WO2016115671A1 - Use of inhibitor expressed by gene imo4 for preparation of external therapeutic drugs of psoriasis - Google Patents

Abstract

Provided is a use of the human gene LIM domain only 4 (lmo4) for preparation of external therapeutic drugs of psoriasis. The active components of the drugs are the recombinant lentivirus vectors for inhibiting gene lmo4 expression or the recombinant lentiviruses for inhibiting gene lmo4 expression.

Description

Application of inhibiting the expression of lmo4 gene in the preparation of a topical treatment for psoriasis Technical field

The invention belongs to the novel use of the lmo4 gene in the field of biotechnology, and particularly relates to inhibiting the expression of the lmo4 gene to interfere with and inhibit excessive proliferation and abnormal differentiation of skin keratinocytes in patients with psoriasis, thereby being used for preparing topical topical treatment of silver shavings. Disease (psoriasis) treatment drugs.

Background technique

Psoriasis (commonly known as "psoriasis"), with erythema and scales as the main manifestations, itching, easy to infect, easy to relapse. Psoriasis is a common chronic inflammatory disease of the skin. It is highly heritable and has autoimmune characteristics. It is more common in young adults. At present, the incidence of psoriasis in China reaches 0.12%, and the number of patients is close to 10 million. In terms of worldwide statistics, the incidence of psoriasis accounts for 0.1% to 3% of the world's total population, of which the incidence rate in Europe is 4%. The incidence rate in the United States has reached 2.6%, and the prevalence rate in Asian countries is about 0.3%. A survey of patients found that about 55% of them had a family history. At present, there is no clinical cure for psoriasis, and about 10 to 40% of patients have joint damage, often associated with tumors, autoimmune diseases and complex diseases associated with them, such as diabetes, cardiovascular, metabolic diseases. Etc., and most patients suffer from illness for a lifetime, which seriously affects work efficiency, and the quality of life and quality of life of patients are extremely poor. In addition, psoriasis has obvious family genetic characteristics, and members of the patient's family who are not yet ill have a great psychological disorder due to fear and fear.

The etiology and pathogenesis of psoriasis remains unclear. It is known that normal human skin cell renewal depends on the proliferation and differentiation of keratinocytes in the basal layer of the skin, and the differentiation process needs to undergo basal layer, spinous layer, granular layer and keratinized layer, etc., generally a new generation in about 30 days. Each layer of cells has a signature molecule, such as keratin 5 (Keratin 5, K5), keratin 14 (K14), transglutaminase 2 (TG2); Molecules such as: TG5, TG1; granular layer cell marker molecules such as: TG3, K9, K10; keratinized cell marker molecules such as: S100A protein, outer skin protein (Involucrin, IVL) and the like. At present, the researchers believe that psoriasis is a chronic recurrent non-infectious inflammatory complex skin disease characterized by hyperplasia of the epidermis with abnormal differentiation. It is also a kind of virulence factor stimulating the body in a multi-gene genetic background. A T cell-mediated immune-related autoimmune disorder skin disease caused by the immune system, which can induce a variety of cytokines by immune-mediated imbalance of the immune system, nervous system, and inflammatory mediators. It promotes the infiltration of inflammatory cells and the inflammatory network in the lesion area, resulting in abnormal differentiation and proliferation of local keratinocytes. The rate of renewal of epidermal cells is shortened from about 30 days to 1-3 days in normal people. Excessive proliferation of epidermal keratinocytes, inflammatory cell infiltration of the dermis and microvascular proliferation of the dermal papilla are the main pathological changes of psoriasis. It can be seen that the occurrence of psoriasis is caused by various factors leading to the abnormal differentiation and proliferation of local keratinocytes. Currently It is believed that the three main links in the occurrence and development of psoriasis are: synergistic effects of various pathogenic factors—immunity, neurohumoral and other imbalances—excessive proliferation and abnormal differentiation of keratinocytes, leading to the occurrence and development of psoriasis.

There are many treatments for psoriasis, but due to the intricacies of the etiology, the efficacy of many current treatments is not certain, only to improve the symptoms of patients. For many years, traditional treatments for psoriasis, such as topical treatment and phototherapy, have improved the symptoms of psoriasis to a certain extent, but the efficacy is poor or ineffective. Anti-psoriatic biologics use a single receptor or cytokine (which may affect multiple components of the immune system) as an intermediate target for the pathogenesis, neutralizing, blocking and regulating the various immunological abnormalities of psoriasis, so that the clinical efficacy can be obtained. It must be improved, mainly including monoclonal antibodies, fusion proteins, recombinant human cytokines or growth factors, including: Alfaxide (Elefacept, Aceset) which promotes T cell apoptosis; inhibits T cell activation or reduction T-cell migration of chemuzumab (Efalizumab, ilugizumab); tumor necrosis factor-α (TNF-α) antagonists, such as etanercept (Etanercept), infliximab, Infliximab, Infliximab Anti-infliximab), Adalimumab, Golimumab, Certolizumab, etc.; IL12/IL23 antagonists, such as Euteckinab , Ussuzumab, Ustalizumab), Brenumumab (Briakinumab, ABT-874), etc. Among them, etanercept, infliximab, adalimumab, alfaxil and uteximab are FDA-approved five biological agents for the treatment of moderate to severe psoriasis. more and more. However, since the targets of these biological agents are mainly concentrated in the immune link of psoriasis, in the course of medication, the patient's immune system may be intervened, and there are more adverse reactions in patients with moderate or severe psoriasis. It is difficult to tolerate, and the price of these drugs is relatively high, which limits the use of these drugs.

Therefore, the existing treatment of psoriasis mainly focuses on the first two links, the treatment effect is not satisfactory, and the lack of the last (third) link (target) of the disease, that is, the lack of excessive proliferation and abnormality of keratinocytes Differentiation methods and drugs for intervention and treatment. The invention aims to comprehensively treat psoriasis by intervening and inhibiting excessive proliferation and abnormal differentiation of skin keratinocytes in patients with psoriasis.

The English name of lmo4 gene is LIM domain only 4, which is located on human chromosome 1p22.3, Gene ID: 8543. The lmo4 gene expression product (LMO4 protein) was originally defined as the immune antigen of breast cancer, and the lmo4 gene was overexpressed in more than 50% of the primary adenocarcinoma, suggesting that the lmo4 gene has the function of maintaining mammary epithelial hyperplasia and inhibiting its differentiation. Abnormal expression is associated with the formation of breast tumors. Clinical experiments have shown that inhibition of lmo4 gene expression can inhibit the proliferation of cancer cells and promote the apoptosis of breast epithelial cells and breast cancer cells, and the molecular mechanism between the two is not significantly different. Existing studies have confirmed that the function of lmo4 gene is: in the human embryo development stage, the expression product of lmo4 gene LMO4 protein can mediate the proliferation, differentiation and migration of epithelial cells, promote the closure of neural tube and the formation of skin tissue, and also participate in regulation. Repair of damage to normal human skin tissue (Proc. Natl. Acad. Sci. USA. 1998, (95): 15418–15423; Developmental Biology. 2006, (299): 122–136; Developmental Biology. 2008, (321): 263–272).

RNA interference (RNAi) refers to the phenomenon of highly-specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA), which is highly conserved during evolution. Simply put, it refers to a phenomenon of gene silencing induced by double-stranded RNA in molecular biology. When a double-stranded RNA homologous to the endogenous mRNA coding region is introduced into the cell, the mRNA is degraded to cause silencing of the gene expression, which is a specific post-transcriptional gene silencing. Because of its high sequence specificity and effective interference, RNAi can specifically silence specific genes to obtain loss of gene function or gene expression, so it can be used as a powerful research tool for functional genomics. RNAi technology can be widely applied to include functional science, drug target screening, cell signaling pathway analysis, disease treatment and the like.

The Lentivirus vector system has the following characteristics: (1) Security, most of the genes of the virus are deleted or replaced, so the virus does not have the ability to replicate itself, and because the LTR 3'U3 is deleted, the virus cannot produce viral RNA, and the virus has Self-inactivation; (2) Wide range of hosts, due to the replacement of HIV membrane glycoprotein with VSV-G, many types of cells, such as humans and mice, can be efficiently infected; (3) not only the common retrovirus is retained. Stable integration of the characteristics of the host genome, and increased the characteristics of efficient infection of quiescent cells and high expression of foreign proteins and can escape methylation inhibition; (4) combined with RNA interference (RNAi) technology, can be prepared for down regulation A viral infection solution expressed by a specific gene is used to infect a target cell in situ to achieve local treatment. These characteristics of lentiviral vector systems make them widely used in many disciplines and fields such as molecular biology and cell biology.

Summary of the invention

The LMO4 protein is an expression product of the lmo4 gene, and in order to investigate whether LMO4 is involved in hyperproliferation and abnormal differentiation of skin tissue cells of psoriasis, the inventors of the present invention conducted the following experiments: 1) detecting psoriasis patients by immunohistochemistry The expression level of lmo4 gene expression product LMO4 protein in the lesion tissue specimens and normal human skin tissue samples showed that the expression level of LMO4 protein in skin tissue cells of psoriatic lesions was significantly higher than that of normal skin tissue cells; The in vitro cell differentiation assay of primary cultured keratinocytes of normal human basal layer confirmed that the expression of lmo4 gene gradually decreased during differentiation; 3) overexpressing LMO4 protein by keratinocytes in the basal layer of the skin, leading to its proliferation Both speed and differentiation rate increased significantly. 4) Lentivirus-mediated gene knockdown technology inhibited the expression of lmo4 gene and decreased the amount of LMO4 protein, which inhibited the proliferation and differentiation of keratinocytes.

Based on the above experimental results, it can be confirmed that the lmo4 gene is overexpressed in the epidermal cells of the basal keratinocytes and their differentiated spine, granule layer and keratinized layer in the psoriatic lesions; lmo4 gene Excessive expression leads to excessive proliferation and abnormal differentiation of keratinocytes in the basal layer of the skin, causing an increase in the rate of cell renewal in various layers of the skin; inhibition of expression of the lmo4 gene in human skin keratinocytes can be effectively reduced The proliferation rate of keratinocytes prolongs the differentiation time.

Based on the above research results, an object of the present invention is to provide a new use of the human LIM domain only 4 gene (abbreviated as lmo4), which is associated with hyperproliferation and abnormal differentiation of skin keratinocytes in patients with psoriasis, and inhibits human skin tissue cells. The expression level of lmo4 gene can interfere with and inhibit hyperproliferation and abnormal differentiation of skin keratinocytes in patients with psoriasis. Therefore, recombinant lentiviral vector which can inhibit lmo4 gene expression or recombinant lentivirus which inhibits lmo4 gene expression can be prepared as active ingredient. Psoriasis (psoriasis) treatment drugs, especially topical drugs, inhibit the excessive proliferation and abnormal differentiation of keratinocytes by inhibiting the expression of lmo4 gene in skin tissue cells of the lesions of psoriasis patients, and achieve local treatment of silver shavings The purpose of the disease.

The "recombinant lentiviral vector for inhibiting lmo4 gene expression" is a recombinant lentiviral vector constructed based on a lentiviral vector and capable of expressing small interference RNA (siRNA) and specifically inhibiting lmo4 expression. Specifically, its construction can include the following steps:

1) Designing a small hairpin RNA (shRNA) sequence that specifically interferes with the human lmo4 gene using software provided by Invitrogen;

2) According to the designed shRNA sequence, the corresponding single-chain Oligo DNA and its complementary strand of Oligo DNA single strand are synthesized, and the synthesized Oligo DNA and its complementary strand are mixed according to the molecular number 1:1 ratio, and annealed to form a double Chain Oligo DNA;

3) According to the multiple cloning enzyme of the lentiviral vector, the double-stranded Oligo DNA was ligated with the lentiviral RNAi interference vector to obtain a recombinant lentiviral RNAi interference vector which inhibits the expression of the lmo4 gene.

In the above construction method, the open reading code box (ORF) sequence of human lmo4 mRNA can be used in the step 1) using the online software provided by Invitrogen (https://rnaidesigner.lifetechnologies.com/rnaiexpress/). Sequence 1 in the list, GenBank: NM_006769), designed to inhibit the expression of the lmo4 gene, is one of the following RNA sequences:

(1) Sequence 2 in the sequence listing, designated as shRNA1;

(2) Sequence 3 in the sequence listing, designated as shRNA2.

The double-stranded Oligo DNA encoding the shRNA which inhibits expression of the lmo4 gene in the step 2) may be one of the following double-stranded DNA sequences:

(1) The single strand of Oligo DNA of shRNA1 is sequence 4 in the sequence listing, and the complementary strand thereof is sequence 5 in the sequence listing;

(2) The single strand of Oligo DNA of shRNA2 is sequence 6 in the sequence listing, and the complementary strand thereof is sequence 7 in the sequence listing.

The shRNA encoded by (1) double-stranded Oligo DNA is named as shRNA1, and shRNA generated in the cell is cleaved by Dicer to form siRNA1, and its sequence is: 5'-AUUGAUGUAGUGAAACCGA-3' (sequence 8 in the sequence listing), which is Human lmo4 mRNA open reading codon (ORF) sequence (sequence 1 in sequence listing, GenBank number: NM_006769) from the 5' end 1158 to 1176 bp position sequence The homologous sequence of 5'-tcggtttcactacatcaat-3' binds to 5'-tcggtttcactacatcaat-3' by complementary pairing to induce lmo4 mRNA degradation; (2) the double-stranded Oligo DNA-encoded shRNA is named shRNA2, which is in the cell. The shRNA is cleaved by Dicer to form siRNA2, and its sequence is: 5'-AUGAUACACAUUGCCUUGC-3' (sequence 9 in the sequence listing), which is the human lmo4 mRNA open reading codon (ORF) sequence (sequence 1 in the sequence listing, GenBank No.: NM_006769) The homologous sequence of the 5'-gcaaggcaatgtgtatcat-3' from the 5'-position 1089 to 1107 bp at the 5' end binds to 5'-gcaaggcaatgtgtatcat-3' by complementary pairing, thereby inducing degradation of lmo4 mRNA.

The lentiviral RNAi interference vector in the step 3) is pGV248, and the recombinant lentiviral RNAi interference vector containing the double-stranded Oligo DNA encoding the shRNA which inhibits the expression of the lmo4 gene is named pGV248-shRNA1 and pGV248-shRNA2 (collectively referred to as pGV248-shRNA). ).

A recombinant lentivirus that inhibits the expression of the lmo4 gene by mixing the lentiviral RNAi interference vector pGV248-shRNA which inhibits the expression of the lmo4 gene with a helper plasmid in a lentiviral vector system, and transfecting the lentiviral packaging cell with a liposome-mediated method A recombinant lentivirus carrying a small interfering RNA encoding gene that inhibits expression of the lmo4 gene is obtained.

The helper plasmid in the lentiviral vector system is a packaging plasmid containing a gag, pol, or/and rev gene, and the packaging plasmid mainly functions as a viral packaging, and is transcribed and expressed to form a viral capsid structural protein and a polymerase protein; The additional helper plasmid is a envelope plasmid containing the envelope protein gene vsvg, which is transcribed and expressed to form a viral envelope protein. The lentiviral RNAi interference vector which inhibits the expression of lmo4 gene and the packaging plasmid and the envelope plasmid in the lentiviral vector system are mixed in a mass ratio of 3 to 10:3 to 10:1, and the lentivirus-packaged cells are transfected by liposome. -T cells, after transfection, 293-T cell supernatants were collected and centrifuged to obtain a concentrated virus.

The above shRNA which inhibits expression of the lmo4 gene (specifically, sequence 2 or sequence 3), double-stranded Oligo DNA encoding the shRNA which inhibits expression of the lmo4 gene (specifically, sequence 4 and sequence 5, or sequence 6 and sequence 7), and inhibition of lmo4 A recombinant lentiviral RNAi interference vector (specifically, pGV248-shRNA) for gene expression, and a recombinant lentivirus that inhibits expression of the lmo4 gene are all described herein.

Another object of the present invention is to provide a topical therapeutic agent for psoriasis (psoriasis), wherein the active ingredient is a recombinant lentiviral vector which inhibits expression of the lmo4 gene or a recombinant lentivirus which inhibits expression of the lmo4 gene. Based on the lmo4 gene, the cells below the keratinized layer of the psoriatic lesion are highly expressed, and this high expression leads to excessive proliferation and abnormal differentiation of the cells, resulting in increased lesions and increased scales of psoriasis. By interfering with or inhibiting the expression of lmo4 gene in skin cells of the lesions of patients with psoriasis, it has been confirmed at the cellular level that it can inhibit the differentiation of keratinocytes and the proliferation of cells in each layer, and is suitable for the development of psoriasis. The final target (keratinocyte) is a topical drug for the treatment of psoriasis.

The invention has the following beneficial effects:

1) The present invention adopts RNA interference technology to screen out effective interference sequences, and can effectively inhibit excessive proliferation and abnormal differentiation of keratinocytes after effective interference with lmo4 gene in keratinocytes;

2) The main lesion based on psoriasis is the lesion site of the body surface, which is suitable for treatment with external medicine. The invention can be used as a topical medicine for the local lesion of psoriasis, and the administration is convenient and the applicability is strong;

3) Since the exogenous interference sequence is difficult to enter the cells below the keratinized layer of the lesion site, the present invention adopts a lentivirus-mediated RNA interference technique, and is more susceptible to cells under the keratinized layer in the lesion site of psoriasis. , obtained a better effect;

4) The lentiviral-mediated RNA interference topical drug of the present invention is only used for local treatment of the lesion site of psoriasis, the lentivirus is not easy to infect normal skin tissue, and the external drug is relatively high relative to systemic administration. Security.

The present invention will be further described in detail below in conjunction with specific embodiments.

DRAWINGS

Figure 1 shows the expression of lmo4 gene expression product LMO4 protein in normal skin tissues and psoriatic lesions by immunohistochemistry.

Figure 2 shows the morphology of keratinocytes in the primary basal layer of normal human skin.

Figure 3 shows the morphological changes of primary cultured keratinocytes induced differentiation in vitro.

Figure 4 is a quantitative quantitative RT-PCR detection of molecular markers of differentiation of normal human skin keratinocytes in vitro.

Figure 5 shows the results of Western Blot detection of molecular markers of differentiation of normal human skin keratinocytes in vitro.

Figure 6 shows the results of fluorescence quantitative RT-PCR detection of HaCaT cells mimicking in vitro differentiation of keratinocytes.

Figure 7 shows the results of Western Blot detection of HaCaT cells mimicking in vitro differentiation of primary keratinocytes.

Figure 8 is a physical map of a lentiviral RNAi interference vector that inhibits lmo4 gene expression.

Figure 9 shows the results of Western Blot assay for HaCaT cell line that inhibits LMO4 protein expression.

Figure 10 shows the effect of inhibition of lmo4 gene expression on the expression of marker molecules in different layers of HaCaT cells by real-time quantitative RT-PCR.

Figure 11: Western Blot assay to inhibit the expression of lmo4 gene on the expression of marker molecules in different layers of HaCaT cells

Figure 12 shows that inhibition of lmo4 gene expression can inhibit HaCaT cell proliferation (MTT assay)

detailed description

The methods used in the following examples are conventional methods unless otherwise specified. For specific steps, see: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition) , 2001, NY, Cold Spring Harbor).

The percentage concentration is mass/mass (W/W, unit g/100g) percentage concentration, mass/volume (W/V, unit g/100mL) percentage concentration or volume/volume (V/V, unless otherwise specified). Percent concentration in units of mL/100 mL).

The various biological materials described in the examples are obtained by merely providing an experimentally obtained route for the purpose of specific disclosure and should not be a limitation on the source of the biological material of the present invention. In fact, the source of the biomaterials used is extensive, and any biomaterial that can be obtained without violating laws and ethics can be replaced with the instructions in the examples to achieve the enforceable requirements.

The embodiments are implemented on the premise of the technical solution of the present invention, and detailed embodiments and specific operation procedures are given. The embodiments will be helpful for understanding the present invention, but the scope of protection of the present invention is not limited to the following embodiments. .

Example 1. Immunohistochemical detection of LMO4 protein expression product of lmo4 gene in lesions of patients with psoriasis

34 cases of clinical and pathologically confirmed psoriasis lesions were collected as experimental samples, all of which were in the advanced or stable phase, including 15 females, 19 males, and 5 family history. The normal skin of clinical circumcision was collected. Four cases were organized as normal samples. Immunohistochemistry was used to detect the expression of lmo4 gene expression product LMO4 protein in normal skin tissues and in lesions of psoriasis patients.

The specific method includes the following steps:

1) Make tissue wax block: Immediately soak the experimental sample and normal sample in 4% (V/V) formaldehyde solution, rinse the tissue with running water for 10 hours after 24 hours, then put it into the dehydrator for dehydration, dehydrated and then placed The tissue was immersed in a xylene solution for 15 minutes to make the tissue transparent. Finally, the tissue was immersed in wax to make a tissue wax block and marked, and stored at room temperature.

2) Making tissue sections: Cut the paraffin sections with a thickness of about 3 mm with a tissue microtome, and gently transfer the sections from the knife to the warm water of 45 ° C to 50 ° C with a brush. After the slices are flat, slide the slices with a glass slide. After drying, the sheet was placed in a 60 ° C oven for 30 min.

3) Immunohistochemical detection:

a. Dewaxing into water: the experimental sample tissue section and the normal sample tissue section are placed on a slide holder, and then placed in xylene I for 15 min, placed in a 58 ° C incubator; xylene II in 15 min, placed in a constant temperature In the box; anhydrous alcohol I in 10min; anhydrous alcohol II in 5min; 90% (V / V) alcohol 3min; 80% (V / V) wine Fine 3min; 70% (V / V) alcohol 3min; deionized water for 30min.

b. Antigen repair: prepare 0.01M pH citrate solution (formulation: trisodium citrate 3g, citric acid 0.4g, dissolved in 1000mL distilled water), completely immerse the tissue section in the microwave oven for 7min, Naturally cooled for 2 minutes, then microwave oven for 2 minutes, and finally placed in the basin for natural cooling. The tissue sections were placed flat in a wet box and treated with PBS (recipe: pH 7.2-7.4, NaCl 137 mmol/L, KCl 2.7 mmol/L, Na ₂ HPO ₄ 4.3 mmol/L, KH ₂ PO ₄ 1.4 mmol/L). The side of the slice was gently washed for 3 min and repeated 3 times.

c. Immune reaction: gently wipe the water around the tissue with toilet paper, add 3% (V / V) hydrogen peroxide, completely cover the tissue, place it at 37 ° C for 15 min, and finally wash with PBS for 3 min, repeat 3 times. Wipe the water around the tissue with toilet paper, add goat serum (purchased from GIBCO, USA) to completely cover the tissue, and incubate at 37 ° C for 30 min. Serum was removed, and anti-LMO4 (purchased from Abcam, USA) was added dropwise, overnight at 4 ° C (8-12 h), and the antibody was diluted 1:200 with a primary antibody dilution (purchased from TOYOBO, Japan). Wash PBS 3 times for 3 min each time. The residual water traces were wiped off, biotinylated secondary antibody working solution (purchased from TOYOBO Co., Japan) was added dropwise, and incubated at 37 ° C for 30 min. Wash PBS 3 times for 3 min each time. The horseradish enzyme-labeled streptavidin solution was added dropwise and incubated at 37 ° C for 30 min. Wash PBS 3 times for 3 min each time.

d.DAB color development: prepare 0.05% DAB coloring solution (formulation: 0.005g DAB dissolved in pH 7.2 Tris-HCl solution, while adding 3% H ₂ O ₂ 0.1mL), pay attention to avoid light, add to the tissue block One drop of DAB developer was immediately placed under a microscope. After the brownish yellow particles were observed, the color was stopped with distilled water, and the sections were rinsed in running water for 30 min. Note: During the rinsing process, it is not possible to flush directly against the water flow to prevent the tissue from falling off. After washing, put 0.5% hematoxylin staining solution (formulation: 0.5g hematoxylin dissolved in 100mL distilled water) for 1~3min, then rinse with running water for 30min, put into the oven until the tissue section is completely dry, and finally use neutral gum ( Purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd.), sealed at room temperature.

e. Fluorescence microscopy observation: The brownish yellow particles in the cytoplasm of the experimental sample were taken as the positive reaction area and photographed, and the pictures of the normal sample control group were taken.

The results are shown in Fig. 1. It can be seen that in 4 normal skin tissue samples, only the lmo4 gene expression product LMO4 protein (brown nucleus in the nucleus) was observed in the basal cells of the skin, but in all the detected psoriasis In the experimental samples of skin lesions, LMO4 protein was observed from the cells of basal layer, spinous layer, granular layer and keratinized layer, indicating that the abnormal expression of lmo4 gene was present in all layers of cells in the lesion tissue of psoriasis.

Example 2. Isolation, culture and in vitro differentiation of normal human skin keratinocytes and detection of differentiated cell marker molecules and lmo4 gene expression

Example 1 Immunohistochemical method was used to detect that the lmo4 gene expression product LMO4 protein was highly expressed at the tissue level of psoriasis, and the differentiation of lmo4 gene in normal skin keratinocytes was further examined by the following method. Changes in expression levels in the process.

1. Primary culture of keratinocytes

The basal layer of keratinocytes was isolated from human normal skin tissue samples and primary cultured.

The primary culture method includes the following steps:

1) Preparation before experiment: preparation method of rat tail collagen and pretreatment of culture dish: take 4 rat tails, wash the epidermis with detergent, and then soak for 7 minutes with 75% (V/V) alcohol, in the ultra-clean workbench Inside, rinse with sterile saline, aseptically cut the tail into small pieces, cut and remove the fur, take out the silver tail scorpion in physiological saline, cut the tail scorpion, and put it into autoclave (120 °C high pressure) In a 20 min) flask, add 0.3 mL of 0.3% (V/V) acetic acid solution prepared by autoclaving deionized water, shake it at 4 ° C from time to time, centrifuge at 1500 rpm for 20 min after 48 h, and take the upper layer of the viscous supernatant. Store at -20 ° C after storage. Before isolating the primary cells of the foreskin, the rat tail collagen was plated on the bottom of the dish, and then placed in a 37 ° C cell incubator for 30 min. Before inoculation of the primary cells, the residual rat tail collagen was aspirated and gently washed with PBS. 2 times, 3 minutes each time.

2) Tissue treatment: Before the experiment, wipe the ultra-clean table with 75% (V/V) alcohol, turn on the UV lamp for 30 minutes, take out the autoclaved surgical instrument and place it in a 75% (V/V) alcohol cylinder with tweezers. Remove the foreskin soaked in saline or PBS. Place the outermost epidermis down into a 10cm cell culture dish containing saline or PBS, take out the tweezers and scissors and let it cool for 10 seconds on the alcohol lamp. The scorpion stretches the leather surface. The operator holds the scorpion and holds the scissors. The fat, connective tissue, fascia, blood vessels, etc. on the inner surface of the foreskin are cut off, and the skin is cut off as much as possible. Finally, a thin skin is left. The foreskin was transferred to another 10 cm cell culture dish containing saline or PBS, and the excess tissue was further cut off, and then the epidermis was cut into 0.5×1 cm strips and rinsed several times in physiological saline or PBS; Sterilize sterile gauze in another clean 10cm cell culture dish, and pipet 4mL 0.25% (V/V) trypsin (purchased from Hyclone) into the dish until the gauze is just immersed. The surface is laid flat on the gauze 4 ℃ placed 4h.

3) Primary cell separation: open the ultra-cleaned table after UV sterilization, take out the foreskin that has been digested for 4 hours, take out a new 10cm cell culture dish, add 3~5mL 0.25% (V/V) trypsin, and take out the alcohol. The scorpion soaked in the cylinder is cooled for 10 to 15 sec after burning on the alcohol lamp. Then, the end of the skin is clamped with a pair of tweezers, and the tissue is scraped from top to bottom with a pair of tweezers. After scraping 3 times in a row, the epidermis will be adhered. The tissue scorpion is gently floated several times in the trypsin to transfer the tissue to the trypsin and continue to digest at room temperature. After repeated scraping for 3 to 4 times, the skin is turned upside down and scraped 3 to 4 times until the skin is scraped. Loose deformation, discard the skin; after taking the epidermal tissue, use the ophthalmic scissors to repeatedly cut in the trypsin, about 200 times, 4 minutes, until the tissue homogenate is cut; then add the same amount of trypsin to the dish. 10% (V/V) FBS DMEM medium (purchased from Hyclone) stopped the trypsin to continue digestion, cut 1 mL of the head of the gun, and repeatedly beat to ensure that the cell non-adhesive tissue was filtered by the drying net; Screen the filtrate, transfer the filtrate to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 10 min; pour off the supernatant, use P Wash the BS once, centrifuge at 1000 rpm for 10 min; discard The supernatant was added to 5 mL of a keratinocyte-specific medium (K-SFM was purchased from Gibco, USA), and the cells were transferred to a petri dish which had been treated with rat tail collagen and cultured at 37 °C. The epidermal cells began to adhere within 24 hours, and the cells became mainly round. As time went on, the cells expanded into an elliptical shape and the volume became larger. Small colonies or small clusters formed by several keratinocytes can be seen around 3d, and grow out as a center. The cells are confluent and connected into slices in 7-10 days. The morphology of keratinocytes in the primary basal layer of normal human skin is as follows. Figure 2 shows.

Second, the differentiation of primary keratinocytes in vitro

Using the primary cultured keratinocytes obtained in the first step, the keratinocytes are induced to differentiate in vitro by calcium ion stimulation. This differentiation process can mimic the cell differentiation process in the skin tissue of the body: from the basal cells, spines Layer cells, granulosa cells, and finally differentiate into keratinocytes.

The method of inducing differentiation includes the following steps:

1) culturing the cells: the medium for culturing the primary keratinocytes cultured for 4 to 7 days was changed from K-SFM to a DMEM medium supplemented with 2 mmol/L of calcium ions;

2) Induction of differentiation: The differentiation of keratinocytes was induced by DMEM containing 2 mmol/L calcium ion at 37 °C, and the differentiation time was 0h, 6h, 12h, 24h, 48h, and the differentiation process was observed.

The morphological changes of primary cultured keratinocytes induced differentiation in vitro are shown in Fig. 3. After 24 hours of differentiation, the cell morphology was cobblestone-like, and the cell-to-cell junction was tight, indicating that the keratinocyte differentiation system was successfully established in vitro.

3. Reverse transcription-fluorescence quantitative PCR (RT-PCR) was used to detect the differentiation of normal human skin keratinocytes in vitro to induce molecular markers and lmo4 gene expression levels.

The differentiated cells at each time point in step 2 were collected, total RNA was extracted by a conventional method, and reverse transcription was performed using AMV of Dalian Bao Biotech Co., Ltd. (reverse transcription system and operation procedure were carried out according to the instructions). The expression levels of basal cell marker molecule K14, acanthocyte marker molecule TG5, granule layer cell marker molecule K10 and keratinocyte marker molecule IVL and lmo4 genes were detected by fluorescent quantitative PCR method of Dalian Bao Biotech Co., Ltd., respectively. Actin is a reference. Real-time quantitative PCR analysis was carried out according to the kit instructions, and the PCR primer sequences are shown in Table 1.

Table 1 primer sequence

The results are shown in Figure 4. The primary cultured keratinocytes were induced by calcium ion for 6h, 12h, and 24h, and the expression level of lmo4 gene gradually decreased, which was consistent with the gradual decrease of basal cell marker molecule K14, but the expression of lmo4 gene after 48h. The level is slightly elevated (may be related to cell proliferation in the late stage of differentiation); while the expression levels of the acanid cell marker molecule TG5, the granular layer cell marker molecule K10 and the keratinocyte marker molecule IVL increase with the differentiation time. It indicates that primary cultured human skin keratinocytes can induce the differentiation of keratinocytes in the acanthus, granule layer and keratinized layer in vivo through calcium ion induction; during this differentiation, the expression of lmo4 gene is divided into points. The time and degree of differentiation are gradually reduced.

4. Western blot analysis of normal human skin keratinocytes induced differentiation molecular markers and LMO4 protein expression levels in vitro

The differentiated cells at each time point in step two were collected, and the total protein was extracted by a conventional method. Western blot was used to detect the expression levels of basal cell marker molecule K14, acanthocyte marker molecule TG5, granule layer cell marker molecule K10 and keratinocyte marker molecule IVL and LMO4 protein. GAPDH was used as reference, antibody used, dilution factor See Table 2.

Table 2 uses the list of antibodies

Antibody name	Description	company name	source	application
Cytokeratin 10 Antibody (VIK-10)	Detecting keratin 10	SANTA CRUZ	mouse	WB 1:400
					Cytokeratin 14 Antibody (C-14)	Detecting keratin 14	SANTA CRUZ	goat	WB 1:400
Involucrin Antibody (SY5)	Detect Involucrin	SANTA CRUZ	mouse	WB 1:200
					Rabbit monoclonal to LMO4	Detect LMO4	Abcam	rabbit	WB 1:2000 IHC 1:200
Mouse monoclonal to GAPDH	Detect GAPDH	Abcam	mouse	WB 1:5000
					Goat anti rabbit IgG-HRP	HRP labeled secondary antibody	SANTA CRUZ	goat	WB 1:2000
Goat anti mouse IgG-HRP	HRP labeled secondary antibody	SANTA CRUZ	goat	WB 1:5000
					Donkey anti goat IgG-HRP	HRP labeled secondary antibody	SANTA CRUZ	donkey	WB 1:5000

The results are shown in Fig. 5. The primary cultured keratinocytes were induced by calcium ion for 6h, 12h and 24h, and the expression levels of LMO4 protein and K14 decreased with the differentiation time. The acanthal cell marker molecule TG5 and granular layer cell marker molecules The expression level of K10 and the keratinocyte marker molecule IVL showed a gradual increase.

Thus, the lmo4 gene was expressed in normal skin keratinocytes, but gradually decreased with the differentiation of keratinocytes; the experimental results of Example 1 showed that there were lmo4 genes in the cells of the psoriasis lesions. Abnormal overexpression, the experimental results of this example show that the abnormal overexpression of lmo4 gene may be associated with silver The incidence of the disease is related.

Example 3: Human skin keratinocyte cell line HaCaT cell culture and in vitro differentiation

In order to further investigate the effect of aberrant expression of lmo4 gene in keratinocytes on its proliferation and differentiation, human skin-derived keratinocyte cell line HaCaT cells were used for subsequent experiments.

Human skin-derived keratinocyte cell line HaCaT cell culture and in vitro differentiation methods, including the following steps:

1) Resusciting the human skin keratinocyte cell line HaCaT (purchased from Life Technologies, USA) in a 42 ° C water bath, and after the cells were completely attached, the cells were replaced with calcium-free K-SFM medium;

2) Induction of differentiation: After the cells were transformed into an undifferentiated long spindle shape, cells were induced at 37 ° C with DMEM containing 10% calf serum (FBS, purchased from Gibco) containing 2 mmol/L calcium ion. The time to differentiation and induce differentiation is 0 to 5 days.

Results As shown in Fig. 6 and Fig. 7, the expression levels of lmo4 and keratin 14 decreased with the increase of differentiation time, and the expression levels of granule cell marker molecule keratin 10 and keratinocyte marker molecule ivl showed a gradual increase. HaCaT can mimic the process of differentiation of human normal keratinocytes in vivo in this system.

Example 4: Construction of a lentiviral RNAi interference vector, lentivirus, and a CaCa cell line that inhibits lmo4 gene expression, which inhibits lmo4 gene expression

1. Construction of a lentiviral RNAi interference vector that inhibits the expression of lmo4 gene

1. Designing shRNAs that inhibit lmo4 gene expression and control shRNA-scramble

According to the open reading frame (ORF) sequence of human lmo4 mRNA published by GenBank (sequence sequence 1, GenBank: NM_006769) and the use of lentiviral RNAi interference vector pGV248 (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd.), according to the requirements of Invitrogen's online software (https://rnaidesigner.lifetechnologies.com/rnaiexpress/) designed two pairs of specific lmo4 small hairpin RNA (shRNA) sequences targeting the lmo4 gene coding region, named separately As shRNA1 and shRNA2; at the same time, a control shRNA (designated shRNA-scramble) was designed, and the green fluorescent protein gene (GFP) open reading codon sequence was selected according to the literature (Science.2008 Jun 13.320(5882): 1496-501). (Sequence 10 in the Sequence Listing) The shRNA target sequence was used as a control from the 5'-end 122-143 bp position sequence 5'-GCAAGCTGACCCTGAAGTTCAT-3'. The specific sequence is as follows:

1) shRNA1: 5'-Ccgg gaUCGGUUUCACUACAUCAAU CUCGAG AUUGAUGUAGUGAAACCGAUC UUUUUg-3' (sequence 2 in the sequence listing);

2) shRNA2: 5'-Ccgg gcGCAAGGCAAUGUGUAUCAU CUCGAG AUGAUACACAUUGCCUUGCGC UUUUUg-3' (sequence 3 in the sequence listing);

3) shRNA-scramble: 5'-Ccgggc GCAAGCUGACCCUGAAGUUCAU CUCGAG AUGAACUUCAGGGUCAGCUUGCGC UUUUUg-3' (sequence 11 in the Sequence Listing).

2. Construction of lentiviral RNAi interference vector for inhibition of lmo4 gene expression

Based on the designed shRNA1, shRNA2, shRNA-scramble and lentiviral RNAi interference vector pGV248, shRNA encoding lmo4 gene expression and control double-stranded Oligo DNA were synthesized by Shanghai Jikai Biotechnology Co., Ltd.

The shRNA encoding the expression of the lmo4 gene and the control double-stranded Oligo DNA are one of the following double-stranded DNA sequences:

1) Oligo DNA single strand of shRNA1: 5'-Ccgg gaTCGGTTTCACTACATCAAT CTCGAG ATTGATGTAGTGAAACCGATC TTTTTg-3' (sequence 4 in the sequence listing),

Its complementary strand; 5'-aattcaaaaa TCGGTTTCACTACATCAAT CTCGAG ATTGATGTAGTGAAACCGA C-3' (sequence 5 in the sequence listing );

2) Oligo DNA single strand of shRNA2: 5'-Ccgg gcGCAAGGCAATGTGTATCAT CTCGAG ATGATACACATTGCCTTGCGC TTTTTg-3' (sequence 6 in the sequence listing),

Its complementary strand: 5'-aattcaaaaagc GCAAGGCAATGTGTATCAT CTCGAG ATGATACACATTGCCTTGCGC -3' (sequence 7 in the sequence listing );

3) ShRNA-scramble Oligo DNA single strand: 5'-Ccgggc GCAAGCTGACCCTGAAGTTCAT CTCGAG ATGAACTTCAGGGTCAGCTTGCGC TTTTTg-3' (sequence 12 in the sequence listing),

Its complementary strand: 5'-aattcaaaaagc GCAAGCTGACCCTGAAGTTCAT CTCGAG ATGAACTTCAGGGTCAGCTTGC -3' (sequence 13 in the Sequence Listing).

The shRNA encoded by 1) double-stranded Oligo DNA is named as double-stranded shRNA1, and shRNA generated in the cell is cleaved by Dicer to form siRNA1, and its sequence is: 5'-AUUGAUGUAGUGAAACCGA-3' (sequence 8 in the sequence listing), the siRNA1 Is a homologous sequence of 5'-tcggtttcactacatcaat-3' from the 5'-end 1158-1176 bp position in the human lmo4 mRNA open reading codon (ORF) sequence (SEQ ID NO: 1 , GenBank No.: NM_006769), and 5'-tcggtttcactacatcaat- 3' is bound by complementary pairing to induce lmo4 mRNA degradation; 2) double-stranded Oligo DNA-encoded shRNA is named double-stranded shRNA2, and shRNA is produced in cells to form siRNA2 by Dicer cleavage, the sequence is: 5'- AUGAUACACAUUGCCUUGC-3' (sequence 9 in the sequence listing), this siRNA2 is the human lmo4 mRNA open reading codon (ORF) sequence (sequence 1, GenBank: NM_006769) from the 5' end 1089 to 1107 bp position sequence 5'-gcaaggcaatgtgtatcat -3' homologous sequence, which binds to 5'-gcaaggcaatgtgtatcat-3' by complementary pairing, thereby inducing lmo4 mRNA degradation; 3) double-stranded Oligo DNA-encoded shRNA is named double-stranded shRNA-scramble in cells The shRNA produced inside is cleaved by Dicer enzyme to form siRNA-scramble, whose sequence is: 5'-AUGAACUUCAGGGUCAGCUUGC-3' (SEQ ID NO: 14 in the Sequence Listing), which is from the 5' of the green fluorescent protein gene (GFP) open reading codon sequence (sequence 10 in the sequence listing) The homologous sequence of the 5'-gcaagctgaccctgaagttcat-3' sequence of the 122-143 bp position sequence binds to 5'-gcaagctgaccctgaagttcat-3' by complementary pairing, thereby inducing degradation of GFP mRNA.

Synthetic two pairs of Oligo DNA in step 1) were mixed with 48 μl of annealing buffer (purchased from Biyuntian Biotechnology Co., Ltd.) at a molecular ratio of 1:1, and incubated at 95 ° C for 4 min, then Incubate at 70 ° C for 10 min, then slowly cool to room temperature for annealing; take 5 μl of the annealed double-stranded oligonucleotide fragment into 4 μl of T4 DNA ligase buffer (purchased from Dalian Bao Biotechnology Co., Ltd.), add 10U T4 polynucleotide kinase (Dalian Bao Biotechnology Co., Ltd.) was incubated at 37 ° C for 30 min and then incubated at 70 ° C for 10 min for phosphorylation; at the same time, restriction enzymes Age I and EcoR I were slow. The viral RNAi interference vector pGV248 (purchased from Shanghai Jikai Gene Co., Ltd.) was linearized; the linearized lentiviral RNAi interference vector pGV248 was ligated with the phosphorylated double-stranded oligonucleotide fragment, and the recombinant plasmid was transformed into E. coli DH5α. Competent cells were selected, positive clones were selected, and cultured to amplify and extract plasmids. The plasmids were identified by restriction enzymes Age I and EcoR I, and the 58 bp and 11.5 kb DNA fragments were positively digested. And then the initial screening The positive plasmids were further identified by sequencing. The recombinant lentiviral RNAi interference vectors carrying shRNA1, shRNA2 and shRNA-scramble were inserted into the correct sequence and named as pGV248-shRNA1, pGV248-shRNA2 and pGV248, respectively. -shRNA-scramble, the physical map is shown in Figure 8.

Second, the packaging of lentivirus

293-T lentiviral packaging cells were cultured in 10 cm culture dishes in high glucose DMEM (purchased from Hyclone) containing 10% FBS, 2 mmol/L L-glutamine and 1% cyan-streptomycin. The shRNA1 and shRNA2 lentiviral vectors pGV248-shRNA1, pGV248-shRNA2 and pGV248-shRNA-scramble (purchased from Shanghai Jikai Co., Ltd.) constructed in the first step and the packaging plasmid pGAG-POL (purchased from Invitrogen) and the envelope plasmid were constructed. pVSVG (purchased from Invitrogen) was mixed at a mass ratio of 3 to 10:3 to 10:1 and then added to 1.5 mL of serum-free.

Medium (purchased from Invitrogen), mix gently, 60 μL in another sterile 5 mL tube

2000 (purchased from Invitrogen) diluted in 1.5 mL of serum-free

In the medium I, let stand at room temperature for 5 min, mix the above two liquids, incubate for 20 min at room temperature to form

2000 complex. Will contain 3mL

The medium of the 2000 complex was mixed and added to a 10 cm culture dish in which 293-T lentivirus-packaged cells were grown, and mixed, and high-sugar containing 10% FBS and 2 mmol/L L-glutamine without antibiotics was used. The DMEM medium was cultured in a 37 ° C, 5% CO ₂ incubator, and the medium was changed the next day. The supernatant was collected in a 15 mL sterile centrifuge tube at 48 h, 72 h, and centrifuged at 4 ° C, 3000 rpm for 15 min to remove cell debris. The supernatant (containing virus particles) was centrifuged at 4 ° C for 4 to 6 hours at 4 ° C to concentrate the virus. Obtain virus particles containing shRNA1 or shRNA2, and mix the supernatants of the two virus particles (for RNA interference, generally more than two interference sequences are used to prevent off-target phenomenon. Mixing the two virus solutions, the purpose is to make two kinds of virus liquids shRNA was simultaneously transferred into cells to achieve double interference to increase interference and facilitate stable interference, named LV-shRNA; and virus particles containing control shRNA-scramble were also collected. The supernatant containing the virus solution was stored at -70 ° C until use.

3. A HaCaT cell line (HaCaT/shRNA) and a control HaCaT cell line (HaCaT/shRNA-scramble) which inhibit the expression of lmo4 gene were established.

1) Cellular virus infection: HacaT cells were cultured in a 10 cm culture dish. When the cells were fused to 90%, cells were directly infected with LV-shRNA virus solution or shRNA-scramble virus solution, and 9 mL of normal medium (containing 5 μg) was added to each plate. /mL Polybrene, purchased from Sigma), 1 mL of LV-shRNA virus solution or shRNA-scramble virus solution. The normal medium was changed after 24 hours.

2) Establishment of stable interference cell line: After 3 to 5 days of infection, some cells were observed to have green fluorescence, and cells were screened for 2 to 3 weeks with a screening medium containing 0.5 μg/mL puromycin (Puromycin, purchased from Sigma). At the time, HaCaT cells and control cell lines which were resistant to puromycin and inhibited lmo4 gene expression were named HaCaT/shRNA cells and HaCaT/shRNA-scramble cells.

3) HaCaT cells obtained by screening to inhibit the expression of lmo4 gene were subjected to Western blot to detect the expression of LMO4 protein.

As a result, as shown in Fig. 9, the expression level of LMO4 protein in HaCaT/shRNA cells was significantly decreased as compared with the control HaCaT/shRNA-scramble cells, indicating that a HaCaT cell strain stably interfering with lmo4 expression has been established.

Example 5: Induction of differentiation of HaCaT/shRNA cells in HaCaT/shRNA-scramble cells in vitro and detection of their labeled molecules

I. In vitro differentiation

HaCaT/shRNA-scramble cells and HaCaT/shRNA cells were induced to differentiate in vitro according to the method in Example 2. Since the time of differentiation of HaCaT cells was longer than that of primary cultured keratinocytes, 0d, 1d, 3d, 5d and so on were selected at the time of differentiation.

Second, the marker molecule detection

Total RNA and total protein were collected at various time points for induction of differentiation. Fluorescence quantitative RT-PCR and Western blot detection were carried out according to the method of Example 2.

The results of fluorescence quantitative RT-PCR are shown in Figure 10. In the cells that inhibited the expression of lmo4 gene, the expression level of lmo4 gene decreased at each induction differentiation time, and the basal cell marker molecule K14 was compared with the control cells. The expression level is significantly higher than that of the control cells; while the expression level of the keratinocyte marker molecule IVL is higher than normal. Significantly reduced in the cells. After inhibiting the expression of lmo4 gene, although the expression level of the granular layer cell marker molecule K10 was higher than that of the control group, the protein expression level was as shown in Fig. 11, and the expression level of K10 was lower than that of the control group. At the same time, the changes of K14, LMO4 and IVL protein expression levels were consistent with the results of fluorescence quantitative RT-PCR. Therefore, the HaCaT cell model demonstrated that inhibition of lmo4 gene expression inhibited HaCaT cell differentiation.

Example 6, cell proliferation experiment

In the development of psoriasis, it is often accompanied by abnormal proliferation of keratinocytes. HaCaT/shRNA-scramble cells and HaCaT/shRNA cells were used as cell models, and the effect of inhibiting lmo4 gene expression on cell proliferation was detected by MTT assay.

The MTT detection method includes the following steps:

1) Inoculation of HaCaT/shRNA-scramble cells and HaCaT/shRNA cells: a cell suspension was prepared from DMEM containing 10% FBS, and 2000 cells per well were seeded into 96-well plates at a volume of 100 μl per well, and the remaining wells were filled with PBS. full.

2) After the cells were attached, the cells were replaced with K-SFM medium for 1 d, and the cells were returned to the differentiated spindle-shaped state, and then replaced with DMEM medium for 5 days.

3) Color reaction: 10 μl of 5 mg/mL MTT (purchased from Biyuntian Biological Co., Ltd.) was added to each well in a clean bench. Take care to avoid light. After incubating for 4 hours in a 37 ° C incubator, carefully discard the culture solution in the well. 100 μl of DMSO (purchased from Sigma, USA) was added and placed in a 37 ° C incubator for 5 to 10 minutes to completely dissolve the blue-violet crystal.

4) Colorimetric: The wavelength of 570 nm was selected, and the light absorption value of each well was measured on an enzyme-linked immunosorbent detector, and the results were recorded. The OD increase values of each group were calculated and plotted against the OD value of 0d. The cell proliferation inhibition rate was calculated: [(the average OD value of the control group - the average OD value of the interference group) ÷ the average OD value of the control group] × 100%.

The results of MTT assay are shown in Figure 12. The HaCaT cells inhibiting the expression of lmo4 gene, while inducing differentiation (1~5d), the increase of OD began from the first day, and the proliferation rate of cells was significantly lower than that of the control cells. They are: 1d (11.1%), 3d (26.7%), and 5d (11.6%). Thus, inhibition of lmo4 gene expression can inhibit the proliferation of HaCaT cells.

Example 7, preparing a topical medicine for treating psoriasis and its curative effect

By interfering with or inhibiting the expression of the lmo4 gene in skin cells of the lesion site of psoriasis patients, it was confirmed at the cell level experiment (Examples 5 and 6) that the differentiation of keratinocytes and the proliferation of cells in each layer were inhibited. Development of a topical drug for the treatment of psoriasis acting on the final target of psoriasis (keratinocytes).

The invention adopts a lentivirus infection technique based on the cell layer below the keratinized layer which is difficult for the external drug to enter the lesion site. It is easy to infect cells below the keratinized layer in the lesion area, and has good curative effect. At the same time, the topical medicine is convenient and safe to use.

Industrial applicability

The invention proves that the lmo4 gene is associated with hyperproliferation and abnormal differentiation of skin keratinocytes in patients with psoriasis, thereby inhibiting the expression level of lmo4 gene in human skin tissue cells to interfere with and inhibit excessive skin keratinocytes in patients with psoriasis. Proliferation and abnormal differentiation, according to which a recombinant lentiviral vector which inhibits expression of lmo4 gene or a recombinant lentivirus which inhibits expression of lmo4 gene is used as an active ingredient to prepare psoriasis (psoriasis) therapeutic drugs, particularly for topical drugs, The invention inhibits the expression of lmo4 gene in skin tissue cells of the lesions of psoriasis patients, inhibits excessive proliferation and abnormal differentiation of keratinocytes, and achieves the purpose of local treatment of psoriasis, and has industrial applicability.

Claims (10)

1. The human LIM domain only 4 gene (abbreviated as lmo4) is used in the preparation of a topical therapeutic drug for psoriasis (psoriasis).
2. The use according to Claim 1, characterized in that the active ingredient in the medicament is a recombinant lentiviral vector which inhibits expression of the lmo4 gene or a recombinant lentivirus which inhibits expression of the lmo4 gene.
3. The use according to claim 2, wherein the recombinant lentiviral vector for inhibiting expression of the lmo4 gene is constructed based on a lentiviral vector, capable of expressing small interference RNA (siRNA) and specifically inhibiting lmo4 The recombinant lentiviral vector expressed comprises the following steps:

   1) designing a small hairpin RNA (shRNA) sequence that specifically interferes with the human lmo4 gene;

   2) According to the designed shRNA sequence, the corresponding single-chain Oligo DNA and its complementary strand of Oligo DNA single strand are synthesized, and the synthesized Oligo DNA and its complementary strand are mixed according to the molecular number 1:1 ratio, and annealed to form a double Chain Oligo DNA;

   3) According to the multiple cloning enzyme of the lentiviral vector, the double-stranded Oligo DNA was ligated with the lentiviral RNAi interference vector to obtain a recombinant lentiviral RNAi interference vector which inhibits the expression of the lmo4 gene.
4. The use according to claim 3, characterized in that in the step 1), the shRNA which inhibits the expression of the lmo4 gene, which is designed for the open reading codon (ORF) sequence of human lmo4 mRNA (sequence 1 in the sequence listing, GenBank number: NM_006769), Is one of the following RNA sequences:

   (1) Sequence 2 in the sequence listing, designated as shRNA1;

   (2) Sequence 3 in the sequence listing, designated as shRNA2.
5. The use according to claim 4, wherein the double-stranded Oligo DNA in step 2) is a shRNA encoding an expression of the lmo4 gene, and is one of the following double-stranded DNA sequences:

   (1) The single strand of Oligo DNA of shRNA1 is sequence 4 in the sequence listing, and the complementary strand thereof is sequence 5 in the sequence listing;

   (2) The single strand of Oligo DNA of shRNA2 is sequence 6 in the sequence listing, and the complementary strand thereof is sequence 7 in the sequence listing.
6. The use according to claim 5, characterized in that: (1) the shRNA encoded by the double-stranded Oligo DNA is named as double-stranded shRNA1, and shRNA generated in the cell is cleaved by Dicer to form siRNA1, and the sequence is: 5'- AUUGAUGUAGUGAAACCGA-3' (sequence 8 in the sequence listing), which is the human lmo4 mRNA open reading codon (ORF) sequence (sequence 1 in the sequence listing, GenBank number: NM_006769) from the 5' end 1158 to 1176 bp position sequence 5 The homologous sequence of '-tcggtttcactacatcaat-3' binds to 5'-tcggtttcactacatcaat-3' by complementary pairing to induce lmo4 mRNA degradation; the (2) double-stranded Oligo DNA-encoded shRNA is named double-stranded shRNA2, which is produced in cells. shRNA is cleaved by Dicer to form siRNA2, and its sequence is: 5'-AUGAUACACAUUGCCUUGC-3' (sequence 9 in the sequence listing). The siRNA2 is a homologous sequence of the 5'-gcaaggcaatgtgtatcat-3' sequence from the 5' to 1089 to 1107 bp position of the 5' end of the human lmo4 mRNA open reading codon (ORF) sequence (sequence 1 in the sequence listing, GenBank number: NM_006769), and 5'-gcaaggcaatgtgtatcat-3' binds by complementary pairing to induce degradation of lmo4 mRNA.
7. The use according to claim 6, wherein the lentiviral RNAi interference vector in step 3) is pGV248, and the recombinant lentiviral RNAi interference vector which inhibits lmo4 gene expression is named pGV248-shRNA1 and pGV248-shRNA2, collectively referred to as pGV248-shRNA.
8. The use according to claim 2, wherein the recombinant lentivirus which inhibits expression of the lmo4 gene is a recombinant lentiviral RNAi interference vector and lentiviral vector which inhibit expression of the lmo4 gene according to any one of claims 3-7. After the helper plasmid (package plasmid and envelope plasmid) in the system was mixed, the lentivirus-packaged cells were transfected by liposome-mediated method to obtain a recombinant lentivirus carrying the shRNA-encoding gene for inhibiting the expression of the lmo4 gene.
9. The use according to claim 8, wherein the helper plasmid in the lentiviral vector system is a packaging plasmid containing a gag, pol or rev gene, and the additional helper plasmid is an envelope plasmid containing the envelope protein gene vsvg. The lentiviral RNAi interference vector which inhibits the expression of lmo4 gene is mixed with the packaging plasmid and the envelope plasmid in the lentiviral vector system at a mass ratio of 3 to 10:3 to 10:1, and the lentivirus-packaged cells are transfected by the liposome. -T cells, after transfection, 293-T cell supernatants were collected and centrifuged to obtain a concentrated virus.
10. The shRNA which inhibits expression of the lmo4 gene according to any one of claims 3 to 7, which may specifically be Sequence 2 or Sequence 3, and the double-stranded Oligo DNA encoding the shRNA which inhibits expression of the lmo4 gene (specifically, Sequence 4 and Sequence 5, or Sequence 6 and sequence 7), or a recombinant lentiviral RNAi interference vector (specifically, pGV248-shRNA) which inhibits expression of the lmo4 gene, or a recombinant lentivirus which inhibits expression of the lmo4 gene according to claim 8 or 9.

Images