CN103773740B - Pig breathes the structure with reproductive syndrome virus replication defective virus vaccine strain and application - Google Patents
Pig breathes the structure with reproductive syndrome virus replication defective virus vaccine strain and application Download PDFInfo
- Publication number
- CN103773740B CN103773740B CN201310703956.3A CN201310703956A CN103773740B CN 103773740 B CN103773740 B CN 103773740B CN 201310703956 A CN201310703956 A CN 201310703956A CN 103773740 B CN103773740 B CN 103773740B
- Authority
- CN
- China
- Prior art keywords
- strain
- prrsv
- nsp9
- jiangxi
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention belongs to vaccine preparation field, be specifically related to a boar and breathe the structure with reproductive syndrome virus replication defective virus vaccine strain and application.Pig is breathed and reproductive syndrome virus (PRRSV) Jiangxi 3 strain lack part Nsp9 gene by the present invention, obtain the Jiangxi 3 strain infection clones of replication defective, the Nsp9 gene of PRRSV is cloned into Marc 145 cell simultaneously, stabilize it expression Nsp9 albumen, Marc 145 cell by the PRRSV Jiangxi 3 strain infection clones transfection expression Nsp9 albumen of replication defective, save out rVJiangxi 3 strain with replication capacity, it is thus achieved that replication defective PRRSV virus vaccine strain.The vaccine that the present invention is obtained has good immunogenicity, can protect PRRSV classics strain and the infection of highly pathogenic mutant strain simultaneously.
Description
Technical field
The invention belongs to vaccine preparation field, be specifically related to one and utilize Nsp9 gene delection to build PRRSV
(porcine reproductive and respiratory syndrome virus, pig breathes and reproductive syndrome virus)
The method of replication defective virus vaccine strain and the application in immunogenic production process thereof.
Background technology
Porcine reproductive and respiratory syndrome (porcine reproductive and respiratory syndrome, PRRS)
Be late 1980s find a kind of hyperinfection disease, cause the miscarriage of in-pig, stillborn fetus,
The dysgenesias such as mummy tire, and the respiratory tract disease of various age pig (particularly piglet).1987
The U.S. first reported the generation of this disease.In a few years time subsequently, extend over the entire globe rapidly each pig industry and send out
The countries and regions reached.1996, Harbin veterinary institute divided first from domestic doubtful PRRS case
From viral to PRRS, thus confirm the primary disease existence in China.1991, the central authorities of Holland of Lelystad
Doctor Wensvoort of veterinary institute is separated to cause of disease first with porcine alveolar macrophage, and named
Lelystad virus (PRRSV Europe class representative strains).Within 1992, American Studies personnel use CL2621 cell
Also PRRSV american type representative strains (VR-2332) it is separated to.By to the form of this virus, structure and
The research of antigenicity etc., it was demonstrated that it is a kind of newfound virus.
Its cause of disease is porcine reproductive and respiratory syndrome virus (porcine reproductive and respiratory
Syndrome virus, PRRSV), belong to the many viraleses of newly established Buddhist nun (order Nidovirales), move
Arteries and veins inflammation Viraceae (family Arteriviridae), Arterivirus (genus Arterivirus).PRRSV
Different separation strain nucleotide sequences existence extensively and significantly make a variation, according to serological test and structural gene sequence
PRRSV can be divided into two kinds of basic genotype by row analysis result: Europe class (I type) and America strain (II
Type), the former Major Epidemic is in European Region, and the latter's Major Epidemic is in America and the Asian-Pacific area.But Denmark,
Slovakia, Canada occur in that the infection of amphitypy PRRSV the most respectively.Further, the american type that Denmark occurs
The popular of PRRSV is owing to american type PRRSV Attenuate vaccine virulence returns strong result.Although two genotype
Genome nucleotide concordance only 55%～70%, but its morphosis, replicate feature, cell tropism, stream
The biological characteristicses such as the genius morbi of row circulation way and initiation thereof are the most identical.
Since two thousand six, PRRSV variant " the pig high-pathogenicity blue ear disease " caused is a kind of new in China
Type deadly infectious disease, it with popular wide, propagate fast, sickness rate and fatality rate vaccine unprotect high, existing is made
With being characterized, and completely different with classical pig blue-ear disease, and up to now, primary disease is in more than 20 province of China
Popular, the nearest medium and small pig farm of our province part also fails to escape by luck, and has hit the pig industry of China's our province weightily,
Its economic loss has reached hundreds of millions yuan of meters.Highly pathogenic PRRS in 2008 is popular less the whole nation, but
Start for 2009 second half year and occur in that the eruption and prevalence of highly pathogenic PRRS, in the northern province of China such as
Henan, Anhui, Shandong etc. are popular seriously, cause the biggest economic loss.
In PRRSV, ORF1 is 1 maximum reading frame, is about 12kb, including ORF1a and
ORF1b, accounts for virus genomic 80%, and for the non-structural protein coding region of virus, Nsp9 gene is positioned at
ORF1b upper main code RNA dependent RNA polymerase (RNA-dependent RNA
Polymerase, RdRp), participate in virus replication, high conservative.The biological function of Nsp9 is with sick
What relation biology and the Clinical symptoms of poison have unclear.Reverse Genetics is research RNA viruses
Replicate, the interaction of pathogenic, protein function, virus and host and exploitation new generation vaccine and virus carry
Body provides a good technology platform.Siao-Kun Wan Welch etc. constructs and lacks ORF2 respectively
With the PRRSV replication defective virus vaccine strain of ORF4, but after immune swine, only produce more weak immunoreation
(Welch, S.K., et al., Construction and evaluation of genetically engineered
replication-defective porcine reproductive and respiratory syndrome virus vaccine
Candidates.Vet Immunol Immunopathol, 2004.102 (3): p.277-90.).
The research and development of Porcine reproductive and respiratory syndrome (or pig blue-ear disease) vaccine are global problems, epidemic disease of living
Generally there is the problem that virulence is the strongest in Seedling, and the subject matter that inactivated vaccine exists is that immune efficacy is not good enough.To the greatest extent
Pipe is of a great variety currently for the vaccine research of PRRS, but does not has a kind of vaccine that pig body can produce preferably peace
Full guard effect.Therefore currently in the urgent need to working out a kind of safe and effective, that immunity spectrum is wide vaccine.
Summary of the invention
In order to overcome the problem and shortcoming that above-mentioned prior art exists, the primary and foremost purpose of the present invention is to provide one
Plant the method building virus replication-deficient PRRSV virus vaccine strain.The bacterial strain that invention is applied is PRRSV
Jiangxi-3 strain (GenBank Accession Number:EU200961.1), by by Nsp9(Nonstructural
Protein9) gene carries out excalation, it is achieved the replicability defect characteristics of PRRSV.
The virus replication-deficient PRRSV that another object of the present invention is to provide said method to prepare is sick
Toxic vaccine strain.
It is still another object of the present invention to provide answering of above-mentioned virus replication-deficient PRRSV virus vaccine strain
With.
The purpose of the present invention is achieved through the following technical solutions: a kind of structure virus replication-deficient PRRSV is sick
The method of toxic vaccine strain, is specifically included as: by PRRSV Jiangxi-3 strain lack part Nsp9 gene, obtain
The Jiangxi-3 strain infection clones of replication defective, simultaneously by the Nsp9 gene of PRRSV Jiangxi-3 strain
It is cloned into Marc-145 cell so that it is stably express Nsp9 albumen, by the PRRSV Jiangxi-3 of replication defective
The Marc-145 cell of strain infection clones transfection expression Nsp9 albumen, saves out and has replication capacity
RVJiangxi-3 strain, it is thus achieved that replication defective PRRSV virus vaccine strain.
Described PRRSV Jiangxi-3 strain derives from 2006 " hyperpyrexia disease " period from the separation of pig farm, Jiangxi Province
Identify (GenBank Accession Number:EU200961.1), this bacterial strain has been delivered document and has been: pig breeding with
The complete genome sequencing of breath syndrome virus epidemic strain Jiangxi-3, Shanghai Communications University's journal (agricultural
Academy of science), 2 phases in 2009.
Described is utilization reverse genetic manipulation and base by PRRSV Jiangxi-3 strain lack part Nsp9 gene
Because recombinant technique realizes.
Described lack part Nsp9 gene is preferably disappearance PRRSV Jiangxi-3 pnca gene group sequence
GenBank Accession Number EU200961.1's is shown from 5 ' end the 8241st to 8342
The nucleotide fragments of 102nt；
Preferably, on the basis of by Jiangxi-3 strain Nsp9 gene delection 102nt nucleotide, then at GenBank
Accession Number EU200961.1 inserts restriction enzyme in 5 ' end the 8241st to 8342
Enzyme site；Described restriction endonuclease sites is preferably restricted enzyme Sbf I site；
Described rVJiangxi-3 strain can stable on the Marc-145 cell of stable expression Nsp9 albumen pass
Culture, but can not express the cell line of Nsp9 gene replicates in pig body or not and pass on.
A kind of virus replication-deficient PRRSV virus vaccine strain is prepared by said method, this viral vaccine
Strain can stablize Secondary Culture on the Marc-145 cell of stable expression Nsp9 albumen, but can not be in pig body
Or do not express in the cell line of Nsp9 gene replicate pass on.
Above-mentioned virus replication-deficient PRRSV virus vaccine strain is breathed with numerous in preparation prevention and/or treatment pig
Grow the application in syndrome vaccine.
The present invention has such advantages as relative to prior art and effect:
1. in vitro transcription and liposome-mediated direct transfection under the present invention is controlled by CMV promoter are steady
Surely the Marc-145 cell of Nsp9 albumen is expressed, it is thus achieved that the PRRSV of the replication defective stably passed on
Jiangxi-3 strain Revive virus rVJiangxi-3, lacks a length of 102nt in the Nsp9 coding region of its genome
Nucleotide fragments.In disappearance district, introduce restriction enzyme site Sbf I make to set up serology and molecule life
Thing diagnostic method is possibly realized.The unique restriction enzyme site Sbf I introduced also makes follow-up molecule manipulation more
Add conveniently.So rVJiangxi-3 can become PRRS marker vaccine and the ideal candidates of arteritis virus carrier
Object, efficiently solves the problems referred to above that this type of vaccine exists.
2. the PRRSV clonal virus rVJiangxi-3 of rescue has good hereditary stability in vitro, with
Parental virus PRRSV Jiangxi-3 compares, answering on the Marc-145 cell of stable expression Nsp9 albumen
System and propagation do not have marked difference, and cultivate on the Marc-145 cell do not express Nsp9 albumen and do not breed
Do not produce pathological changes.
3. Animal infection experiments shows, rVJiangxi-3 strain pathogenic lower than parental virus, does not produces pig
Any clinical symptoms, due to virus not reproducible in pig body, but can express its coding structural protein and
Non-structural protein stimulates pig body to produce immunoreation.In the rVJiangxi-3 strain of replication defective built at it
34 aminoacid, the polypeptide that can lack exploitation differential diagnostic method has been lacked in Nsp9 gene.
4. Vaccine potency test shows, the present invention utilizes virus replication-deficient PRRSV virus vaccine strain system
The standby vaccine obtained has high vaccine potency, virus replication-deficient PRRSV viral vaccine the 5th generation
(105.5TCID50) after 5 times dilute, still to Porcine reproductive and respiratory syndrome (or pig blue-ear disease)
Preventing and treating has significant effect.
5. the pig that invention builds breathes has good immunity with reproductive syndrome virus replication defective virus
Originality, can protect pig to breathe and reproductive syndrome virus classics strain and the infection of highly pathogenic mutant strain simultaneously.
Accompanying drawing explanation
Fig. 1 is that Jiangxi-3 strain replication defective virus infection clones builds schematic diagram.
Fig. 2 is Jiangxi-3 strain Revive virus indirect immunofluorescence qualification figure.Wherein, A is
RVJiangxi-3d102 infection Marc-145 cell IFA qualification result after 36 hours；B is rVJiangxi-3d102
Infection Marc-145-Nsp9 cell IFA qualification result after 36 hours.
Fig. 3 is that PRRSV is respectively at Marc-145 cell with stably express on the Marc-145 cell of Nsp9
Growth curve.
Fig. 4 is rVJiangxi-3(the 20th generation) and the partial sequence of PRRSV Jiangxi-3Nsp9 coding region
Relatively.
Fig. 5 is the dynamic change of Revive virus immunity piglet antibody.
Detailed description of the invention
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention
It is not limited to this.
The PRRSV Jiangxi-3 strain replication defective virus vaccine strain of the present invention, the original strain used
Jiangxi-3 strain derives from 2006 " hyperpyrexia disease " period from pig farm, Jiangxi Province isolation identification (GenBank
Accession Number:EU200961.1), (having delivered document is: porcine reproductive and respiratory syndrome virus is popular
The complete genome sequencing of strain Jiangxi-3, Shanghai Communications University's journal (Academy of Agricultural Sciences), 2009 2
Phase), utilize reverse genetic manipulation and gene recombination technology by Jiangxi-3 strain lack part Nsp9 gene, obtain
To the Jiangxi-3 strain infection clones of replication defective, simultaneously by the Nsp9 gene gram of Jiangxi-3 strain
Grand enter Marc-145 cell so that it is stably express Nsp9 albumen, replication defective PRRSV Jiangxi-3 strain
The Marc-145 cell of infection clones transfection expression Nsp9 albumen, saves out and has replication capacity
RVJiangxi-3 strain, this strain stably can pass on the Marc-145 cell of stable expression Nsp9 albumen
Cultivate, but can not express the cell line of Nsp9 gene replicates in pig body or not and pass on.
Embodiment 1: the structure of the recombinant vector pACYC-Jiangxi-3d102 containing Nsp9 deleted coding region
The present embodiment is that PRRSV Jiangxi-3 Genomic full_length cDNA will lack length in Nsp9 coding region
For the nucleotide fragments of 102bp, and it is cloned in plasmid pACYC177 carrier obtaining recombinant vector.
The nucleotide sequence of described nucleotide fragments such as GenBank Accession Number EU200961 from 5 '
Shown in end the 8241st to 8342.
1, the structure of the recombinant vector of the nucleotide fragments containing Nsp9 deleted coding region
According to Jiangxi-3 complete sequence (GenBank serial number EU200961) and plasmid vector pACYC177
Restriction enzyme site, by software design clone and detection primer (such as table 1), primer is raw by Shanghai English fine horse
Thing technology company synthesizes.
Table 1 is for building the primer sequence of PRRSV Jiangxi-3 strain infection clones
On the basis of PRRSV Jiangxi-3 strain whole genome sequence measures, analyze its genome and clone carries
The restriction enzyme site of body, utilize Jiangxi-3 strain nucleotide sequence from the 6465th Afl II of 5 ' ends, the 11883rd
Asc I, the 13122nd Sal I design 8 and primer amplification go out overlapped 4 section nucleic acid fragment, name respectively
For FA, FB, FC, FD.5 ' the ends of amplification gene group 5 ' end i.e. FA section the primer FA-F introduce restricted
Restriction endonuclease Mlu I restriction enzyme site, draws in amplification gene group 3 ' end poly (A41) i.e. FD section the primer FD-R
Entering PacI restriction enzyme site, its construction method is as shown in Figure 1.
The transformation of 2.pACYC177 carrier
PACYC177 carrier contains Amp and Kan resistant gene, removes the BamH I of pACYC177 carrier
And the sequence between II liang of site of Bgl, for the ease of the insertion of PRRSV full-length genome, at BamH I and Bgl II
New restriction enzyme site Not I, Mlu I, Afl II, Asc I, Sal I and Pac I is inserted between two sites.For
Reach one section of multiple clone site nucleotide sequence of this mesh synthetic, its sequence
ATCGGATCCAATGCGGCCGCTAGCTCGACGCGTAAGCATCTTAAGCGATC
CAGGCGCGCCGGTATGCGTCGACCTTGGACTTAATTAAGTCGAATGCCCT TCCGGCATACTG, sequence has the sequence BamH I successively of underscore, Not I, Mlu I, Afl II,
Asc I, Sal I, the recognition sequence of Pac I and Bgl II.By this section of joint (Linker) sequence BamH I
Carry out enzyme action with Bgl II and be then cloned in pACYC177 carrier, replace BamH I in pACYC177 carrier
And original sequence between II liang of site of Bgl, by named for this carrier pACYC-Linker carrier.
Introduce CMV promoter before PRRSV Jiangxi-3 strain full-length genome, and make PRRSV5 ' hold the first alkali
Base is placed in the transcriptional start site of CMV promoter, it is therefore an objective to make to transcribe just from PRRSV Jiangxi-3 strain
Full-length genome 5 ' end start, CMV promoter with primer CMV-F and CMV-R with containing CMV promoter
Plasmid vector such as pVax (American I nvitrogen company) is that template expands, and primer CMV-F introduces
Not I restriction enzyme site, primer CMV-R introduces Mlu I restriction enzyme site.Improved pACYC177 carries
Body entitled pACYC-CMV-Linker carrier.
The structure of 3.Nsp9 coding region disappearance 102bp nucleotide fragments
Nsp9 is positioned in fragment B of PRRSV Jiangxi-3 strain full-length genome as shown in Figure 1, utilizes table 1
In 2 couples of primers F B-F, Nsp9-dR and Nsp9-dF, FB-R amplify Nsp9 coding in fragment B respectively
The sequence of disappearance front and back end, district, then matches with these two sections of PCR primer for template primers F B-F and FB-R
Amplify Nsp9 coding region disappearance 102bp nucleotide fragments B, it is thus achieved that with Nsp9 coding region lack 102bp
The named FBd102 of fragment B of nucleotide, the 5 ' ends at primer Nsp9-dR and Nsp9-dF with the addition of limit
In the recognition sequence CCTGCAGG(table 1 of property restriction endonuclease Sbf I processed, underscore represents), amplification obtains
Fragment just introduces restricted enzyme Sbf I can be as genetic marker.
4. contain the structure of the PRRSV Jiangxi-3 strain full-length genome recombinant vector of Nsp9 deleted coding region
(1) virus genome RNA extracts and the synthesis of cDNA
Virus genome RNA extracts the viral RNA/DNA extraction using TaKaRa company (DaLian, China)
Test kit is carried out according to test kit description, and the RNA of extraction is finally dissolved in 40 μ L ultra-pure waters.
The synthesis of cDNA: carry out according to American I nvitrogen company Reverse Transcription box description, respectively will
In table 1, primers F D-R, primers F C-R and FB-R (10 μMs) 0.5 μ L, add dNTP1 μ L (10 μMs of each)
With 6 μ L RNA sample, 5.5 μ L dd H2O mix homogeneously, is heated to 65 DEG C of 5min in PCR instrument, takes out
Put into rapidly 2min in frozen water, be subsequently adding 4 μ L5 × RT-PCR Buffer, 1 μ L DDT, 1 μ L
RNaseOUT, reverse transcription SuperscriptTM III 1 μ L (100u/ μ L), mixing, in 55 DEG C in PCR instrument
Reverse transcription 60min, 70 DEG C of 10min, reaction terminate after take out immediately use or-20 DEG C frozen standby.
(2) viral genome segmented-PCR amplification
PCR amplification is carried out with reference to the TransStart FastPfu product description of Fermentas company of the U.S..Often
Individual PCR reaction system is 50 μ l, including 5 × TransStart FastPfu Buffer10 μ l, dNTP (2.5mM
Each) 4 μ l, TransStart FastPfu1.5 μ l, each 2 μ l of upstream and downstream primer (10 μMs), cDNA2 μ l, supplements
Water is to 50 μ l.PCR condition is generally 95 DEG C of 1mins routinely；95 DEG C of 30secs, 55 DEG C, 30secs,
72 DEG C of 5mins, run 35 circulations；Last 72 DEG C of 10mins.Annealing temperature and extension of time are drawn with every pair
The Tm value of thing and the length of amplified fragments thereof are adjusted accordingly.
(3) splicing of PRRSV Jiangxi-3 strain full-length cDNA
Respectively the PCR primer electrophoresis of FA, FBd102, FC, FD nucleotide fragments is reclaimed with corresponding
Restricted enzyme carries out endonuclease reaction, and electrophoresis reclaims the PCR primer after enzyme action, by each fragment according to routine
Cloning process is cloned into the recombiant plasmid in pACYC-CMV-Linker carrier, after structure successively
PACYC-CMV-Jiangxi-3d102 gene order is as shown in Figure 1.
(4) order-checking of full-length genome cDNA clone is identified
The full-length genome cDNA clone pACYC-CMV-Jiangxi-3d102 of structure is served sea English fine horse biological
Company carries out the order-checking of PRRSV Jiangxi-3 strain full-length genome, by row and the protovirus nucleotide sequence of being checked order
Comparison, finds out the nucleotide site of sudden change.
The structure of embodiment 2:Nsp9 stable expression cell line
1. the structure of recombiant plasmid pIRESpuro-Nsp9
Eukaryon expression plasmid pIRESpuro2 is purchased from Clonetec company of the U.S.；Marc-145 cell is purchased from
ATCC company of the U.S..Jiangxi-3(EF398047 according in GenBank) Nsp9 gene order sets
Meter pair of primers: Nsp9-F:5 '-ATCGCTAGCATGCTAGCCGCCAGCGGCT, Nsp9-R:
5′-ATCGCGGCCGCTTATTCTCATGATTGGACCTGAGT.For the ease of being cloned in primer
(underscore is enzyme action position to introduce Nhe I and Not I restriction enzyme site in Nsp9-F and Nsp9-R respectively
Point), primer is synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.Conventionally carry out Nsp9 gene
The restricted enzyme action of Nhe I and Not I of PCR amplification, Nsp9 genetic fragment and Plasmid pIRES puro2 connects,
Convert bacillus coli DH 5 alpha competent cell, be then passed through extracting plasmid and carry out restricted enzyme action and order-checking mirror
Fixed, it is thus achieved that the named pIRESpuro-Nsp9 of recombiant plasmid.
The most stably express the screening of Nsp9 gene M arc-145 cell strain
By Marc-145 cell about 1～3x105Individual passage is about 60%-80 to 6 orifice plates, cultivation to degree of converging
Being used for during % transfecting, transfection method is according to American I nvitrogen company LipofectamineTM2000 transfection reagents
Box operating instruction is carried out.Adding 1mg/L puromycin after transfecting 24 hours is that pressure screening culture fluid continues training
Support, every hole 1mL, within every 3 days, change a culture fluid, after lasting puromycin screens 2 weeks, Tissue Culture Plate transfer
Resisting cell is had to grow seen from the hole of dye pIRESpuro-Nsp9.Treat that Marc-145 blanc cell cellular control unit exists
Culture fluid containing puromycin is cultivated and uses instead containing minimum lethal concentration puromycin to whole death
(0.5mg/L) culture medium carries out maintaining screening 1-2 week, utilizes limiting dilution assay mould with purine-containing in 96 orifice plates
Element (0.5mg/L) RPMI-1640 culture fluid is cultivated, and wherein has 13 porocytes to obtain propagation, by thin for this 13 hole
Born of the same parents' amplification culture respectively, wherein part is frozen, and remaining amplification culture makees follow-up identification experiment.
3. express the qualification of the Marc-145 cell strain of Nsp9 gene
PCR identifies: extract 13 strain Marc-145 cell genomic dnas of above-mentioned amplification culture, utilize with
By PCR method, 1 pair of primer that amplification Nsp9 gene is identical, identifies whether Nsp9 gene is incorporated into
In Marc-145 cell, PCR result shows in the genome of 9 strains and has amplified Nsp9 gene, shows
This 9 strain Marc-145 cell strain contains Nsp9 gene.
Indirect immunofluorescence (IFA) is identified: cultivating the Marc-145 cell after screening, 80% cold acetone is fixed
After, close 30min, PBS and wash 3 times, the PRRSV antiserum that addition 0.5%PBST100 times dilutes,
In 37 DEG C effect 1h after, with containing 0.5%PBST clean 3 times, each 5min, add 1:100 times dilute
The goat anti-mouse IgG antibody of the FITC labelling released is after 37 DEG C of effect 30min, and PBST cleans 3 times,
Use fluorescence microscope result.Result display PCR identifies that the 9 strain Marc-145 containing Nsp9 gene are thin
Born of the same parents' strain, it is observed that specific fluorescence, shows that this 9 strain Marc-145 cell strain have expressed Nsp9 gene,
By the highest for the expression strain Marc-145 cell name Marc-145-Nsp9 cell, it is thus achieved that this strain cell
Rescue as PRRSV Jiangxi-3 strain replication defective virus.
Embodiment 3: the preparation of replication defective virus
1. the transfection of replication defective virus and rescue
By Marc-145-Nsp9 passage in 6 orifice plates, with containing volume fraction 10% calf serum
RPMI-1640 culture fluid overnight incubation, for transfecting in time growing to 60%～70% degree of converging and uniformly.Transfection
The plasmid pACYC-CMV-Jiangxi-3d102 Spin MiniPrep Kit of QIAGEN company of the U.S. used
Test kit extracts, then with the content of spectrophotometric determination plasmid.The extraction steps of plasmid carries according to plasmid
Take test kit description to operate.Transfection method is according to American I nvitrogen company LipofectamineTM
2000 transfection reagent box operating instructions are carried out.Transfection supernatant inoculation Marc-145-Nsp9 is taken after transfecting 24 hours
Cell monolayer, adds the RPMI-1640 culture fluid containing volume fraction 2% serum and cultivates 4-5 days after inoculation, cell goes out
Existing it will be evident that initially present focal cell aggregation, become round, shrinkage, progressively disengage cell monolayer, finally
Disintegrate, coming off, the virus of rescue is the second filial generation (F2), and the viral nomenclature this obtained is rVJiangxi-3d102,
Then proceed on Marc-145-Nsp9 cell, cultivate Revive virus to 20 generations (F3～F20).
2. the growth kinetics analysis of replication defective virus
By PRRSV Jiangxi-3 strain the 20th generation, rVJiangxi-3d102 the 20th generation respectively with virus infection multiplicity
(Multiplicity of infection, MOI) is 0.1 to infect Marc-145 cell strain and Marc-145-Nsp9 respectively
Cell, 12,24,36,48,72h collect cell conditioned medium, collect 200 μ L every time, supplement 200 μ L simultaneously
New maintenance liquid.The supernatant of results is made 10 times of dilutions (10-1～10-8), each dilution virus liquid is inoculated in
The MARC-145 cell having grown up to monolayer in 96 orifice plates carries out TCID50 test.Calculate by Reed-Muench method
The TCID50 of virus, and with the viral growth curve of GraphPad Software on Drawing.Viral growth kinetic curve
As it is shown on figure 3, result shows that rVJiangxi-3d102 has similar life to parent's strain PRRSV Jiangxi-3 strain
Long period.
3. the qualification of replication defective virus
The RT-PCR of recombinant virus identifies: take above-mentioned cultivation replication defective virus the 5th generation (F5),
The each 200 μ L of 10th generation (F10), the 15th generation (F15) and the 20th generation (F20) virus-culturing fluid extract
Viral RNA primer Seq-F and Seq-R carries out RT-PCR amplification two ends, Nsp9 gene delection position
Sequence, and the RT-PCR product of amplification is carried out sequencing analysis, the virus N sp9 gene of result display rescue
Disappearance 102bp base is consistent with design, shows that saved virus has good hereditary stability.Wherein,
RVJiangxi-3d102(the 20th generation) compare knot with the partial sequence of PRRSV Jiangxi-3Nsp9 coding region
Fruit sees Fig. 4.
The indirect immunofluorescence (IFA) of replication defective virus is identified: express in IFA method and embodiment 2
The authentication method of the Marc-145 cell strain of Nsp9 gene is identical, and antibody used is PRRSV immunity Sanguis sus domestica
Clearly.Result infects Marc-145 cell after 36 hours as in figure 2 it is shown, Fig. 2 A is rVJiangxi-3d102
IFA qualification result, result does not has specificity fluorescent, shows that rVJiangxi-3d102 can not be thin at Marc-145
Born of the same parents are upper to replicate, and Fig. 2 B is that rVJiangxi-3d102 infection Marc-145-Nsp9 cell was carried out after 36 hours
IFA identifies, has specificity fluorescent seen from result, shows that rVJiangxi-3d102 obtains rescue can be
Marc-145-Nsp9 cell replicates.
The qualification of replication defective virus replication defective: rVJiangxi-3d102 is being grown respectively at monolayer
Marc-145-Nsp9 cell and Marc-145 cell are cultivated 4 days, examines under a microscope Marc-145-
Nsp9 cell creates obvious pathological changes, and Marc-145 cell does not produce any pathological changes.
Embodiment 4: pig breathes the method being used for producing vaccine with reproductive syndrome replication defective vaccine strain
Described pig breathes and is used for, with reproductive syndrome replication defective vaccine strain, the method that produces vaccine, by with
Lower step is carried out:
(1) the passing on and cultivating of seedling cell: by the Marc-145 cell line warp of stable expression Nsp9
EDTA-pancreatin cell dispersion liquid had digestive transfer culture, continues to cultivate with cell growth medium, when forming good monolayer,
Pass on or virus inoculation for continuing；
(2) breeding of cell seed culture of viruses: rVJiangxi-3d102 strain virus liquid is accessed by the volume of 1/10
Generate the cell bottle of monolayer, after adsorbing 1 hour, add cell maintenance medium in cell monolayer, continuation training
Support, gather in the crops after pathological changes occurs in 70-80% cell, rearmounted less than-15 DEG C of the venom freeze thawing of results 2-3 time
Preserve, take and do the inspection of semifinished product on a small quantity.
(3) Seedling, subpackage and lyophilizing are joined: by virus-culturing fluid qualified for inspection, press 1:1 with conventional stabilizer
Volume ratio mixing, fully shake up, quantitative separating；Every part is no less than 10 containing cell venom5.5TCID50,
Carry out rapidly lyophilization after subpackage to get product.
The vaccine strain that the present invention produces characteristic on cell: with pACYC177 plasmid as carrier, in insertion
State's highly pathogenic PRRS poison Jiangxi-3 strain complete nucleotide sequence in addition to Nsp9 partial sequence, therewith
Supporting production of vaccine cell line is the Marc-145 cell line having cloned Jiangxi-3 strain Nsp9 full genome,
The replication defective vaccine strain obtained stably can be bred in this cell line, makes cell at about 72 hours products
Raw cytopathy, in continuous passage 20 generation on cell, the multiplication characteristic of virus does not change, and gene is tied
Structure does not the most change.
One, the vaccine safety to this animal:
1, pig blue-ear disease replication defective vaccine (the 5th generation) (105.5TCID50) 30 ages in days are infected respectively
10 sodium selenites, infective dose is 3ml/ head pig, collunarium 2ml, and musculi colli injection 1ml, after infection
Respectively survey 1 body temperature morning and afternoon every day, observe clinical symptoms, after 30 days, take 5 slaughter rear Anatomical observation its
Lungs and the change of other organs.
All 10 pigs of result all raise without body temperature, and whole pigs survive.5 all internal organs of pig dissected
It is visible by naked eyes pathological change.
2, with pig blue-ear disease replication defective vaccine (the 10th generation) (105.6TCID50) infect 35 respectively
Age 10 sodium selenites, infective dose is 3ml/ head pig, collunarium 2ml, musculi colli injection 1ml, infect
Respectively survey 1 body temperature rear morning and afternoon every day, observe clinical symptoms, after 21 days, take 5 and slaughter rear Anatomical observation
Its lungs and the change of other organs.
The result people have 10 pigs all to raise without body temperature, and whole pigs survive.5 all internal organs of pig dissected
It is visible by naked eyes pathological change.
3, virus recovers replication capacity
PRRSV rVJiangxi-3 strain was returned in pig body continuously 5 generations, does not find that virus recovers duplication
Phenomenon.
Result shows: with pig blue-ear disease replication defective vaccine to pig safety.
Two, pig blue-ear disease replication defective rVJiangxi-3d102 strain vaccine potency test:
1, pig blue-ear disease replication defective vaccine (rVJiangxi-3d102 strain the 5th generation) is used
(105.5TCID50) 20 sodium selenites of immunity, counteracting toxic substances after 35 days, observe 21 days after counteracting toxic substances, after slaughtering
Its lungs of Anatomical observation and the change of other organs.Result of the test is as follows:
Safety: in after vaccination 35 days of all immune swines, all rises without body temperature, also without clinical condition
Shape.Prove vaccine safety.
Immunoprotection: antibody test result after immunity as it is shown in figure 5, after immune 2 weeks antibody test 100% sun
Property, within the 4th week, reach the highest；After attacking strong poison, all immune swines are all strong lives, and the body weight of three groups of immune swines increases
Add apparently higher than comparison pig.The pulmonary lesion protective rate of immune swine is 85%.
2, two groups of pig blue-ear disease replication defective vaccines (rVJiangxi-3d102 strain the 5th generation) are used
(105.5TCID50), after 5 times of dilutions, every batch of each immune 10 36 age in days sodium selenites, musculi colli is injected
2ml.Survey 1 body temperature every day, observe clinical symptoms, within 21st, slaughter its lungs of rear Anatomical observation and other organs
Change.Result of the test is as follows:
Immune group is fallen ill for one group 1/10, and 1/10 is dead, and another group 2/10 morbidity, 0/10 is dead, compares pig
10/10 morbidity, 8/10 is dead.
Result shows: can produce good protected effect with pig blue-ear disease replication defective vaccine immunity pig.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-mentioned enforcement
The restriction of example, the change made, modifies, replaces under other any spirit without departing from the present invention and principle
In generation, combine, simplify, all should be the substitute mode of equivalence, within being included in protection scope of the present invention.
Claims (6)
1. the method building virus replication-deficient PRRSV virus vaccine strain, it is characterised in that specifically wrap
Containing being: by PRRSV Jiangxi-3 strain lack part Nsp9 gene, obtain the Jiangxi-3 strain of replication defective
Infection clones, is cloned into Marc-145 cell by the Nsp9 gene of PRRSV Jiangxi-3 strain simultaneously, makes
It stably expresses Nsp9 albumen, by the PRRSV Jiangxi-3 strain infection clones transfection expression of replication defective
The Marc-145 cell of Nsp9 albumen, saves out the rVJiangxi-3d102 strain with replication capacity, it is thus achieved that multiple
Defective PRRSV virus vaccine strain processed；
Described PRRSV Jiangxi-3 strain derives from 2006 " hyperpyrexia disease " period from the separation of pig farm, Jiangxi Province
Identify, its GenBank Accession Number:EU200961.1；
Described lack part Nsp9 gene is disappearance PRRSV Jiangxi-3 pnca gene group sequence GenBank
The nucleoside from 5 ' the 8241st to 8342 shown 102nt of end of Accession Number EU200961.1
Acid fragment.
The method of structure virus replication-deficient PRRSV virus vaccine strain the most according to claim 1,
It is characterized in that: described is utilization reverse genetic by PRRSV Jiangxi-3 strain lack part Nsp9 gene
Operation and gene recombination technology realize.
The method of structure virus replication-deficient PRRSV virus vaccine strain the most according to claim 1,
It is characterized in that: described lack part Nsp9 gene is disappearance PRRSV Jiangxi-3 pnca gene group sequence
GenBank Accession Number EU200961.1's is shown from 5 ' end the 8241st to 8342
The nucleotide fragments of 102nt, and in the 8241st to 8342, insert restriction endonuclease sites.
The method of structure virus replication-deficient PRRSV virus vaccine strain the most according to claim 3,
It is characterized in that: described restriction endonuclease sites is restricted enzyme Sbf I site.
5. a virus replication-deficient PRRSV virus vaccine strain, described in any one of Claims 1 to 4
Method prepare.
6. the virus replication-deficient PRRSV virus vaccine strain described in claim 5 preparation prevention and/or
Treatment pig breathes and the application in reproductive syndrome vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310703956.3A CN103773740B (en) | 2013-12-19 | 2013-12-19 | Pig breathes the structure with reproductive syndrome virus replication defective virus vaccine strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310703956.3A CN103773740B (en) | 2013-12-19 | 2013-12-19 | Pig breathes the structure with reproductive syndrome virus replication defective virus vaccine strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103773740A CN103773740A (en) | 2014-05-07 |
| CN103773740B true CN103773740B (en) | 2016-08-17 |
Family
ID=50566507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310703956.3A Expired - Fee Related CN103773740B (en) | 2013-12-19 | 2013-12-19 | Pig breathes the structure with reproductive syndrome virus replication defective virus vaccine strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103773740B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834348B (en) * | 2017-03-20 | 2020-05-08 | 西北农林科技大学 | Porcine reproductive and respiratory syndrome virus with fluorescent marker and construction method and application thereof |
| CN109943590B (en) * | 2019-04-18 | 2022-11-18 | 西南大学 | Replication-defective porcine circovirus, preparation method and application thereof |
| CN111662885A (en) * | 2020-06-22 | 2020-09-15 | 扬州大学 | Construction, rescue and application of infectious clone of virulent and attenuated strains of two highly homologous genome porcine reproductive and respiratory syndrome viruses |
| CN112094952A (en) * | 2020-10-28 | 2020-12-18 | 云南农业大学 | Complete set of primer pair for porcine reproductive and respiratory syndrome virus whole genome determination and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101220351A (en) * | 2007-12-07 | 2008-07-16 | 中国农业大学 | Method for constructing PRRSV gene deletion vaccine toxin strain by using Nsp2 gene deletion and uses thereof |
| CN101848995A (en) * | 2007-06-25 | 2010-09-29 | 南达科他州立大学 | Recombinant north american type 1 porcine reproductive and respiratory syndrome virus and methods of use |
| CN102250843A (en) * | 2011-06-01 | 2011-11-23 | 中国农业科学院上海兽医研究所 | Genetic engineering marked attenuated vaccine strain of porcine reproductive and respiratory syndrome virus and application thereof |
| CN102660545A (en) * | 2012-06-04 | 2012-09-12 | 中国农业科学院兰州兽医研究所 | Ribonucleic acid interference (RNAi) for inhibiting porcine reproduction and respiratory syndrome virus replication and preparation method of RNAi |
| CN103087996A (en) * | 2013-01-18 | 2013-05-08 | 中国农业大学 | Recombinant porcine reproductive and respiratory syndrome virus as well as preparation method and application thereof |
-
2013
- 2013-12-19 CN CN201310703956.3A patent/CN103773740B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101848995A (en) * | 2007-06-25 | 2010-09-29 | 南达科他州立大学 | Recombinant north american type 1 porcine reproductive and respiratory syndrome virus and methods of use |
| CN101220351A (en) * | 2007-12-07 | 2008-07-16 | 中国农业大学 | Method for constructing PRRSV gene deletion vaccine toxin strain by using Nsp2 gene deletion and uses thereof |
| CN102250843A (en) * | 2011-06-01 | 2011-11-23 | 中国农业科学院上海兽医研究所 | Genetic engineering marked attenuated vaccine strain of porcine reproductive and respiratory syndrome virus and application thereof |
| CN102660545A (en) * | 2012-06-04 | 2012-09-12 | 中国农业科学院兰州兽医研究所 | Ribonucleic acid interference (RNAi) for inhibiting porcine reproduction and respiratory syndrome virus replication and preparation method of RNAi |
| CN103087996A (en) * | 2013-01-18 | 2013-05-08 | 中国农业大学 | Recombinant porcine reproductive and respiratory syndrome virus as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Construction and evaluation of genetically engineered replication-defective porcine reproductive and respiratory syndrome virus vaccine candidates;Siao-Kun Wan Welch et al.;《Veterinary Immunology and Immunopathology》;20041231;第102卷;第277-290页 * |
| Recovery of viable porcine reproductive and respiratory syndrome virus from an infectious clone containing a partial deletion within the Nsp2-encoding region;Z. G. Ran et al.;《Arch Virol》;20081231;第153卷;第899-907页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103773740A (en) | 2014-05-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Le Gall-Reculé et al. | Characterisation of a non-pathogenic and non-protective infectious rabbit lagovirus related to RHDV | |
| CN110551695A (en) | African swine fever virus four-gene deletion low virulent strain and application thereof | |
| CN101514334B (en) | Chicken infectivity bronchitis virus attenuated vaccine strain and application thereof | |
| CN109762792B (en) | Porcine reproductive and respiratory syndrome virus chimeric strain and application thereof | |
| CN101280292B (en) | Virus velogen strain for porcine reproductive and respiratory syndrome, attenuated vaccine strain thereof and application thereof | |
| CN109385435B (en) | A kind of recombination PRRSV virus-like particle and its preparation with immunogenicity | |
| CN103773740B (en) | Pig breathes the structure with reproductive syndrome virus replication defective virus vaccine strain and application | |
| CN101380468A (en) | Porcine reproductive and respiratory syndrome bivalence recombinant adenovirus vaccine and preparation method thereof | |
| CN102757942A (en) | Recombinant vaccine strain for foot-and-mouth disease type A as well as preparation method thereof and application thereof | |
| Wang et al. | Changes in VP2 gene during the attenuation of very virulent infectious bursal disease virus strain Gx isolated in China | |
| CN109402145B (en) | A kind of preparation method of immunity enhancement type recombination PRRSV virus-like particle subunit vaccine | |
| CN102221618B (en) | Method for establishing hog cholera lapinized virus labeled vaccine strain and preparing vaccine | |
| CN103468651A (en) | Recombination Newcastle vaccine strain rAI4-S1 for expressing infectious bronchitis virus S1 protein and generating method thereof | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN104561092B (en) | Express construction method and the application of CSFV E 2 protein recombination PRRS viral genetic engineering vaccine | |
| Jiang et al. | Recombinant infectious bronchitis coronavirus H120 with the spike protein S1 gene of the nephropathogenic IBYZ strain remains attenuated but induces protective immunity | |
| CN104250638B (en) | Porcine reproductive and respiratory syndrome virus attenuated strain, vaccine composition and preparation method and application thereof | |
| CN105400745B (en) | A kind of porcine reproductive and respiratory syndrome virus gene engineered strain and its inactivated vaccine and vaccine preparation method | |
| Li et al. | Isolation and oral immunogenicity assessment of porcine epidemic diarrhea virus NH-TA2020 strain: One of the predominant strains circulating in China from 2017 to 2021 | |
| CN110305852A (en) | Express the building of Porcine epidemic diarrhea virus S1 genetic recombination pseudorabies virus | |
| CN109395073A (en) | A kind of immunity enhancement type recombination PRRSV virus-like particle subunit vaccine | |
| CN115386556B (en) | Gene engineering vaccine for serially expressing gene recombination pseudorabies virus of African swine fever virus P30 and P54 and application thereof | |
| CN102363770A (en) | Recombinant baculovirus capable of expressing porcine circovirus type 2 Cap protein and somatostatin in fusion manner, and subunit vaccine thereof | |
| CN101422608A (en) | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence | |
| CN106916832A (en) | O-shaped foot and mouth disease virus recombinant nucleic acid, recombinant vaccine strain and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160817 Termination date: 20181219 |