CN103751783A - Function of IRF1 in aortic constriction disease and application of inhibitor thereof - Google Patents

Abstract

The invention discloses a function of IRF1 in aortic constriction disease and an application of an inhibitor thereof, belonging to the fields of gene function and application. The invention uses IRF1 gene-deleted mice and heart-specific IRF1 transgenic mice as experimental subjects, and conducts myocardial hypertrophy and myocardial fibrosis and heart function detection, results show that compared with a wild type, the degree of myocardial hypertrophy and myocardial fibrosis in IRF1 gene deleted mice is significantly inhibited, while the degree of myocardial hypertrophy and myocardial fibrosis in heart-specific IRF1 transgenic mice is aggravated to some extent and heart function is distinctly worsened, thus indicating that IRF1 gene has effect of promoting incidence and progression of aortic constriction-associated diseases, IRF1 can be used as drug target for screening medicaments for treating aortic constriction associated diseases, and an IRF1 inhibitor can be used for preparing medicaments for treating aortic constriction-associated diseases.

Description

The function of IRF1 in aorta arch constriction disease and the application of inhibitor thereof

Technical field

The invention belongs to function and the application of gene, particularly a kind of IRF1(interferon regulatory factor 1, IRF1) function in aorta arch constriction relevant disease and the application of inhibitor thereof.

Background technology

According to World Health Organization's report, cardiovascular disease has become one of global Chronic Non-Communicable Diseases threatening human life's health.At present, chronic heart failure case fatality rate increases rapidly, becomes without doubt one of important disease threatening human life.Basis and clinical research confirmation heart failure are come by myocardial hypertrophy (Cardiac Hypertrophy) differentiation often, myocardial hypertrophy refers to that heart is under the effect of heredity, environment, multiple physiology and pathological factor, in order to adapt to heart acting, increase and cardiac weight and the volume increase of appearance, mainly take the increase of myocardial cell volume and extracellular matrix, increase as feature.Research shows, myocardial hypertrophy is the common pathophysiological process of the multiple cardiovascular disease such as coronary heart disease, hypertension, arrhythmia, valvular heart disease and cardiomyopathy, significantly increase sickness rate and the case fatality rate of heart failure, and be the independent hazard factor of multiple cardiovascular complication.In addition,, along with the progress of left ventricular hypertrophy, the incidence rate of the cardiovascular events such as myocardial ischemia, malignant ventricular arrhythmia, heart failure, sudden cardiac death increases 6-10 doubly.Therefore, the mechanism of illustrating myocardial hypertrophy generation development is significant to cardiovascular serious symptoms such as control chronic heart failures, studying its molecular mechanism can be the following novel targets based theoretical of finding control myocardial hypertrophy, and produces far-reaching clinical practice meaning and vast social value.

Myocardial hypertrophy refers to that heart is under the effect of heredity, environment, multiple physiology and pathological factor, in order to adapt to heart acting, increases and cardiac weight and the volume increase of appearance, mainly take the increase of myocardial cell volume and extracellular matrix, increases as feature.Myocardial hypertrophy is regulated by many factors, and is a kind of dynamic process of complexity.Research show lasting pressure and/or volume load excessive, can increase locular wall stress, cause myocardial hypertrophy.Substantially visible cardiac weight obviously increases, ventricular structure changes; Visible on cellular level, myocardial cell length and/or width increase, and muscle segment quantity increases, arrangement disorder, and collagen content increases, fibrous tissue hyperplasia, and cell arrangement disorder is loose; On molecular level, various born of the same parents' external stimulus signals such as transforming growth factor-beta, Angiotensin II, Endothelin, catecholamine can be transduceed by activation signal, the expression of inducing embryo type gene, changes thereby impel cell that loose phenotype occurs, and finally causes cardiac myocyte hypertrophy.But existing research can not be annotated the mechanism of myocardial hypertrophy completely.Therefore, find the specific molecular that suppresses myocardial hypertrophy, for the generation development mechanism of further elaboration myocardial hypertrophy, there is great theory significance, can be clinical prevention myocardial hypertrophy novel targets and New Policy are provided.

IRF1 is a member of interferon regulatory factor family (IRFs), in numerous immunoreation, is a multi-functional transcription regulaton factor.Under different conditional stimuluss, IRF1 optionally works in the immune response in different cells.In many pernicious diseases in the blood system, as acute leukemia (AL), myelodysplastic syndrome (MDS) and kinds cancer, all with the unconventionality expression of IRF1 gene.The various biological function that IRF1 has has at present been subjected to people's extensive concern, IRF1 not only can induce the expression that activates IRFS, or a kind of cancer suppressor protein, because IRF1 has tumor-suppression activity, it is again transcription factor, the target gene of its effect is one of focus of people's research in recent years, and this further investigation will be contributed to disclose the pathogenesis of tumor.In addition, IRF1 gene can also make the immunologic cytotoxicity effect that NK cell, macrophage are brought into normal play.IRF1 is as transcription factor important in body, and discovered in recent years it also damage closely related with generation, bringing out property of the cytokine islets of langerhans of ischemic brain injury.

Summary of the invention

For solving defect and the deficiency of above-mentioned prior art, the object of the present invention is to provide the application in the medicine of preparation treatment aorta arch constriction disease of a kind of IRF1 and inhibitor thereof.

Object of the present invention is achieved through the following technical solutions:

The function of IRF1 in aorta arch constriction relevant disease, is mainly reflected in IRF1 gene and has and worsen the effect, particularly IRF1 gene of cardiac function and can increase the weight of the effect that promotes that aorta arch constriction relevant disease occurs.

For the above-mentioned functions of IRF1, provide IRF1 application in the medicine of screening cardioprotection function as drug targets.

For the above-mentioned functions of IRF1, provide IRF1 application in the medicine of screening treatment aorta arch constriction disease as drug targets.

For the above-mentioned functions of IRF1, the application of the inhibitor that IRF1 is provided in the medicine of preparing cardioprotection function.

A medicine for cardioprotection function, the inhibitor that comprises IRF1.

For the above-mentioned functions of IRF1, provide the inhibitor of IRF1 in the application of preparing in the medicine for the treatment of aorta arch constriction disease.

Treat a medicine for aorta arch constriction disease, the inhibitor that comprises IRF1.

The inhibitor of described IRF1 is preferably the siRNA of IRF1 gene, the rna interference vector of IRF1 gene, and the antibody of IRF1 and other can suppress the one in inhibitor that IRF1 expresses.

The present invention is take IRF1 knock out mice and specific heart IRF1 transgenic mice as experimental subject, by coarctation of aorta art, build mouse cardiac muscle plumpness (AB) model, carried out the detection of AB model mice myocardial hypertrophy and fibrosis and cardiac function, result shows to contrast with wild-type mice, IRF1 knock out mice myocardial hypertrophy and Fibrotic degree are obviously suppressed, and the myocardial hypertrophy of specific heart IRF1 transgenic mice and fibrosis increase to a certain extent, and cardiac function obviously worsens.This prompting IRF1 has the effect that worsens cardiac function, can promote myocardial hypertrophy and Fibrotic development, for novel targets and the New Policy of research control myocardial hypertrophy provide theoretical foundation and Clinical Basis.

Result of study of the present invention shows, in the myocardial hypertrophy that IRF1 knock out mice causes in coarctation of aorta, after IRF1 gene knockout, mouse cardiac muscle is plump and Fibrotic degree is obviously suppressed, and myocardial hypertrophy and the fibrosis of specific heart IRF1 transgenic mice increase the weight of to a certain extent.Proved that IRF1 gene has important deterioration effect in coarctation of aorta relevant disease model.

The present invention has following advantage and effect with respect to prior art:

(1) the present invention finds the new function of IRF1 gene, and IRF1 gene has the effect that can worsen aorta arch constriction relevant disease.

(2) function in deterioration aorta arch constriction relevant disease based on IRF1 gene, is the drug provision target of development aorta arch constriction relevant disease.

(3) inhibitor of IRF1 can be used for preparing the medicine of cardioprotection function and treatment aorta arch constriction disease.

Accompanying drawing explanation

Fig. 1 be IRF1+ /+and IRF1-/-mice AB model 4 weeks after psychosoma than (HW/BW), lung body than (LW/BW) and heart shin than the statistics block diagram of (HW/TL).

Fig. 2 be IRF1+ /+and IRF1-/-mice AB model 4 weeks after heart tissue HE dyeing and myocardial cell cross-sectional area statistics block diagram.

Fig. 3 be IRF1+ /+and IRF1-/-mice AB model 4 weeks after heart tissue Picro-Sirius red dyeing and left chamber area of collagen statistics block diagram.

Fig. 4 be NTG and IRF1-TG mice AB model after 4 weeks psychosoma than (HW/BW), lung body than (LW/BW) and heart shin than the statistics block diagram of (HW/TL).

Fig. 5 is NTG and the rear heart tissue HE dyeing in 4 weeks of IRF1-TG mice AB model and myocardial cell cross-sectional area statistics block diagram.

Fig. 6 is NTG and the rear heart tissue Picro-Sirius red dyeing in 4 weeks of IRF1-TG mice AB model and left chamber area of collagen statistics block diagram.

Fig. 7 be IRF1+ /+and IRF1-/-mice AB model 4 weeks after ultrasound detection cardiac function result statistics block diagram, wherein, HR is that mice heart rate, LVEDd are that LVED (Left Ventricular End Systolic Dimension), LVESd are that left chamber end systolic diameter, EF are that ejection fraction and FS are shortening fraction.

Fig. 8 be IRF1+ /+and IRF1-/-mice AB model 4 weeks after PV detect hemodynamic results statistics block diagram, wherein, EF is ejection fraction, dP/dt max is that the maximum climbing speed of left indoor pressure and dP/dt min are the minimum climbing speed of left indoor pressure.

Fig. 9 is NTG and 4 weeks rear ultrasound detection cardiac function result statistics block diagrams of IRF1-TG mice AB model, wherein, HR is that mice heart rate, LVEDd are that LVED (Left Ventricular End Systolic Dimension), LVESd are that left chamber end systolic diameter, EF are that ejection fraction and FS are shortening fraction.

Figure 10 is that NTG and 4 weeks rear PV of IRF1-TG mice AB model detect hemodynamic results statistics block diagram, and wherein, EF is ejection fraction, and dP/dt max is that the maximum climbing speed of left indoor pressure and dP/dt min are the minimum climbing speed of left indoor pressure.

The specific embodiment

Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited to this.

Animal for research and raising

Laboratory animal: select age in 8-10 week, body weight at 23.5-27.5g, background is the specific heart Cre mice (α-MHC-Cre(name IRF1+ /+) of male C57BL/6 strain, background is C57BL/6, purchased from Jackson Laboratory, article No. 005650), IRF1 knock out mice (IRF1-KO, B6.129 background, purchased from Jackson Laboratory, article No. 002762; The IRF1-KO buying back and C57BL/6 wild-type mice at least 5 generations that backcrossed, the IRF1-KO mice that obtains C57BL/6 is for experiment), non-transgenic mice (NTG, background is C57BL/6, purchased from China bio tech ltd, Fukang, Beijing) and specific heart IRF1 transgenic mice (IRF1-TG, background is C57BL/6, and in its heart tissue, the expression of IRF1 is approximately 3 times of NTG) be experimental subject.

The structure of specific heart IRF1 transgenic mice:

Transgene carrier builds information: with primer (forward primer: GCCACCATGAAGCTTATGCCAATCACTCGA

ATGCG; Downstream primer: GTATGGGTAAAGCTTTGGTGCACAAGGAATGGCCT) amplification mice IRF1 full-length gene (NCBI, Gene ID:16362, XM_006532308.1), again mouse α-MHC Promoter, IRF1 gene and hGH polyA are linked in order on pBlueScript SK+ carrier and obtain transgene carrier, transgene carrier, by the microinjection embryo's (C57BL/6J background) that is configured to be fertilized, is obtained to specific heart IRF1 transgenic mouse.(above-mentioned transgenic mice is prepared with reference to following document: Jiang DS; Bian ZY; Zhang Y; Zhang SM; Liu Y, Zhang R et al. Role of interferon regulatory factor 4 in the regulation of pathological cardiac hypertrophy. Hypertension 2013; 61:1193-1202.)

Feeding environment: all experiment mices are all raised in the SPF of Wuhan University angiocardiopathy institute level Experimental Animal Center.Mice special feed is provided by Chinese military medicine academy of science animal center.Raising condition: room temperature is between 22-24 ℃, and humidity is between 40-70%, and it is 12h that light and shade replaces lighting hours, freely drinks water and ingests.

Embodiment 1 myocardial hypertrophy (AB) model obtains

1. laboratory animal grouping: male C57BL/6 wild-type mice (IRF1+ /+), IRF1 knock out mice (IRF1-/-) and specific heart IRF1 transgenic mice (TG) and non-transgenic mice (NTG), by coarctation of aorta art, set up myocardial hypertrophy model.Be divided at random 8 groups, be grouped as follows: C57BL/6 strain wild-type mice sham operated rats (IRF1+ /+SHAM) and AB art group (IRF1+ /+AB), IRF1 knock out mice sham operated rats (IRF1-/-SHAM) and AB art group (IRF1-/-AB), non-transgenic mice sham operated rats (NTG SHAM) and AB art group (NTG AB), specific heart IRF1 transgenic mice sham operated rats (TG SHAM) and AB art group (TG AB).

2. myocardial hypertrophy model adopts aorta arch constriction operation, model manipulation flow process:

2.1 preoperative preparations

(1) anesthesia: first weigh to mice, calculate required anaesthetic (3% pentobarbital sodium) amount according to 90mg/kg body weight, by lumbar injection, and record some inject time.Folder tail, folder toe without significant reaction and mice in good condition be the successful standard of anesthesia (after general injection, about 10min, without significant reaction, responds to anaesthetize rear about 50min mice folder toe, and after anesthesia, 30min left and right is best operating time).

(2) prepare in art district: by the skin unhairing of left mice chest, left side chest and left fore oxter.Shave Mao Houyong wet gauze wiping art district and remove Mus hair, not affect surgical field of view, be advisable.

(3) tracheal intubation: with rubber band, mice is gone up to front tooth and be fixed on V shaped slab inclined-plane, and rapidly tracheal intubation is accurately inserted in trachea through glottis, right arm reclining is placed in (heating cushion need shift to an earlier date preheating) on heating cushion subsequently, then tracheal intubation is connected with respirator, fixing mice.If it is consistent with respirator frequency that the thorax of mice rises and falls, tracheal intubation success is described.

2.2 aortic arch descending branch ligations

Get right arm reclining, mice left fore is placed in right fore top, and two forelimbs is fixed with medical adhesive tape.Right chest below is encased inside cotton swab, raises thorax, is that 75% ethanol is to operative region skin degerming successively by iodine tincture and volume fraction.Left hand is held ophthalmic tweezers left skin of chest has been pinched, the right hand is held eye scissors and is cut off the about 1cm of skin, separating muscle and soft tissue successively, in 2-3 rib horizontal opening thoracic cavity, with cotton swab, slightly push left lung aside, aortic arch descending branch dissociates, 7-0 sutures is passed to blood vessel, and above blood vessel one section of 26G(25.0-27.5g mice of parallel placement) or 27G(23.5-25.0g) syringe needle, by blood vessel and syringe needle, ligation is good together, then extracts syringe needle out and can reach the Vasoconstriction of respective degrees.After ligation, sew up successively, close thoracic cavity, with syringe, from sealing insertion thoracic cavity and extract 1cc gas out to recover negative pressure in thoracic cavity, extract rapid skin suture otch after syringe.Sham operated rats (SHAM) is dissociating a not ligation of threading after aorta descending branch, the same myocardial hypertrophy of remaining step (AB) model group.

2.3 postoperative care

After aortic arch descending branch ligation, treat that mice occurs that kickback appears in autonomous respiration, folder toe, extract tracheal intubation, and mice is put into the rearging cage of the bedding and padding, feedstuff and the drinking water that autoclaving are housed and cross, in receptacle, continue breeding observing.Postoperative 4 weeks of IRF1 knock out mice and wild-type mice, non-transgenic mice and the postoperative detection of carrying out respectively indices for 4 weeks of specific heart IRF1 transgenic mice.

Embodiment 2 mouse cardiac muscle plumpness (AB) model myocardial hypertrophies and fibrosis detect

1. draw materials

(1) previous work: prepare the urine cup of volume fraction 10% formaldehyde that 20mL is housed in advance, and post label (mice numbering, group, type of surgery and draw materials the date).The culture dish that fills mass fraction 10% KCl solution is placed in to the place that draws materials.Open analytical balance, return to zero standby.Weigh again and put to death mice.

(2) draw materials: the curved tweezer of ophthalmology is clamped the vessel pedicle of auricle below, cuts heart, is placed in rapidly mass fraction 10% KCl solution.Until cardiac arrest, after relaxing period, be placed on sterile gauze, push gently heart intracavity liquid, dip in after dry surface liquid, weigh and record, heart is put into corresponding urine cup, after fixing 48h, for pathology, detect.

(3) measurement of correlation and calculating: take out mice lungs, after pruning, filter paper blots, and weighs and record.Cut off mouse hind leg tibia place skin, measure and record tibia length.Calculate the heavy ratio (HW/BW) with body weight of the heart, the heavy ratio (HW/TL) with tibia length of the heavy ratio (LW/BW) with body weight of lung and the heart.

2. pathology detect

2.1 prepare paraffin specimen section

By laboratory specialty pathology staff, prepare paraffin specimen section, main operation sequence comprises pruning heart → embedding frame processing → flowing water flushings → dehydration → transparent → waxdip → embedding → section → stand sheet → dry or toast standby afterwards.

2.2 hematoxylin-eosins (HE) dyeing

Key step is: 55 ℃ of baking 30min → dimethylbenzene 5min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → distilled water 1min → haematoxylin solution (Zhuhai shellfish rope, BA-4021) 5min → washing 1min → 1% hydrochloride alcohol (getting 3mL concentrated hydrochloric acid fully mixs homogeneously with 297mL 70% ethanol) 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, Magnesium sulfate heptahydrate 2g, both are dissolved in 100mL distilled water) 1min → washing 1min → Yihong solution (Zhuhai shellfish rope, BA-4024) 3-5min → distilled water washes away loose colour → 70% ethanol 1s → 95% ethanol 1s → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of in the not dry mounting → fume hood immediately of dimethylbenzene and dry up, microscope is taken pictures.

HE dyeing picture statistics: every pictures is selected more than 3 clear border, and core is roughly positioned at central cell, with Image-Pro Plus 6.0 software circle cell areas.

2.3 Picro-Sirius reds (PSR) dyeing

Key step is: 55 ℃ of baking 30min → dimethylbenzene 2min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% ethanol 1min → flowing water rinses 10min → distilled water 1min → mass fraction 0.2% phosphomolybdic acid 2min → 0.1% sirius red picric acid solution and drips in tissue, 90min → removal residual liquid → 0.01N hydrochloric acid 4s → 70% ethanol 1 time → 90% ethanol 1 time → 100% ethanol 30s dyes in wet box, 3 times → dimethylbenzene 2min, 3 times → take advantage of the not dry coverslip immediately of dimethylbenzene mounting, microscope is taken pictures.

PSR dyeing picture statistics: collagen ratio=area of collagen/(gross area-blank area) × 100%.

Cardiac muscular tissue is comprised of myocardial cell and stroma, and heart is a whole end differentiation organ, and myocardial cell loses multiplication capacity, and the myocardial cell reaction that various physiology or pathological stimuli cause can only be that the volume of individual cells increases and can not quantitatively breed.Therefore,, in the pathophysiological process of myocardial hypertrophy, main manifestations is that myocardial cell volume increases, muscle segment quantity increases, cell arrangement disorder, and heart interstitial changes the propagation and the conversion that comprise Cardiac Fibroblasts, collagen fiber density increases, and collagen secretion increases, collagen proportional balancing method imbalance etc.

IRF1+ /+and IRF1-/-mice AB model after phenotype the results are shown in Figure 1, Fig. 2, Fig. 3.SHAM(sham-operation) the equal not statistically significant of difference in group between IRF1+ /+mice and HW/BW, LW/BW and the HW/TL of IRF1-/-mice; IRF1+ /+mice AB HW/BW of postoperative 4 weeks, LW/BW, HW/TL are higher than its SHAM group; Postoperative 4 weeks of AB, HW/BW, the LW/BW of IRF1-/-mice and HW/TL all reduce (Fig. 1) compared with IRF1+ /+mice.HE stained can be observed: SHAM group heart no significant difference, and AB group all increases compared with the heart of SHAM group, and the heart of IRF1-/-mice is significantly less than IRF1+ /+group mice; SHAM group myocardium myo fibril cell arrangement is neat, fine and close, complete form, and karyon and nucleolar structure are clear; AB group myofilament arrangement disorder, loose, myocardial cell volume obviously increases, form irregularity, karyon engrain, increase, deformity, kernel is fuzzy, and IRF1-/-group is obviously loose without IRF1+ /+group cell; The postoperative myocardial cell cross-sectional area of IRF1-/-mice AB is greater than its SHAM group, is less than IRF1+ /+mice AB group, and difference has statistical significance (Fig. 2).After PSR dyeing, find that AB group myocardium of ventricle interstitial collagen content increases compared with SHAM group, arteries collagen increase is around more obvious, and collagen increases thick, and it is network-like that arrangement disorder becomes; Around collagen content is obvious without IRF1+ /+postoperative increase of mice AB for IRF1-/-postoperative collagen content of mice AB and blood vessel; No difference of science of statistics between SHAM group (Fig. 3).

Fig. 4, Fig. 5, Fig. 6 are the phenotype results after NTG and IRF1-TG mice AB model.Same the TG mice AB HW/BW of postoperative 4 weeks, LW/BW and HW/TL are higher than its SHAM group; The degree that HW/BW, the LW/BWL of postoperative 4 weeks TG mices of AB and HW/TL increase is obviously greater than NTG mice (Fig. 4).Heart phenotype, AB group all increases compared with the heart of SHAM group, and the degree that the postoperative TG mouse heart of AB increases is much larger than NTG mice.HE stained can be observed: the postoperative myocardial cell cross-sectional area of TG mice AB is greater than SHAM group, is significantly greater than NTG mice AB group (Fig. 5).PSR dyeing is visible, and the postoperative myocardium interstitial collagen content of TG mice AB and blood vessel around collagen content are all greater than NTG mice AB group (Fig. 6).

Embodiment 3 myocardial hypertrophies (AB) model mice cardiac function detects

1 ultrasound detection cardiac function

1.1 early-stage preparations

(1) anesthetic machine is prepared: first connect the intake interface on oxygen cylinder and anesthetic machine, then turn on dosing mouth seal cover on anesthetic machine, add rapidly isoflurane to tighten seal cover to safe scale.Turn on total valve on oxygen cylinder, adjust the knob of flow control valve, go out atmospheric pressure and maintain 0.2-0.3mPa.

(2) mice to be measured is prepared: mice to be detected is with isoflurane rapidly after anesthesia, and hair is shaved in left anterior pectorial region, by the mouse head of handling well stretch into anesthetis conduit pullover in, with 1.5-2.0% isoflurane, maintain the stable narcotism of mice.

1.2 cardiac function detect

Mice is got left lateral position or dorsal position, and evenly smears ultrasonic coupling agent (Tianjin Cheng Xin company) shaving hair-fields.Adopt high-frequency ultrasound in diagnosis instrument, frequency is 15MHz, selection standard papillary muscles of left ventricle minor axis tangent plane, measures mice heart rate (HR), LVED (Left Ventricular End Systolic Dimension) (LVEDd), left chamber end systolic diameter (LVESd), ejection fraction (EF) and shortening fraction (FS).

2 cardiac catheters ultrasonic (PV) detect hemodynamics

2.1 early-stage preparations

(1) anesthetic machine is prepared: with ultrasound detection cardiac function part.

(2) mice to be measured is prepared: mice to be detected is with isoflurane rapidly after anesthesia, and hair is shaved in operation on neck district, and by wet gauze wiping unhairing.By the mouse head of handling well stretch into anesthetis conduit pullover in, with 1.5-2.0% isoflurane, to maintain depth of anesthesia, avoid anaesthetizing dark or excessively shallow.

2.2 PV detect

After iodine tincture and 75% alcohol disinfecting, cut off mice skin of neck, separating muscle and soft tissue successively, and the right common carotid artery of dissociating pass two-wire ligation distal end under blood vessel, simultaneously slip-knot ligation proximal part.With vascular scissors, at distal end, cut a kerf (1/3-1/2 caliber), under stereomicroscope, Millar1.4F ultra micro conduit is inserted rapidly to right common carotid artery, wear a suture by conduit and vascular ligation simultaneously.Open proximal part slip-knot, conduit is inserted in left ventricle along right common carotid artery-ascending aorta, connect Powerlab System of organism signal.Waveform situation on observation recorder, regulates the position of conduit to make oscillogram clear and stable.The indexs such as monitoring ejection fraction, the maximum climbing speed of left indoor pressure (dP/dt max) and the minimum climbing speed of left indoor pressure (dP/dt min).

The present embodiment uses M type ultrasoundcardiogram and hemodynamics to detect and evaluates myocardial hypertrophy and cardiac function.Fig. 7, Fig. 8 be IRF1+ /+and IRF1-/-mice AB model after ultrasound detection cardiac function result figure.Compared with IRF1+ /+SHAM group, IRF1+/postoperative 4 weeks of+mice AB shows decreased cardiac function and myocardial hypertrophy, and index LVEDd, the LVESd that main manifestations is myocardial hypertrophy increases, and index EF, the FS of reaction cardiac function decline.Postoperative 4 weeks of AB, the degree that the index of the degree that the index of IRF1-/-mouse cardiac muscle plumpness increases and reaction cardiac function declines is obvious without IRF1+ /+mice, the equal no significant difference of HR.Between SHAM group IRF1+ /+mice and the above index of IRF1-/-mice, difference is very micro-, all no difference of science of statistics (Fig. 7).By the detection of hemodynamic index, observe postoperative 4 weeks IRF1+ /+mice dP/dt max of AB and dP/dt min and all than its SHAM group, reduce, the postoperative IRF1-of AB/-mice EF, dP/dt max and dP/dt min compared with IRF1+ /+mice AB significantly raise (Fig. 8).

Fig. 9, Figure 10 are the ultrasonic and PV testing results after NTG and IRF1-TG mice AB model.Compared with NTG SHAM group, NTG mice AB shows decreased cardiac function and myocardial hypertrophy for postoperative 4 weeks.Main manifestations is that index LVEDd, the LVESd of myocardial hypertrophy increases, and index EF, the FS of reaction cardiac function decline.Postoperative 4 weeks of AB, compared with NTG mice, the degree that the index of the degree that the index of TG mouse cardiac muscle plumpness increases and reaction cardiac function declines is greater than NTG group, the equal no significant difference of HR, between SHAM group NTG mice and the above index of TG mice, difference is very micro-, all no difference of science of statistics (Fig. 9).By the detection of hemodynamic index, observing postoperative 4 weeks NTG mice dP/dt max of AB and dP/dt min all reduces than its SHAM group, the postoperative EF of TG mice AB, the degree that dP/dt max and dP/dt min reduce is greater than NTG group, and difference has statistical significance (Figure 10).

Above-mentioned result of study shows, in the myocardial hypertrophy that IRF1 knock out mice causes in coarctation of aorta, after IRF1 gene knockout, mouse cardiac muscle plumpness and Fibrotic degree obviously reduce, and myocardial hypertrophy and the fibrosis of specific heart IRF1 transgenic mice increase to a certain extent.Proved that IRF1 gene has important deterioration effect in coarctation of aorta relevant disease model, its inhibitor can be used for the medicine of preparation treatment aorta arch constriction disease.

Above-described embodiment is preferably embodiment of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and principle, substitutes, combination, simplify; all should be equivalent substitute mode, within being included in protection scope of the present invention.

SEQUENCE LISTING

<110> Wuhan University

The function of <120> IRF1 in aorta arch constriction disease and the application of inhibitor thereof

<130> 1

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> forward primer

<400> 1

gccaccatga agcttatgcc aatcactcga atgcg 35

<210> 2

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> downstream primer

<400> 2

gtatgggtaa agctttggtg cacaaggaat ggcct 35

Claims (7)

1.IRF1 is the application in the medicine of screening cardioprotection function as drug targets.

2.IRF1 is the application in the medicine of screening treatment aorta arch constriction disease as drug targets.

The application of the inhibitor of 3.IRF1 in the medicine of preparing cardioprotection function.

4. a medicine for cardioprotection function, is characterized in that: the inhibitor that comprises IRF1.

The application of the inhibitor of 5.IRF1 in the medicine of preparation treatment aorta arch constriction disease.

6. a medicine for the treatment of aorta arch constriction disease, is characterized in that: the inhibitor that comprises IRF1.

7. according to the medicine described in application or claim 4 or 6 described in claim 3 or 5, it is characterized in that: the inhibitor of described IRF1 is siRNA, the rna interference vector of IRF1 gene or the antibody of IRF1 of IRF1 gene.

Images