERBIRD qPCR Mix12.5ul, pair for amplification primer SEQ NO1 and each 0.8ul of SEQ NO2, a pair detection probes SEQ NO3 and SEQ NO4 each 0.4ul, ddH 2o8.1ul, wherein,
SEQ NO1：GGGTTTTCTCATCACTCTGCG
SEQ NO2：AGTGTGTATGCAGGCATCCT，
SEQ NO3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ NO4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。
Positive reference substance: the solution containing FGFR3 gene G380R mutant nucleotide sequence.
Negative controls: the solution not containing FGFR3 gene order.
Blank product: 2 μ l physiological saline or do not add any material.
Embodiment 2: testing process
(1) blood DNA extracts: get 500ul whole blood, put in the centrifuge tube of 1.5ml, add 1ml erythrocyte cracked liquid.Spin upside down, make to mix completely, it is centrifugal that rotary pulse put into whizzer after 15 seconds, and centrifugation rate is 5000rpm, 10min.Outwell upper liquid, bottom visible centrifuge tube, have color to precipitate.Add 500ul erythrocyte cracked liquid, repeat this cleavage step once.Centrifugal 5000rpm, 5min, finally discard by transfer pipet all upper liquid that exhausts, precipitate to make the color bottom centrifuge tube and no longer remain lysate, in precipitation, add 60ul nucleic acid extraction liquid (repeatedly blowing and beating before getting), mix with rifle head, metal bath 100 DEG C 10 minutes, 12000rpm, 5min, get supernatant, obtain sample DNA solution.When not using immediately, sample DNA solution is preserved stand-by at-20 DEG C.
(2) real-time fluorescent PCR amplification:
The qPCR amplification reaction solution of sample DNA is 25ul:THUNDERBIRD qPCR Mix12.5ul, pair for amplification primer SEQ NO1 and each 0.8ul of SEQ NO2, a pair detection probes SEQ NO3 and SEQ NO4 each 0.4ul, ddH 2o8.1ul.Specific configuration is as shown in the table.
Real-time fluorescent PCR amplification reaction conditions: 95 DEG C of 5min denaturations; 95 DEG C of 15sec, 62 DEG C of 30sec, 40 circulations, after reaction terminates, obtain amplification curve.
FGFR3 gene G380R site mutation type is determined: if obtain two amplification curves, be then heterozygous mutant, i.e. Gly/Arg type according to obtained amplification curve; If obtain an amplification curve, judge its mutation type according to corresponding detection probes: when the detection probes of correspondence is SEQ NO3, then there is not FGFR3 gene G380R site mutation, is wild-type, i.e. Gly/Gly type; When the detection probes of correspondence is SEQ NO4, be then homozygous mutant, i.e. Arg/Arg type; If do not have amplification curve to produce, then need again to detect.
Embodiment 3: sample detection is verified
Choose clinical sample 7 example, numbering 1-7, wherein sample 1-5 is clinical diagnosis is ACH patient, and sample 6 is from No. 5 wives patient, and No. 5 wives patient do not suffer from ACH, and conceived 20 weeks, sample 7 was the amniotic fluid of No. 5 wives patient.Implementation step is as follows:
(1) 1-6 sample is peripheral blood, according to blood DNA extraction method described in embodiment 2, extracts DNA, and No. 7 samples use the QIAamp DNA extraction kit of QIAGEN company to extract chorion cast-off cells DNA in amniotic fluid.
(2) according to real-time fluorescent PCR amplification method described in embodiment 2, real-time PCR detection is carried out to 1-7 sample DNA, Sanger sequencing analysis is carried out to this 7 routine sample F GFR3 gene exon10 simultaneously.Real-time fluorescence PCR (qPCR) detected result and Sanger sequencing analysis result as shown in the table:
From table in result, detected result of the present invention and Sanger sequencing result completely the same, also conform to clinical diagnoses.Wherein c.1138G>A No. 7 sample result prompting fetuses carry Disease-causing gene, carry out B ultrasonic detection subsequently and find that fetus biparietal diameter value is on the low side, with pregnant Zhou Bufu, be diagnosed as ACH further, suggestion induced labor under physician guidance, family members agree to, induced labor smoothly.This confirms accuracy of the present invention and specificity more, also shows to utilize the present invention to detect simultaneously, can carry out disease prevention as soon as possible.
Embodiment 4: sample detection is verified
Get clinical blood sample 3 example, i.e. sample A, B and C, extract DNA according to the method in embodiment 2 and carry out real-time PCR detection.
FGFR3 gene exon10 standard sequence as shown in Figure 1, wherein with square frame indicate three bases in Far Left base (G) corresponding to the 1138th site in FGFR3 gene order, when this bases G sports A (namely c.1138G>A), there is G380R sudden change in the albumen of this coded by said gene, namely albumen the 380th amino-acid residue sports arginine (Arg) by glycine (Gly).
For sample A, as shown in Figure 2, owing to only producing an amplification curve, and corresponding detection probes is SEQ NO3 to its real-time fluorescence PCR detected result, and therefore sample A is wild-type, i.e. Gly/Gly type.The Sanger sequencing result of sample A as shown in Figure 5 simultaneously.
For sample B, as shown in Figure 3, owing to only producing an amplification curve, and corresponding detection probes is SEQ NO4 to its real-time fluorescence PCR detected result, and therefore B sample is homozygous mutant, i.e. Arg/Arg type.The Sanger sequencing result of sample B as shown in Figure 6 simultaneously.
For sample C, as shown in Figure 4, owing to producing two amplification curves, therefore C sample is heterozygous mutant to its real-time fluorescence PCR detected result, i.e. Gly/Arg type.The Sanger sequencing result of sample C as shown in Figure 7 simultaneously.
Standard sequence in Fig. 1 and the sequence in Fig. 5, Fig. 6 and Fig. 7 are compared, the real-time PCR detection result that known the present invention adopts is consistent with Sanger sequencing analysis result.This demonstrates accuracy and the specificity of detected result of the present invention again.
SEQUENCE LISTING
 
<110> ADICON Clinical Laboratories, Inc.
 
<120> detects method and the oligonucleotide of FGFR3 G380R site mutation
 
<130>
 
<160> 4
 
<170> PatentIn version 3.3
 
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
 
<400> 1
gggttttctc atcactctgc g 21
 
 
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
 
<400> 2
agtgtgtatg caggcatcct 20
 
 
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
 
<400> 3
aagaagccca ccccgtagct 20
 
 
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
 
<400> 4
aagaagccca ccctgtagct 20
 
 

Claims (8)

1., for detecting the Oligonucleolide primers pair of FGFR3 gene G380R site mutation in sample, it is characterized in that, described Oligonucleolide primers is to comprising:
(1) a pair specific amplimer SEQ ID NO 1 and SEQ ID NO 2, its base sequence is:
SEQ ID NO 1：GGGTTTTCTCATCACTCTGCG
SEQ ID NO 2：AGTGTGTATGCAGGCATCCT
(2) a pair specific detection probes SEQ ID NO 3 and SEQ ID NO 4, its base sequence is:
SEQ ID NO 3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ ID NO 4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。
2. Oligonucleolide primers pair as claimed in claim 1, it is characterized in that, the working concentration ratio of described amplimer is:
SEQ ID NO 1:SEQ ID NO 2＝1:1。
3. Oligonucleolide primers pair as claimed in claim 1, it is characterized in that, the working concentration ratio of described detection probes is:
SEQ ID NO 3:SEQ ID NO 4＝1:1。
4. Oligonucleolide primers pair as claimed in claim 1, it is characterized in that, the working concentration ratio of described amplimer and described detection probes is:
SEQ ID NO 1:SEQ ID NO 2:SEQ ID NO 3:SEQ ID NO 4＝2:2:1:1。
5. Oligonucleolide primers pair as claimed in claim 1, it is characterized in that, the PCR reaction conditions of described amplimer and described detection probes is: 95 DEG C of 5min denaturations; 95 DEG C of 15sec, 62 DEG C of 30sec, 40 circulations.
6. Oligonucleolide primers pair as claimed in claim 1, is characterized in that, utilize described amplimer and described detection probes can determine FGFR3 gene G380R site mutation type in sample: there is not sudden change, is wild-type; Heterozygous mutant; Homozygous mutant.
7. the Oligonucleolide primers for detecting FGFR3 gene G380R site mutation in sample according to claim 1 is to preparing the application on test kit, described test kit comprises sample DNA extraction agent, erythrocyte cracked liquid, dehydrated alcohol, qPCR amplification reaction solution, positive reference substance, negative controls and blank product, described qPCR amplification reaction solution comprises pair for amplification primer SEQ ID NO 1 and SEQ ID NO 2 and a pair detection probes SEQ ID NO 3 and SEQ ID NO 4, it is characterized in that
SEQ ID NO 1：GGGTTTTCTCATCACTCTGCG
SEQ ID NO 2：AGTGTGTATGCAGGCATCCT
SEQ ID NO 3：FAM-AAGAAGCCCACCCCGTAGCT-MGB
SEQ ID NO 4：HEX-AAGAAGCCCACCCTGTAGCT-MGB。
8. apply as claimed in claim 7, it is characterized in that, described erythrocyte cracked liquid comprises NH 4cl, NaHCO 3, EDTA-Na 2and ddH 2o.
CN201410006046.4A 2014-01-04 2014-01-04 Detect method and the oligonucleotide of FGFR3 G380R site mutation Active CN103789416B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410006046.4A CN103789416B (en) 2014-01-04 2014-01-04 Detect method and the oligonucleotide of FGFR3 G380R site mutation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410006046.4A CN103789416B (en) 2014-01-04 2014-01-04 Detect method and the oligonucleotide of FGFR3 G380R site mutation

Publications (2)

Publication Number Publication Date
CN103789416A CN103789416A (en) 2014-05-14
CN103789416B true CN103789416B (en) 2015-09-23

Family

ID=50665468

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410006046.4A Active CN103789416B (en) 2014-01-04 2014-01-04 Detect method and the oligonucleotide of FGFR3 G380R site mutation

Country Status (1)

Country Link
CN (1) CN103789416B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111424081B (en) * 2020-04-13 2023-04-25 广东省妇幼保健院 Primer, probe and kit for detecting achondroplasia FGFR3 gene mutation based on multiplex fluorescence quantitative PCR technology
CN113981075A (en) * 2021-12-17 2022-01-28 北京积水潭医院 Primer, probe composition and kit for detecting FGFR3 gene mutation site related to achondroplasia

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103031364A (en) * 2011-09-30 2013-04-10 广州益善生物技术有限公司 FGFR3 gene mutation detection specific primer and liquid chip

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103031364A (en) * 2011-09-30 2013-04-10 广州益善生物技术有限公司 FGFR3 gene mutation detection specific primer and liquid chip

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
an improved tetra-primer PCR approach for the detection of the FGFR3 G380R mutation responsible for achondroplasia;etlik o et al;《molecular and cellular probes》;20080430;第22卷(第2期);71-75 *
rapid combined genotyping assay for four achondroplasia and hypochondroplasia mutations by real-time pcr with multiple detection probes;schrijver i et al;《genetic testing》;20041231;第8卷(第2期);185-189 *

Also Published As

Publication number Publication date
CN103789416A (en) 2014-05-14

Similar Documents

Publication Publication Date Title
US6235504B1 (en) Methods for identifying genomic equivalent markers and their use in quantitating cells and polynucleotide sequences therein
CN110387421A (en) DNA methylation qPCR kit and application method for lung cancer detection
CN105543408B (en) coronary heart disease early diagnosis marker
CN111662982B (en) Biomarker for early diagnosis and/or recurrence monitoring of brain glioma and application thereof
CN108977544A (en) For identifying kit and its application of gastric cancer and/or polyp of stomach
CN114807124B (en) Primer and probe composition for detecting ALK fusion gene, kit and method
CN112852957B (en) Early diagnosis marker for Hirschmannia and application thereof
CN108559776A (en) A kind of biomarker and its application for sudden weak smart auxiliary diagnosis
CN103614477A (en) Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for diagnosing human spinal muscular atrophy
CN109844139A (en) The determination method of sporadic colorectal cancer initiation potential
CN103789416B (en) Detect method and the oligonucleotide of FGFR3 G380R site mutation
CN109182493A (en) The primer and kit and its detection method of people&#39;s 16p11.2 microdeletion syndrome detection
CN111172273B (en) Primer group, kit and detection method for SMN1 gene detection
CN106906288B (en) Primer and method for detecting leukemia CDX2 gene expression level
CN102517390B (en) Chromosome aneuploidy detection kit based on real-time fluorescent PCR
CN106460047B (en) Method and kit for identifying precancerous colorectal polyps and colorectal cancers
CN111334568A (en) Multiple connection probe amplification probe combination and kit for screening congenital heart disease gene copy number variation and susceptible persons
CN106967810A (en) The method and kit of a kind of detection FGFR3 gene mutation diagnosing bladder cancers
CN110396542A (en) A kind of LncRNA marker and its application in diabetes
CN103789415B (en) Detect method and the oligonucleotide of cftr gene Δ F508 site mutation
CN110387417A (en) The method of target gene methylation level in Diagnosis of Bladder system, reagent combination and detection urine
CN102732618A (en) Kit used for detecting relative expression of AML1-ETO fusion gene
CN110295232A (en) MicroRNA biomarker for colorectal cancer
CN110951857A (en) Digital PCR-based noninvasive prenatal detection method and kit for trisomy 21, 18 and 13 syndromes of fetus
TWI535851B (en) Autosomal dominant polycystic kidney disease (ADPKD) integrated gene detection method and its detection kit, primer group

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant