CN103789293A - Method for producing isoprene by utilizing blue-green algae - Google Patents

Method for producing isoprene by utilizing blue-green algae Download PDF

Info

Publication number
CN103789293A
CN103789293A CN201410076573.2A CN201410076573A CN103789293A CN 103789293 A CN103789293 A CN 103789293A CN 201410076573 A CN201410076573 A CN 201410076573A CN 103789293 A CN103789293 A CN 103789293A
Authority
CN
China
Prior art keywords
isoprene
blue
green algae
idi
fusion rotein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410076573.2A
Other languages
Chinese (zh)
Other versions
CN103789293B (en
Inventor
杨琛
高翔
刘邓
高方
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHANGHAI RESEARCH AND DEVELOPMENT CENTER OF INDUSTRIAL BIOTECHNOLOGY
Original Assignee
SHANGHAI RESEARCH AND DEVELOPMENT CENTER OF INDUSTRIAL BIOTECHNOLOGY
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI RESEARCH AND DEVELOPMENT CENTER OF INDUSTRIAL BIOTECHNOLOGY filed Critical SHANGHAI RESEARCH AND DEVELOPMENT CENTER OF INDUSTRIAL BIOTECHNOLOGY
Priority to CN201410076573.2A priority Critical patent/CN103789293B/en
Publication of CN103789293A publication Critical patent/CN103789293A/en
Application granted granted Critical
Publication of CN103789293B publication Critical patent/CN103789293B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/03027—Isoprene synthase (4.2.3.27)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/03—Intramolecular oxidoreductases (5.3) transposing C=C bonds (5.3.3)
    • C12Y503/03002—Isopentenyl-diphosphate DELTA-isomerase (5.3.3.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Abstract

The invention discloses a method for producing isoprene by utilizing blue-green algae. The method adopts fusion protein containing prenyl pyrophosphoric acid isomerase and isoprene synthetase. The blue-green algae is subjected to genetic modification, the isoprene synthetase (IspS) of a plant origin is expressed in the blue-green algae, and the isoprene yield by utilizing the genetic engineering blue-green algae is remarkably improved by adopting various methods. In addition, research results can be further applied to other foreign protein expressed by the genetic engineering blue-green algae, an application range of the genetic engineering blue-green algae is greatly widened, and the method has wide industrial application prospect.

Description

Utilize blue-green algae to produce isoprene
The application is the divisional application of application number 201310128943.8, on 04 15th, 2013 applying date, the invention and created name application for a patent for invention that " utilizes blue-green algae to produce isoprene ".
Technical field
The invention belongs to genetically engineered field, specifically, relate to the method for utilizing blue-green algae to produce isoprene.
Background technology
Isoprene is important large basic material, is mainly used in synthetic polyisoprene rubber, for manufacturing tire.Simultaneously for the production of multiple fine chemical products such as Sulcatone, lavandula angustifolia alcohol.Photoetching rubber and the ucon oil additive etc. also used for the production of unicircuit.In addition, nearest research shows that isoprene can also change into biofuel, as aviation fuel.
At present, industrial isoprene is mainly used petroleum base raw material production, utilizes solvent extraction distillation method to separate the C 5 fraction in oil refining by product.This preparation method's expense purity high and isoprene is low, along with rising steadily of the worsening shortages of fossil resource, oil price, estimates that the production and supply of isoprene will be restricted, cost will further improve.Also have by chemosynthesis isoprene, as acetone and ethylene reaction, propylene polymerization etc., but it is low to be faced with equally efficiency, and purity is low, the problem that cost is high.On the other hand, along with the development of world economy, the demand of tire constantly increases, and natural rubber production because the reasons such as plantation land limited, disease and pest are restricted, cause the demand of isoprene to present rapid growth.Therefore, in the urgent need to developing a kind of high purity, isoprene manufacturing technology cheaply.
Isoprene is the compositing monomer of miscellaneous terpenoid.The biosynthetic pathway of the isoprene of finding at present has two (Fig. 1): (1) mevalonic acid (MVA) approach, take three acetyl-CoA molecules as raw material, form mevalonic acid, then pass through pyrophosphorylation, decarboxylation is synthesized prenyl tetra-sodium (IPP), pass through isomery again, form dimethyl allyl tetra-sodium (DMAPP), DMAPP is Isoprene under the effect of isoprenoid synthase (isoprene synthease).(2) phosphoric acid methyl erythrose (MEP) approach, take pyruvic acid and glyceraldehyde 3-phosphate as raw material, form deoxy-D-xylulose sugar-5-phosphoric acid, reduction isomery generates methyl E4P (MEP), then generate methylol butylene-4-phosphoric acid (HMDPP) through a series of reaction, under the effect of HMDPP reductase enzyme, generate IPP and DMAPP, DMAPP is Isoprene under the effect of isoprenoid synthase simultaneously again.
Only there is at present isoprenoid synthase gene (ispS) cloning and identification of plant origin out, respectively from willow (Populus alba; Populus tremloides) (Mliter et.al.Planta2001213:483-487; Sasaki et.al.FEBS Letters579 (2005) 2514-2518) and kudzu (Kudzu) (Sharkey et.al.Plant Physiology137 (2005) 700-712).Plant (as heat stress etc.) under certain environmental conditions can discharge isoprene, but it is very difficult to collect the isoprene of Plant emission, and efficiency is low, and plant-growth is slow, so can not satisfy the demands far away.
Along with developing rapidly that metabolic engineering and synthesising biological learn a skill, utilize Production by Microorganism Fermentation terpenoid to make substantial progress in recent years.Genencor company of the U.S., by genetic modification e. coli bl21 (E.coli BL21), obtains high yield isoprene engineering bacteria.Specifically, in intestinal bacteria, import the isoprenoid synthase (IspS) that improved willow is originated, and then import the MVA approach of external source and cross expression phosphogluconolactonase, finally by the optimization of fermentation condition, make the output of isoprene reach 60g/L.But Escherichia coli fermentation method is synthesized isoprene, need to consume a large amount of grape sugar and starches.
The photosynthetic microorganisms such as blue-green algae can be by the CO in photosynthesis fixed air 2, faster growing in bioreactor.Therefore genetic engineering modified by blue-green algae is carried out, by CO 2direct bioconversion is isoprene, not only can reduce substrate cost, can also reduce CO 2discharge, thereby have important practical significance.Melis et.al. first in poly-born of the same parents algae (Synechocystis) successful expression the isoprenoid synthase in kudzu source, and synthesizing of isoprene detected, but output (50 μ g/L) is very low, can not meet the requirement of suitability for industrialized production far away.
Summary of the invention
In order to solve yielding poorly of existing in the production method of existing isoprene, defect that cost is high, present inventor is by comparing the isoprenoid synthase of the different sourcess such as blue gum, willow, kudzu, and it is carried out after codon optimized expressing in poly-born of the same parents algae, further, by the optimization of the metabolic flux to isoprene route of synthesis, result has improved the output of the synthetic isoprene of poly-born of the same parents algae genetic engineering bacterium significantly.
Therefore, the object of the present invention is to provide the method for utilizing blue-green algae to produce isoprene.
For solving above-mentioned technical problem, the present invention by the following technical solutions:
According to a first aspect of the invention, a kind of fusion rotein, described fusion rotein comprises prenyl tetra-sodium isomerase and isoprenoid synthase.
According to a preferred embodiment of the invention, described prenyl tetra-sodium isomerase source home-brewed wine yeast.
According to the present invention, described isoprenoid synthase is derived from willow, blue gum or kudzu.
According to a preferred embodiment of the invention, described prenyl tetra-sodium isomerase is positioned at the N end of described isoprenoid synthase.
According to a second aspect of the invention, a kind of method of utilizing blue-green algae to produce isoprene is expressed fusion rotein as above in blue-green algae.
Beneficial effect of the present invention: by construction expression Idi-IspS fusion rotein, the isoprene that discovery can significantly improve genetically engineered blue-green algae synthesizes, and can be applicable to the research of the synthetic various terpenoids of blue-green algae.
The present invention carries out genetic modification to blue-green algae, in blue-green algae, express the isoprenoid synthase (IspS) of plant origin, and the generation of isoprene detected, then by the method research of expressing fusion protein, improve significantly the output that genetically engineered blue-green algae produces isoprene, and these results of study can also be applied to genetically engineered blue-green algae and express other foreign proteins, greatly expand the range of application of genetically engineered blue-green algae, there is prospects for commercial application widely.
Accompanying drawing explanation
Fig. 1 is the biosynthetic pathway schematic diagram of isoprene.
Fig. 2 is the plasmid schematic diagram of pKS2.
Fig. 3 is the plasmid schematic diagram of pKS3.
Fig. 4 is the MEP approach schematic diagram of the synthetic isoprene of blue-green algae.
Fig. 5 A is the cumulative withdrawal figure of recombinant bacterial strain ss005, ss016 and the synthetic isoprene of ss017.
Fig. 5 B is the isoprene production yield results figure of recombinant bacterial strain ss016.
Fig. 5 C is the growth curve chart of recombinant bacterial strain ss005, ss016 and ss017.
Fig. 6 A is the cumulative withdrawal figure of recombinant bacterial strain ss016, ss019, the synthetic isoprene of ss020, ss021.
Fig. 6 B is the growth curve chart of recombinant bacterial strain ss016, ss019, ss020, ss021.
Fig. 7 is the cumulative withdrawal figure of recombinant bacterial strain ss016, ss022 and the synthetic isoprene of ss023.
Embodiment
Below, by specific embodiment, the present invention is described in further details.Should be understood that following examples are only for the present invention is described but not for limiting scope of the present invention.
The present invention relates to structure, optimization and the application thereof of isoprene route of synthesis in blue-green algae.Particularly, by construction expression Idi-IspS fusion rotein, the isoprene that discovery can significantly improve genetically engineered blue-green algae synthesizes, studied and there is Different L inker(connection peptides) the fusion rotein impact synthetic on isoprene, can be applicable to the research of the synthetic various terpenoids of blue-green algae.
Bacterial strain and growth conditions used in the present invention are as follows:
Cloning host bacillus coli DH 5 alpha and protein expression host e. coli BL21 (DE3) are purchased from Novagen company.All intestinal bacteria are containing in corresponding resistance LB substratum, 37 ℃ of cultivations.
Poly-born of the same parents algae (Synechocystis sp.) PCC6803 is provided by Japanese National Institute for Environmental Studies microbial strains preservation center (NIES Microbial Culture Collection).Poly-born of the same parents algae PCC6803 cultivates in BG11 liquid nutrient medium.Solid medium adds 1.5% agar and 0.15% Sulfothiorine in BG11 liquid nutrient medium.Fermention medium adds the sodium bicarbonate of 0.1mol/L in BG11 liquid nutrient medium, regulates pH to 7.5, filtration sterilization.Culture condition: 30 ℃, light intensity 2000～3500lux.Add the corresponding microbiotic of 20 μ g/ml for the recombinant bacterium after transforming;
Wherein, described BG11 liquid nutrient medium is composed as follows: NaNO 31.5g/L, MgSO 47H 2o0.075g/L, CaCl 22H 2o0.036g/L, HEPES(20mM) 4.76g/L, Stcok11mL, Stock2(Trace metal mix A5) 1mL, Stock31mL;
Stock1: citric acid H 2o6.567g/L, ferric ammonium citrate 6g/L, EDTANa2H 2o1.107g/L;
Stock2：H 3BO 32.86g/L、MnSO 4·H 2O1.545g/L、ZnSO 4·7H 2O0.222g/L、CuSO 4·5H 2O0.079g/L、Na 2MoO 4·2H 2O0.391g/L、CoCl 2·6H 2O0.0404g/L；
Stock3：K 2HPO 4·3H 2O52g/L、Na 2CO 320g/L。
Plasmid information used in the present invention is as follows:
All plasmids are pBluescript KS+(purchased from Stratagene company) plasmid, express goal gene for be incorporated into poly-born of the same parents algae PCC6803 genome by homologous recombination.
Primer information used in the present invention is as shown in table 1.
Table 1, primer information
Numbering Sequence (5 ' → 3 ') SEQ ID
P5 gagagagagctcttagtcactccttttacttgccagggc?NO：1
P6 gagagatctagattgccctccgcagtgtggttaaaga?NO：2
P7 gagagactcgagactcactttttgcggggcattatt?NO：3
P8 gagagaggtaccgggaaatttataaataataccaccggac?NO：4
P21 agagcatatgactgccgacaacaatagtatgc?NO：5
P22 tagcattctatgaatttgcctgtc?NO：6
P23 gacaggcaaattcatagaatgctaggcggtggctccatgagatgttctgtaagcac?NO：7
P24 agagctgcagttatctctcaaagggtagaataggc?NO：8
P25 agagcatatgactgccgacaacaatagtatgc?NO：9
P26 gtgtatatctccttcttaaagttaaactctagattatagcattctatgaatttgcctgtc?NO：10
P27 tttaactttaagaaggagatatacacatgagatgttctgtaagcac?NO：11
P28 agagctgcagttatctctcaaagggtagaataggc?NO：12
The method of gathering born of the same parents algae PCC6803 conversion in the present invention and go down to posterity is as follows:
The poly-born of the same parents algae PCC6803 of wild-type (WT) grows 2～3 days in liquid B G11 substratum, and cell concn is about 6 × 10 7cell/mL(OD 730=0.6), centrifugal collecting cell, then use BG11 substratum resuspended, make cell density arrive 10 9cell/mL.The cell of every 100 μ l adds the plasmid of 1 μ g, mixes, and secretly cultivates 12h, then illumination 1h, is finally applied to and contains on corresponding antibiotic BG11 solid plate, cultivates 5～6 days, can see that mono-clonal grows.Choose mono-clonal and carry out liquid culture, identify recon.The recombinant bacterium correctly inserting is gone down to posterity containing in corresponding antibiotic liquid nutrient medium, after 3～4 generations, can obtain inserting completely the recombinant bacterium in corresponding site on genome.
The synthetic method that detects isoprene in the present invention is as follows:
Pure recombinant bacterium being inoculated into sealing in the saline bottle of the 300mL that contains 100mL fermention medium cultivates.Every day substratum in saline bottle top gas get the gas of 100 μ L, carry out GC detection.GC7900 is purchased from Shanghai Tian Mei company, and (TM-PLOT Q:30m*0.53mm*40 μ m) and photoionization detector(PID) (PID) to use capillary column.GC condition: 150 ℃ of injection ports, 150 ℃ of column temperatures, 150 ℃ of detectors.Detect the isoprene standard substance (purchased from Sigma company) of different concns gradient, drawing standard curve.According to typical curve, calculate output and the productive rate of the synthetic isoprene of recombinant bacterium.Draw Time-course curve.
embodiment 1, integrate the structure of the poly-genomic expression vector of born of the same parents algae
1.1, the structure of plasmid pKS2
Plasmid pKS2 is the glgX(slr0237 being inserted in poly-born of the same parents algae PCC6803 genome) homologous recombination vector in site.To gather born of the same parents algae PCC6803 genome as template, primer pair P5 and P6 amplification upstream homology arm glgX-up sequence (glgXup), primer pair P7 and P8 amplification downstream homology arm psbA2-down sequence (glgXdn), be loaded into successively on pBluescript KS+ plasmid, introduce again spectinomycin mark (Spe), introduce the promotor (P of the endogenous coding psbA2 of poly-born of the same parents algae PCC6803 simultaneously psbA2) and colibacillary trrnB terminator sequence (trrnB), obtain expressing the homologous recombination vector pKS2(SEQ ID NO:13 of goal gene), its plasmid schematic diagram is as shown in Figure 2.
1.2, the structure of plasmid pKS3
By the promotor of the psbA2 that encodes in pKS2 replace with coding cpc operon promoter sequence (P cpc), obtain expressing the homologous recombination vector pKS3(SEQ ID NO:14 of goal gene), its plasmid schematic diagram is as shown in Figure 3.
embodiment 2, in poly-born of the same parents algae PCC6803, express the fusion rotein of Idi and IspS
Derive from the isoprenoid synthase encoding gene e1ispS of blue gum (Eucalyptus globulus), original DNA sequence is from GenBank database (GenBank:AB266390.1), and sequence is as shown in SEQ ID NO:15.Derive from the isoprenoid synthase encoding gene p1ispS of willow (Populus alba), original DNA sequence is from GenBank database (GeneBank:AB198180), and sequence is as shown in SEQ ID NO:16.Derive from the isoprenoid synthase p2ispS of Populus alba x Populus tremula, original series is from GenBanK database (GenBank:AJ294819.1), and sequence is as shown in SEQ ID NO:17.Wherein, e1ispS, p1ispS and p2ispS sequence all do not contain signal peptide.By the synthetic above-mentioned DNA sequence dna of Nanjing Jin Sirui company.
At the P of pKS3 plasmid cpcbetween the NdeI in the downstream of promotor and PstI restriction enzyme site, insert p1ispS, form plasmid pP cpcp1ispS.Above-mentioned plasmid is transformed in poly-born of the same parents algae PCC6803, screens positive recombinant bacterial strain ss005.
The MEP approach of the synthetic isoprene of blue-green algae as shown in Figure 4, wherein comprises the dxs gene of coding deoxy-D-xylulose sugar-5-phosphate synthase and the idi gene of coding prenyl tetra-sodium isomerase.
2.1, construction expression Idi sCfusion rotein with p1IspS
Take yeast saccharomyces cerevisiae (Sacchromyces cerevisiae), S288C(is derived from ATCC) genome as template, primer pair P21 and P22 amplification idi sCgene.With plasmid pP cpcp1ispS is template, primer pair P23 and P24 amplification p1ispS gene.Take the mixture of the PCR product of above-mentioned two purifying as template, primer pair P21 and P24 amplification obtain idi-GGGS-p1ispS fusion PCR fragment, and (GGGS is the connection peptides sequence between Idi albumen and IspS albumen, short flexible linker), pack pKS2 into, obtain plasmid pPcpcidi-GGGS-p1ispS, transform poly-born of the same parents algae PCC6803, obtain recombinant bacterium SS016.
Change the order of connection of Idi and IspS, can obtain the fusion PCR fragment of p1ispS-GGGS-idi, pack pKS2 into, obtain plasmid pP cpcp1ispS-GGGS-idi, transforms poly-born of the same parents algae PCC6803, obtains recombinant bacterium SS017.
Take the genome of yeast saccharomyces cerevisiae as template, primer pair P25 and P26 amplification idi sCgene.With plasmid pP cpcp1ispS is template, and primer pair P27 and P28 amplification p1ispS gene, by idi sC, p1ispS packs pKS2 successively into, obtains plasmid pP cpcidi sCthe non-fusion rotein of p1ispS(, idi, p1ispS have rbs sequence separately), transform poly-born of the same parents algae PCC6803, obtain recombinant bacterium SS018.
Above recombinant bacterial strain information is as shown in table 2.
Table 2, express the recombinant bacterial strain of Idi-IspS fusion rotein at poly-born of the same parents algae PCC6803
Recombinant bacterial strain Feature
ss016 ΔglgX::P cpcidi-GGGS-p1ispS
ss017 ΔglgX::P cpcp1ispS-GGGS-idi
ss018 ΔglgX::P cpcidi?p1ispS
The positive recombinant bacterial strain that screening is obtained ferments and detects isoprene output, result is as shown in Fig. 5 A, 5B and 5C, ferment the 9th day time, express the recombinant bacterium SS016 cumulative production of Idi-p1IspS fusion rotein up to 6.01mg/L, and from the 3rd day to the 6th day, the productive rate of the synthetic isoprene of SS016 reached 1.2mg/L～1.4mg/L.But the output of expressing the recombinant bacterium SS017 of p1IspS-Idi fusion rotein only reaches 2.0mg/L, illustrate that Idi is in the N of fusion rotein end better effects if.Confirm that the recombinant bacterium of the fusion rotein of expressing Idi-p1IspS in blue-green algae can effectively improve the output of isoprene, and the order of fusion rotein is very crucial.
2.2, build the aminoacid sequence of different Linker(connection peptides) expression Idi sCfusion rotein with p1IspS
Change Idi sCthe catenation sequence of-p1IspS, selects following connection peptides to connect the long flexible linker of fusion rotein: Linker1:GSGGGGS(); The rigidity linker that Linker2:GSGEAAAK(is short); Linker3:GSG (EAAAK) 2(long rigidity Linker).The Idi that above-mentioned different connection peptides are connected sC-p1IspS fusion rotein is connected to pKS2, and the carrier obtaining transforms respectively poly-born of the same parents algae PCC6803, obtains recombinant bacterium SS019, SS020, SS021, as shown in table 3.
Table 3, in poly-born of the same parents algae PCC6803, express the recombinant bacterial strain of the Idi-IspS fusion rotein that different connection peptides connect
Recombinant bacterial strain Feature
ss016 ΔglgX::P cpcidi-GGGS-p1ispS
ss019 ΔglgX::P cpcidi-GSGGGGS-p1ispS
ss020 ΔglgX::P cpcidi-GSGEAAAK-p1ispS
ss021 ΔglgX::P cpcidi-GSG(EAAAK) 2-p1ispS
The positive recombinant bacterial strain that screening is obtained ferment and detects isoprene output, and result as shown in Figure 6 A and 6B, ferment the 12nd day time, and SS016, SS019, SS020, SS021 output are almost identical, the length that Linker is described with flexibility to Idi sCthe expression of-p1IspS fusion rotein and the output of synthetic isoprene almost do not affect.
2.3, construction expression Idi sCfusion rotein with p2IspS or e1IspS
Build in the same way Idi sCwith the fusion PCR fragment of p2IspS, and Idi sCwith the fusion PCR fragment of e1IspS, Linker sequence is: GGGS.Be connected to pKS2, the carrier obtaining transforms respectively poly-born of the same parents algae
PCC6803, obtains recombinant bacterium SS022, SS023, as shown in table 4.
Table 4, in poly-born of the same parents algae PCC6803, express the recombinant bacterial strain of Idi-p2IspS and Idi-e1IspS fusion rotein
Recombinant bacterial strain Feature
ss022 ΔglgX::P cpcidi-GGGS-p2ispS
ss023 ΔglgX::P cpcidi-GGGS-e1ispS
The positive recombinant bacterial strain that screening is obtained ferments and detects isoprene output, result as shown in Figure 7, the fusion rotein of expressing the IspS of different sources can effectively improve the output of isoprene equally, illustrate that the fusion rotein that Idi-IspS builds is applicable to the IspS that different plant species is originated, and is of universal significance.
In sum, the present embodiment finds that the recombinant bacterium of the fusion rotein of expressing Idi-p1IspS in blue-green algae can effectively improve the output of isoprene, and the order of fusion rotein is very crucial, but the output that the connection peptides sequence of fusion rotein and the source of IspS produce isoprene for blue-green algae does not make significant difference.
Figure IDA0000472524560000011
Figure IDA0000472524560000021
Figure IDA0000472524560000031
Figure IDA0000472524560000041
Figure IDA0000472524560000061
Figure IDA0000472524560000081
Figure IDA0000472524560000091
Figure IDA0000472524560000101
Figure IDA0000472524560000111
Figure IDA0000472524560000121
Figure IDA0000472524560000141
Figure IDA0000472524560000151
Figure IDA0000472524560000161
Figure IDA0000472524560000171
Figure IDA0000472524560000181

Claims (5)

1. a fusion rotein, is characterized in that, described fusion rotein comprises prenyl tetra-sodium isomerase and isoprenoid synthase.
2. fusion rotein as claimed in claim 1, is characterized in that, described prenyl tetra-sodium isomerase source home-brewed wine yeast.
3. fusion rotein as claimed in claim 1, is characterized in that, described isoprenoid synthase is derived from willow, blue gum or kudzu.
4. fusion rotein as claimed in claim 1, is characterized in that, described prenyl tetra-sodium isomerase is positioned at the N end of described isoprenoid synthase.
5. utilize blue-green algae to produce a method for isoprene, it is characterized in that, in blue-green algae, express the fusion rotein as described in any one in claim 1-4.
CN201410076573.2A 2013-04-15 2013-04-15 Cyanophyceae is utilized to produce isoprene Active CN103789293B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410076573.2A CN103789293B (en) 2013-04-15 2013-04-15 Cyanophyceae is utilized to produce isoprene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410076573.2A CN103789293B (en) 2013-04-15 2013-04-15 Cyanophyceae is utilized to produce isoprene

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201310128943.8A Division CN103215315B (en) 2013-04-15 2013-04-15 Method for producing isoprene by utilizing blue algae

Publications (2)

Publication Number Publication Date
CN103789293A true CN103789293A (en) 2014-05-14
CN103789293B CN103789293B (en) 2016-07-06

Family

ID=50665351

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410076573.2A Active CN103789293B (en) 2013-04-15 2013-04-15 Cyanophyceae is utilized to produce isoprene

Country Status (1)

Country Link
CN (1) CN103789293B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9382554B2 (en) 2012-07-27 2016-07-05 Wisys Technology Foundation, Inc. Methods for isoprene and pinene production in cyanobacteria

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110039323A1 (en) * 2009-08-14 2011-02-17 Eric Lawrence Singsaas Isoprene Production

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110039323A1 (en) * 2009-08-14 2011-02-17 Eric Lawrence Singsaas Isoprene Production

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LV X，ET AL: "Significantly enhanced production of isoprene by ordered coexpression of genes dxs,dxr,and idi in Escherichia coli", 《APPL MICROBIOL BIOTECHNOL》 *
WIBERLEY,ET AL: "Regulation of isoprene emissio from poplar leves throughout a day", 《PLANT CELL AND ENVIRONMENT》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9382554B2 (en) 2012-07-27 2016-07-05 Wisys Technology Foundation, Inc. Methods for isoprene and pinene production in cyanobacteria
US9580728B2 (en) 2012-07-27 2017-02-28 Wisys Technology Foundation, Inc. Methods for isoprene and pinene production in cyanobacteria

Also Published As

Publication number Publication date
CN103789293B (en) 2016-07-06

Similar Documents

Publication Publication Date Title
CN103215315B (en) Method for producing isoprene by utilizing blue algae
CN104974944B (en) A kind of schizochytrium limacinum genetic engineering bacterium for producing DHA and its construction method and application
CN103243065A (en) Bacterial strain for producing farnesene and application of bacterial strain
CN101831414B (en) Process for extracellularly producing recombinant alpha-cyclodextrin glucosyltransferase
US9580728B2 (en) Methods for isoprene and pinene production in cyanobacteria
CN104894047A (en) Construction method of recombinant Bacillus subtilis strain for expressing D-allulose 3-epimerase based on D-alanine defective selection marker
CN103243066A (en) Bacterial strain for producing lycopene and application of bacterial strain
CN109609424B (en) Escherichia coli for producing farnesene
CN107201374A (en) The construction method of the butanediol high-yielding engineering bacterial strains of optical voidness meso 2,3 and application
CN111088175A (en) Yarrowia lipolytica for producing bisabolene and construction method and application thereof
CN104789512B (en) The production bacterium of isoprene and the method for producing isoprene
CN104046586A (en) Genetically engineered bacteria and application of genetically engineered bacteria to production of (2R, 3R)-2,3-butanediol
CN104762242B (en) The production bacterium of mevalonic acid and the method for producing mevalonic acid
CN111154665B (en) Recombinant yarrowia lipolytica and construction method and application thereof
CN111394289B (en) Genetically engineered bacterium and application thereof, and method for producing prostaglandin E2
CN103789293B (en) Cyanophyceae is utilized to produce isoprene
CN115704038A (en) Gene, recombinant vector, engineering bacterium and application thereof
CN109852601A (en) It is a kind of can efficient application N- glycosylation algin catenase mutant and construction of genetic engineering method
CN117327725A (en) Yarrowia lipolytica genetically engineered bacterium for producing beta-elemene, construction method and preparation method of beta-elemene
CN105331550B (en) A method of it producing the recombination eukaryon bacterial strain of sweet wormwood diene and prepares sweet wormwood diene using the recombination eukaryon bacterial strain
CN111607546B (en) Genetic engineering bacterium for high-yield farnesene and construction method and application thereof
CN114672510B (en) Method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae
CN109777745B (en) Genetic engineering bacterium for synthesizing sabinene and construction method and application thereof
CN103642767B (en) A kind of 2-methylerythritol 4-cytidine phosphate acyltransferase mutant and application thereof
CN106554933A (en) Isoprene gene engineering produces bacterium and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant