CN103736102A

CN103736102A - Small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof

Info

Publication number: CN103736102A
Application number: CN201310567383.6A
Authority: CN
Inventors: 黄兵; 殷勤伟; 张洪杰
Original assignee: Individual
Current assignee: Individual
Priority date: 2013-11-14
Filing date: 2013-11-14
Publication date: 2014-04-23

Abstract

The invention provides a small RNA used for psoriasis treatment, and derivatives and medicinal preparations thereof. The small RNA inhibits the expression of psoriasis pathopoiesis related gene products comprising TNF alpha, IL-1a, IL6 and IL by inhibiting the expression of CREB1 and ATF1. The above small RNA medicines can substantially improve the psoriasis model mouse skin symptom formed after smearing mice with a 5% Imiquimod cream in an external use mode, can mitigate the cuticle thickening degree of pathologic skins, can improve the skin keratinization, can promote the hair growth of the pathologic skins, and has a certain treatment effect on the psoriasis.

Description

Can be used for treating psoriatic little RNA and derivant and pharmaceutical preparation

Technical field

The present invention relates to genomic medicine field, refer to especially and can be used for treating psoriatic little RNA and derivant and pharmaceutical preparation.

Background technology

Psoriasis, has another name called psoriasis, is a kind of chronic infection cutaneous disorder card, and prevalence accounts for 1～3% of world population.24 provinces，municipalities and autonomous regions of China in 1984 carry out Epidemiological study, and its prevalence is 0.123%, accounts for 5～6% of Dermatology Outpatient Department.

Patient's affected skin place occurs that border is obvious without the red speckle that infiltrates of infectiousness, and its horn cell paraplasm and abnormal differentiation also cause epidermal hyperplasia, simultaneously with lymphocyte infiltration and epidermis vasodilation, the feature that spreads.

So far people are still very limited to the understanding of onset of psoriasis mechanism, are commonly referred to be human immunocyte's complicated regulated and control network and the interactional result of inflammatory cytokine.Susceptible individual is under the effect of risk factor, self DNA that apoptotic cell discharges and self RNA antibacterial peptide LL37 of overexpression with psoriatic lesion in are combined formation complex, bring out plasmacytoid dendritic cells and activate, by producing Th1 cytokines inducing T cell to Th1 type cell proliferation and differentiation.Plasmacytoid dendritic cells specificity hypotype can produce TNF-α and promote nitricoxide synthase to produce.The dendritic cell of activation is divided a word with a hyphen at the end of a line and is entered draining lymph node, and T cells dendritic cell under the effect of IL-12 and IL-23 stimulates differentiation to become Th1 and Th17 type effector lymphocyte, through body fluid circulating reflux, divides a word with a hyphen at the end of a line and enters skin histology.T cell produces the cytokines such as a large amount of TNF-α, IFN-γ, IL-17, stimulates the activation of keratinocyte hypertrophy, produces the short course inflammatory activity of a series of chemotactic factors and cytokine induction.Its result causes occurring in skin the infiltration of a large amount of inflammatory cells, the hyper-proliferative of epidermal keratinocytes, and the hyperplasia of dermal papilla tiny blood vessels, engenders the typical erythra of psoriasis--squama erythema clinically.The cytokine of expressing in Psoriasiform dermatosis kitchen range is mainly Th-1 and the secretion of Th-17 immunocyte hypotype, and mainly increase proinflammatory cytokine, as tumor necrosis factor-alpha, interferon-γ, il-1, interleukin-2, IL-12, interleukin-17, IL-23, and conglutnin-LFA-1.Although these pro-inflammatory cytokines to may not be certain be psoriatic basic reason, they play critical effect at the aspect of inflammation that maintains psoriatic skin focus.Therefore the expression of reduction or one of inhibition or several pro-inflammatory cytokines is the psoriatic strategies quite likely for the treatment of.

Not long ago people are by the technical method of humanized antibody, the monoclonal antibody for one or several proinflammatory inflammation factor is found in research, can effectively treat some psoriasis patients, wherein studying many is the monoclonal antibody for TNF α, its trade name has infliximab and adalimumab, thereby this antibody, by directly suppressing TNF α effector in conjunction with TNF α albumen, reaches the psoriatic effect of clinical treatment.The new high selectivity biological preparation such as IL-12/23 inhibitor (the crow slave of department monoclonal antibody) have also been approved for treatment psoriasis abroad.Have report research by the expression of the direct reticent TNF α of little RNA perturbation technique, experimentation shows that the psoriatic animal model of people is also had to certain therapeutical effect for this reason.But the simple treatment for some psoriasis pathogenic cell factors exists the side effect such as the rear state of an illness bounce-back of drug withdrawal treatment.Therefore be badly in need of choosing newly, the psoriasis pathogenic cell factor is carried out to the research and development of the newtype drug of novel targets.

In to micromolecular pharmaceutically active screening study, finding can be effectively for psoriatic treatment for the kinases inhibitor micromolecular compound of p38MAPK path, but because its toxicity is large, so it is clinical that this class medicine except the treatment for some tumor, could not enter the second phase in the treatment of the chronic diseases such as psoriasis always.Because the toxicity of small-molecule drug has many reasons, as not single-minded in micromolecule action target spot, the metabolite of micromolecular compound has the reasons such as toxicity, and the controlling gene of choosing in p38 MAPK path still has feasibility as psoriatic gene therapy target spot.This point has further been proved in the research of in recent years psoriasis pathology being learned.Yu XJ etc. and Funding AT philosophy are reported in psoriasis people's the phosphorylation of pathological tissue p38 than exceeding 2 times of left and right in normal structure, the MEK on this path simultaneously, and the phosphorylation of ERK1/2 and CREB1 also significantly improves than Normal group.Reticent MSK1, MSK2 can suppress the expression of CREB1, knock out the expression that MSK1 can also effectively reduce the immune molecule directly related with psoriasis simultaneously, as IL-6, IL-8 and TNF α. but the expression whether knocking out of CREB1 gene can suppress cytokine TNF alpha etc. equally is not illustrated in above-mentioned research.

The genomic medicine research and development that the little RNA perturbation technique that developed recently gets up is curing psoriasis bring new development opportunity.Disturb little RNA be a class length be 20 bases can with the mRNA complementation of gene, through Dicer-Ago2 complex, can make the natural or synthetic little RNA of a class of mRNA degraded.The feature of little RNA medicine is the high specificity of target spot, and catabolite does not have toxicity, is a new breakthrough point of current new drug research.The present invention on the basis of psoriatic novel targets, in conjunction with the designing technique of little RNA and the transdermal delivery technology of little RNA, treats psoriatic mouse model selecting, to find the psoriatic potential little RNA medicine for the treatment of of new efficient, low toxicity.

Summary of the invention

The present invention proposes and can be used for treating psoriatic little RNA, its can reticent target gene CREB1 (genebank gene number: NM_004379.3 and NM_134442), ATF1 (genebank gene NM_005171.3) gene expression, and by the expression of direct inhibition said gene, effectively suppress can induce in Skin Cell the TNF α of psoriatic cytokine target gene, the expression of IL6 and IL8, and can improve, alleviate the degree of inflammation of the skin histology of psoriasiform animal model.

Technical scheme of the present invention is achieved in that

Can be used for treating psoriatic little RNA, it has the core nucleotide sequence as shown in SEQ ID NO:1 (or as accompanying drawing 5).

The present invention is by a large amount of screenings, optimization and research, provides this kind can effective reticent CREB1 and the sequence of the little RNA of two strands of ATF1, and little RNA si-CR1 has the duplex structure of core nucleotide sequence:

5′-GAAACCCCAUCUCUACUAA-3′

3′-CUUUGGGGUAGAGAUGAUU-5′

The antisense strand of its medium and small RNA si-CR1 can act directly in the 1156-1174 sequence of CREB1mRNA (NM134442) by base complementrity, also can act directly in the 1022-1040 sequence of ATF1 gene mRNA by base complementrity simultaneously.

In addition, nucleotide sequence small RNA molecular of (or in Table 1) as shown in SEQ ID NO:2 to SEQ ID NO:30, it also has similar inhibition target gene CREB1 and the effect of ATF1.

The present invention also provides the little RNA of the derivative core texture that contains above-mentioned nucleic acid thus, comprises the small nucleic acids of different length and can transcribe in vivo the small nucleic acids expression vector that generates this type of small nucleic acids, also has the function of identical inflammation-inhibiting correlation factor.

It should be appreciated by those skilled in the art, any one nucleotide in nucleotide sequence of the present invention can be natural literalness, also can modify through different chemical method, comprise peptide nucleotide (PNA), locking nucleotide (LNA) or methoxy-or nucleotide etc. of modifying of ethoxy.

In addition, those skilled in the art be also to be understood that nucleotide of the present invention can also comprise the single-chain nucleic acid that is derived by above-mentioned double-strandednucleic acid, hair fastener nucleic acid etc.

In addition, little RNA medicine of the present invention can the technology transfer of polypeptide nano granule transdermal to the pathological tissues of skin, realize the function of little RNA medicine, and little RNA of the present invention can make various preparations, the form of preparation comprises the various dosage forms such as cream, unguentum, tincture, for psoriatic prevention and treatment.

As from the foregoing, the invention provides one and can be used in the psoriatic little RNA for the treatment of and derivant and pharmaceutical preparation.This little RNA, by suppressing the expression of CREB1 and ATF1, suppresses psoriatic pathogenic related gene product---TNF α, IL-1a, the expression of IL6 and IL.This little RNA medicine can significantly be improved 5% imiquimod cream and smeared the skin symptom of the psoriasis model Mus that mouse skin forms by the mode of percutaneous drug delivery, alleviate the epidermis thickened degree of affected skin, improve the keratinization of skin, promote the hair growth of affected skin, treatment psoriasis tool is had certain effect.

Accompanying drawing explanation

In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, to the accompanying drawing of required use in embodiment or description of the Prior Art be briefly described below, apparently, accompanying drawing in the following describes is only some embodiments of the present invention, for those of ordinary skills, do not paying under the prerequisite of creative work, can also obtain according to these accompanying drawings other accompanying drawing.

Fig. 1 be in human keratinized cell HaCaT after the little RNA of transfection siR-1 target gene CREB1 and ATF1 express relative level block diagram, the sequence that NC contrasts little RNA is that positive-sense strand is 5 '-UUCUCCGAACGUGUCACGUTT-3 ', and antisense strand is 5 '-ACGUGACACGUUCGGAGAATT-3 ';

Fig. 2 is that the expression of the transdermal agent formula of siR-1 and the transdermal polypeptide nano granulometric composition inflammatory factor gene on mouse skin tissue affects block diagram;

Fig. 3 is that the hypertrophy of skin histology and the impact of keratinization breakage that siR-1 smears the Animal Models of Psoriasis of mice CD-1 skin formation with the transdermal agent formula of transdermal polypeptide nano granulometric composition to imiquimod ointment contrasts figure; Wherein Fig. 3 A is normal control mice; Fig. 3 B is to the modeling medicine imiquimod ointment psoriasis positive control mice of 50mg/cm221 days; Fig. 3 C forms after psoriasiform skin to modeling medicine modeling medicine imiquimod ointment for 50mg/cm214 days, then gives the natural recovering group of normal saline; Fig. 3 D forms after psoriasiform skin to modeling medicine for 14 days, only gives the little RNA medicine siR-12 μ g/cm2 treatment group mice of continuous 7 days; Fig. 3 E is that normal mouse is only to the little RNA medicine siR-12 μ g/cm2 matched group of continuous 7 days;

Fig. 4 is the HE colored graph that the medicine of siR-1 and transdermal polypeptide nano granulometric composition is cut into slices to mouse skin treated tissue, the same Fig. 3 of experiment condition;

Fig. 5 is the duplex structure of the core nucleotide sequence of the little RNA si-CR1 of the present invention.

the specific embodiment

Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described, obviously, described embodiment is only the present invention's part embodiment, rather than whole embodiment.Based on the embodiment in the present invention, those of ordinary skills, not making the every other embodiment obtaining under creative work prerequisite, belong to the scope of protection of the invention.

Of the present inventionly can be used for treating psoriatic little RNA, it has the core nucleotide sequence as shown in SEQ ID NO:1 (or as accompanying drawing 5).

5′-GAAACCCCAUCUCUACUAA-3′

3′-CUUUGGGGUAGAGAUGAUU-5′

The antisense strand of its medium and small RNA si-CR1 can act directly in the 1156-1174 sequence of CREB1mRNA (NM_134442) by base complementrity, also can act directly in the 1022-1040 sequence of ATF1 gene mRNA by base complementrity simultaneously.

Be below specific embodiment:

Embodiment 1:

The expression of the mRNA that little RNA siR-1 can significantly suppress CREB1, ATF1 in people's keratinocyte, by designing up to a hundred small RNA moleculars, carry out great many of experiments, finishing screen is selected wherein 29, they can be in various degree inhibition target gene Creb1 and the expression of Atf1, the sequence of these 29 small RNA moleculars is in Table 1.

The little RNA single strand sequence of table 1. (another is complementary strand).

sRNAs	Sequence 5 ' end is to 3 ' end
		siR-1	GAAACCCCAUCUCUACUAAUU
siR-2	AGGAGCAAUACAGCUGGCUAACAAU
		siR-3	GCAAUACAGCUGGCUAACAAUGGUA
siR-4	CACUCAGCCGGGUACUACCAUUCUA
		siR-5	GCACGAAAGAGAGAGGUCCGUCUAA
siR-6	CACGAAAGAGAGAGGUCCGUCUAAU
		siR-7	GAAAGAGAGAGGUCCGUCUAAUGAA
siR-8	CAGCUCGAGAGUGUCGUAGAAAGAA
		siR-9	ACAAGACAUUGAUUGAGGAGCUAAA
siR-10	CCUUUACTGCCACAAAUCAGAUUAA
		siR-11	CACUGUAACGGUGCCAACUCCAAUU
miR-12	UGAUCGAAUAUGUAUUUUAAU

[0042]?

miR-13	GUCAUCUCUAACAAAGUUGUG
		miR-14	CGUUACGUUGUCGUUACGUG
siR-15	GCCACAGUUGAUUAUGGAAUU
		siR-16	GCUCAACAGGUAUCAUCUUAA
siR-17	GGAGCCUUACAGUUGGCAAUU
		siR-18	GCAAGGUACAACUAUUCUUAA
siR-19	GCUACUUCUCUGCCACAAAUU
		siR-20	GCUCGAGAAUGUCGCAGAAUU
miR-21	AGGUAGUAGUUUUGUUUACCUCA
		miR-22	AGGUUAGUCAAGGACUACGUCAU
miR-23	CGACUCUCACAUCCUACAAAUGU
		miR-24	UGAUCGAAUAUGUAUUUUAAU
miR-25	UUAGUCAGAGUAACGAAAUAUU
		siR-26	CCGAACUACACCUUCAGCUACUUCU
siR-27	GGUAUCAUCUUUAUCAGAAAGUGAG
		siR-28	GGGAGCUCACAUUUCUCAUAUUGCU
siR-29	GGUGGUCGUACAAACUGCAUCAGGA

People's keratinocyte is purchased from U.S. ATCC (catalog number (Cat.No.): CCL-228 ^tM), use containing the DMEM culture medium of 10% hyclone and divide in the CO2 gas incubator of depressing and cultivate at 5%CO2.HaCaT cell is a good cell model of research curing psoriasis.

In the present embodiment, in 6 well culture plates, inoculate 150,000/hole of HaCaT cell, after incubated overnight, use little RNA contrast and the little RNA siR-11 μ g of inanimate object activity to mix rear transfectional cell with the cell transfecting peptide T D1-R8 of 25 μ g, cotransfection 3 times, every minor tick 48 hours, collects for 7 days afterwards, cell adopts the Trizol reagent of Invitrogen company, and according to the operation instructions of this reagent, extracts total RNA of cell.The integrity of total RNA by agarose gel electrophoresis observe two of 18S and 28S clearly bar bring judgement.The preparation of cDNA adopts the reverse transcription test kit of Promega company, gets 2 μ g cell total rnas, according to the description operation of test kit, carries out reverse transcription.Polymerase chain reaction (PCR) adopts the 2 × PCR mix reactant liquor that contains PCR fluorescent dye SYB Green I of Tian Gen biochemical technology company limited, in the reaction system of 20 μ l, add the cDNA of 1 μ g, forward and the each 1pmol of reverse PCR primer and appropriate water, on quantitative PCR instrument, carry out 40 circulation (60 ℃ of 15s of amplified reaction, 72 ℃ of 30s, 95 ℃ of 20s), after reaction stops, response curve is through normalized, PCR reaction cycle when acquisition fluorescent signal intensity occurs 5% is counted Ct value, and according to amplification efficiency, be the amount of 100% its template of calculating.In each sample, accompanying drawing 1 is shown in the variation of the expression of the relative compared with control cells that does not add any processing of expression of CREB1 and ATF1.Experimental result shows the HaCaT cell of transfection siR-1, intracellular CREB mrna expression level has reduced by 86% than the HaCaT cell that does not add any processing, contrast transfection group comparison with NC, the mrna expression of CREB has reduced by 80%, and compared with not adding the HaCaT cell of any processing, little RNA siR-1 makes the mrna expression of ATF1 gene decline 40%, and compared with siR-1+18 transfection group, the mRNA level of ATF1 has declined approximately 70%; The above results explanation the present invention designs synthetic little RNA si-CR1 the biological activity that suppresses expression of target gene.

Embodiment 2:

Little RNAsi-CR1 can effectively suppress target gene CREB1 in mouse skin and the expression of immunoregulation gene TNF α.

Choose 4 of the female white mice in 6-8 week, the Mus back of the body every Mus is wiped out hair with ophthalmologic operation shears, choose the skin of 0.5 square centimeter of two area, a skin is smeared the transmission medicine contrast of transfection polypeptide and little RNA negative control NC formation, another piece skin is smeared the combination drug of transfection polypeptide and little RNAsi-CR1 formation, twice of every day, each 2 μ g successive administrations are after 5 days, put to death mice, draw respectively the skin histology at medicine and negative control position, be merged into two groups, what adopt Tian Gen biotech company organizes RNA separating kit, and according to the method described in its description, separate total RNA.Get total RNA2 μ g, carry out after reverse transcription, the reverse transcription product of getting 1 μ l is template, DNA primer in employing table 1 carries out 30 circulations of pcr amplification, and pcr amplification product, through 1% agarose gel electrophoresis, obtains the EB dyeing band of gene C REB1 and TNF α, as shown in Figure 2, the brightness analysis of sample strip is found administration group relative comparison group, and the mrna expression of CREB1 gene has reduced by 40%, and the mrna expression of while and the closely-related Disease-causing gene TNF of psoriasis α has declined 44%.Visible, the target gene that little RNAsi-CR1 can inhibition animal skin tissue and psoriasis is there is to the expression of the controlling gene for the treatment of meaning.

Embodiment 3:

Little RNA si-CR1 can effectively improve the scytitis degree of psoriasis model mice.

A psoriatic principal character is the feature that focal zone has inflammation, and therefore whether to improve be a kind of important models of research treatment curing psoriasis medicine to the inflammation of laboratory animal skin.There is in recent years report imiquimod varnish, a kind of small-molecule drug that is used for the treatment of external genitalia/perianal wart, there is the mouse skin epithelial inflammation of initiation and the excessive pathological effect of keratinization, there is psoriatic part pathological characters, be considered to study a psoriatic good modeling medicine (van der Fits L., et al., Imiquimod-Induced Psoriasis-Like Skin Inflammation in Mice Is Mediated via the IL-23/IL-17Axis.J.Immun.2009,182,5836-5845).Imiquimod cream---the Li Kejie that the present invention adopts Hubei Ke Yi Pharmaceutical joint-stock company to produce, adopting CD-1 white mice skin of back is experimental subject, Mus hair is wiped out with ophthalmologic operation shears, and in the region of 1cm2 every day twice of smearing ointment, each every 50mg of place, be coated with 21 days continuously, as the positive Model B of psoriasis; Do not smear the mouse skin of any medicine as the negative model A of psoriasis.To give imiquimod modeling medicine after 14 days, change to normal saline and smear the comparison model C naturally recovering into modeling mouse skin; To give imiquimod modeling medicine after 14 days, change the transmission medicine varnish that forms to transfection polypeptide and si-CR1 7 days, every day twice, the siR-1 of dosage 2 μ g/cm2 is treatment model D; To give imiquimod modeling medicine after 14 days, continue to give imiquimod 7 days, give the transmission medicine varnish 7 days that transfection polypeptide and si-CR1 form simultaneously, every day twice, the siR-1 of dosage 2 μ g/cm2 is the prophylactic treatment model E to psoriasis model as little RNA medicine; With CD-1 mouse skin, directly give the transmission medicine 7 days that polypeptide and siR-1 form, as the stimulation group F to skin.In accompanying drawing 3, provided the situation of change of experiment mice treatment sites skin.Modeling group B, and modeling recovery group C processes after 21 days and 14 days through imiquimod, red swelling of the skin, keratinization is serious and have the appearance of ulceration point, and hair growth stops.Recovery group C recovers after 14 days 7 days in imiquimod effect, although the red and swollen degree of skin alleviates to some extent compared with modeling group, does not return to the level of control group A, and hair is not still grown.In drug treatment group D, the damaged and red and swollen disappearance of the keratinization of skin, hair growth is vigorous.And normal skin is smeared little RNA medicine group E, hair growth is also vigorous compared with matched group, without allergic phenomenas such as red swelling of the skins.

In order further to observe psoriasis modeling medicine and the impact of little RNA medicine on skin, accompanying drawing 4 has provided the HE coloration result of above-mentioned laboratory animal paraffin section (5 μ m are thick).The epidermis that can see control mice is thin, and keratinization is not obvious; And the skin epidermis hypertrophy of the positive model group B of psoriasis is remarkable, keratinization of epidermis is remarkable; The epidermal hyperplasia of natural recovering group C alleviates to some extent compared with model group B, but still significantly, keratinization of epidermis layer hypertrophy alleviates to some extent, but still has significant hypertrophy phenomenon than normal skin; To little RNA treatment group D, through the treatment of 7 days, epidermal hyperplasia degree and epidermis keratinization degree were all close with Normal group, and significantly reduce than the epidermal hyperplasia of natural recovering group C.The combination drug of skin without imiquimod processing directly being smeared to transdermal polypeptide and siR-1 does not affect the epidermis of mice (E group) for 7 days significantly.The above results explanation genomic medicine si-CR1 itself does not have observable stimulation side effect to skin, and the psoriasis model that imiquimod modeling is formed has certain therapeutical effect.

The foregoing is only preferred embodiment of the present invention, in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, be equal to replacement, improvement etc., within all should being included in protection scope of the present invention.

Claims

1. can be used for treating psoriatic little RNA, it is characterized in that: there is nucleotide sequence as shown in the arbitrary sequence of SEQ ID NO:1 to SEQ ID NO:30 and the little RNA of two strands of complementary series thereof, its antisense strand can act directly in the 1156-1174 sequence of CREB1 mRNA and the 1022-1040 sequence of ATF1 gene mRNA by base complementrity simultaneously, and suppresses the expression of this two gene.

2. according to claim 1ly can be used for treating psoriatic little RNA, it is characterized in that: described little RNA also comprises the single-chain nucleic acid that is derived by the little RNA of described two strands, hair fastener nucleic acid etc.

3. according to claim 2ly can be used for treating psoriatic little RNA, it is characterized in that: any one nucleotide in described nucleotide sequence can be modified through chemical method.

4. according to claim 3ly can be used for treating psoriatic little RNA, it is characterized in that: described chemical modification method comprises peptide nucleotide, locking nucleotide or methoxy-or ethoxy modification etc.

5. according to can be used for described in claim 1 to 4 any one, treat psoriatic little RNA, it is characterized in that: described little RNA is the pathological tissues to skin with the technology transfer of polypeptide nano granule transdermal, realize the function of little RNA medicine.

6. comprise the small nucleic acids derivant that can be used for treating psoriatic little RNA described in claim 1 to 5 any one.

7. can transcribe in vivo the small nucleic acids expression vector that generates small nucleic acids derivant claimed in claim 6.

8. according to can be used for described in claim 1 to 5 any one, treat the pharmaceutical preparation that psoriatic little RNA makes.

9. preparation according to claim 8, is characterized in that, described pharmaceutical dosage forms comprises cream, unguentum, tincture etc.