CN103710363B

CN103710363B - Laccase gene Lac6 and expression protein and application thereof

Info

Publication number: CN103710363B
Application number: CN201310689485.5A
Authority: CN
Inventors: 丁少军; 顾春娟; 王燕
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2013-12-16
Filing date: 2013-12-16
Publication date: 2015-06-10
Anticipated expiration: 2033-12-16
Also published as: CN103710363A

Abstract

The invention discloses a laccase gene Lac6 and expression protein and application thereof. The DNA sequence of the laccase gene Lac6 is shown in SEQ ID NO.1. According to the laccase gene Lac6 and the expression protein and application thereof, shown by research on the decoloration of recombinant coprinus comatus laccase through 13 kinds of dyes, the decoloration action of recombinant laccase Lac6+10AA mainly occurs in the beginning 1-2 hours of reaction, the decoloration speed is retarded along with time, the decoloration effect of pure laccase is obviously better than that of a crude laccase solution, and the decoloration ratio can be increased after HBT is added into crude laccase or pure laccase; the Lac6+10AA has a relatively good decoloration effect on remazol brilliant blue and malachite green, and the decoloration ratio can reach over 90% after the mediator HBT is added. The laccase gene Lac6 has a very good industrial application prospect and can generate relatively good economic and social effects.

Description

A kind of laccase gene Lac6 and expressing protein thereof and application

Technical field

Gene engineering technology field of the present invention, particularly a kind of laccase gene Lac6 and expressing protein thereof and application.

Background technology

Laccase is a kind of polyphenoloxidase of cupric, with Vitamin C oxidase and mammalian plasma copper-protein homology, all belong to blue blue multicopper oxidase family, because laccase has special catalytic performance and substrate specificity widely, it is at textile dyestuff decolouring and association with pulp bleaching, Polymer Synthesizing, environment measuring, foodstuffs industry, the aspects such as removing toxic substances and biological restoration have potential using value, therefore, the focus of enzyme technology and the research of environmental science crossing domain is in the world become at present about the heterogenous expression of laccase and the research of expression regulation thereof.

Research about edible fungus laccase gets more and more, such as, occurred the relevant report of honey mushroom, Pleurotus eryngii, Coprinus comatus, flat mushroom, mushroom, needle mushroom etc.Research now about laccase not only relates in its biological characteristics, separation and purification etc., and oneself enters the genetically engineered stage through being deep into molecular level.But the expression amount of multiple laccase self is very low, to the Cloned culturing of laccase gene, make its high expression restructuring laccase protein on heterologous host, be that to solve its high expression level and applied be important means, therefore someone studies the heterogenous expression of laccase always.

Laccase has multiple isozyme, the fungal laccase of different sources, at molecular weight, have certain difference to the adaptability of temperature and pH and the characteristic aspect such as tolerance, enzymatic reaction kinetics, the enzymatic property of same biogenic different isozyme also there are differences.Therefore also need constantly to further investigate laccase.

Summary of the invention

Goal of the invention: for the deficiencies in the prior art, the object of this invention is to provide a kind of laccase gene Lac6.Another object of the present invention is to provide the expressing protein of a kind of above-mentioned laccase gene Lac6.The present invention also has an object to be to provide the application of a kind of above-mentioned laccase gene Lac6.By the decolorization to 13 kinds of different dyes, for the heterogenous expression of laccase and industrial applications thereof provide theoretical foundation.

Technical scheme: in order to realize foregoing invention object, the technical solution used in the present invention is as follows:

A kind of laccase gene Lac6, its DNA sequence dna is as shown in SEQ ID NO.1.

The expressing protein of described laccase gene, its aminoacid sequence is as shown in SEQ ID NO.2.

An expression method for the expressing protein of described laccase gene, aminoacid sequence shown in described SEQ ID NO.2 is added with the expression label of 10 aminoacid sequence compositions, and described aminoacid sequence is TPFPPFNTNS; Expressed protein sequence is as shown in SEQ ID NO.3.

Described laccase gene Lac6 is to the application in the decolouring of dyestuff.

Beneficial effect: compared with prior art, laccase gene of the present invention and expressing protein thereof and application, the advantage had is: studied restructuring Coprinus comatus decolorization by 13 kinds of dyestuffs, find that the decolorization of restructuring laccase Lac6+10AA mainly occurs in 1 of reaction beginning, in 2 hours, along with the prolongation of time, decolorization rate slows down, the decolorizing effect of pure enzyme is obviously better than crude enzyme liquid, and thick enzyme or pure enzyme all can increase adding HBT rear decoloring rate.The decolorizing effect of Lac6+10AA to thunder agate azoles light blue and malachite green is relatively good, adds amboceptor HBT rear decoloring rate and all can reach more than 90%.There is good prospects for commercial application, can good economic benefit and social effect be produced.

Accompanying drawing explanation

Fig. 1 is Coprinus comatus total serum IgE agarose gel electrophoresis figure; In figure, M is Marker, and 1 is the Coprinus comatus total serum IgE extracted;

Fig. 2 is Coprinus comatus DNA agarose gel electrophoresis figure; In figure, M is Marker, and 1,2 is the Coprinus comatus DNA extracted;

Fig. 3 is the amplification figure of degenerated primers; Left figure is a position and No. two position primer PCR results, and right figure is a position and No. four position primer PCR results;

Fig. 4 is recombinant plasmid PCR Screening and Identification result figure; In figure, M is Marker, 1-8 is positive colony result;

Fig. 5 is recombinant plasmid PCR Screening and Identification result figure; In figure, M is Marker, 1-10 is positive colony result;

Fig. 6 is 5 ' RACE amplification figure; M is Marker, and No. 1 swimming lane is amplified production; C:lac65 ' RACE;

Fig. 7 is laccase 3 '-RACE amplification;

Fig. 8 is that the PCR of lac6+10AA Xba I, sac II restriction enzyme site obtains electrophorogram, and M is Marker, No. 1 result for PCR introducing restriction enzyme site;

Fig. 9 is recombinant plasmid lac6+10AA PCR Screening and Identification result figure, and M is Marker; 1-10 swimming lane is the result that the hickie selected is PCR;

Figure 10 is that recombinant plasmid extracts result electrophorogram; M:mark, 2:lac6+10AA;

Figure 11 is that the dull and stereotyped biological respinse of MM detects laccase lac6 Activity Results figure; B:lac6+10AA;

Figure 12 is the growth curve chart of restructuring laccase;

Figure 13 be copper ion concentration laccase lac6+10AA is expressed affect result figure;

Figure 14 is enzyme liquid SDS-PAGE detected result figure after separation and purification;

The optimum temperuture result figure of Figure 15 Coprinus comatus restructuring laccase Lac6+10AA;

Figure 16 recombinates the thermal stability results figure of laccase Lac6+10AA;

Figure 17 recombinates the optimal reaction pH result figure of laccase Lac6+10AA;

Figure 18 recombinates the pH stability result figure of laccase Lac6+10AA;

Figure 19 be different time the pure enzyme of Lac6+10AA (without medium) is decoloured affect result figure;

Figure 20 is that different time affects result figure to the impact that the pure enzyme of Lac6+10AA (having medium) decolours;

Figure 21 is that restructuring Coprinus comatus laccase Lac6+10AA is to the decolouring result figure of anthraquinone dyes;

Figure 22 is that restructuring Coprinus comatus laccase Lac6+10AA is to the decolouring result figure of azo dyes;

Figure 23 is that restructuring Coprinus comatus laccase Lac6+10AA is to the decolouring result figure of triphenylmethane dye.

Embodiment

Below in conjunction with specific embodiment, the present invention is further illustrated.

Embodiment 1

(1) acquisition of shaggy mane mycelium

Strain of coprinus comatus is inoculated into PDA flat board from test tube slant, is placed in 25 DEG C of constant incubators and cultivates.It is (Coprinus comatus needs about the ten days) punching on the PDA flat board covering with mycelia of the punch tool of 1cm with sterilized diameter, choose four ferfas and put off in each sterilized 250mL triangular flask (every bottle containing 30mL liquid nutrient medium), be placed in 25 DEG C of constant incubators and cultivate.At the 10th day, add coffic acid (final concentration is 1mM) induction, within the 22nd day, collect mycelia.By mycelia filtered through gauze, then rinse twice with PBS, put into-80 DEG C of Refrigerator stores after liquid nitrogen flash freezer for subsequent use.

(2) extraction of total serum IgE

The TRIZOL reagent of Invitrogen is adopted to extract, detailed process: taken out from-80 DEG C of refrigerators by Coprinus comatus sample, liquid nitrogen grinding powdered; Get appropriate powder and add 1mL TRIZOL reagent, vibrate 6 times, each 15s, room temperature places 5min; Add 0.2mL chloroform, concussion mixes, and room temperature leaves standstill 5min; With the rotating speed 4 DEG C of centrifugal 15min being less than or equal to 12000g; Supernatant liquor is transferred to clean centrifuge tube, adds Virahol 0.25mL, and the NaAc0.25mL for several times room temperature that turns upside down leaves standstill 10min, with the centrifugal 4 DEG C of centrifugal 10min of the rotating speed being no more than 12000g; Abandon supernatant, precipitation uses 75% ethanol purge, softly blows and beats, make precipitation levitating with rifle; With the speed 4 DEG C of centrifugal 5min being less than 7500g; Abandon supernatant, add the rinsing again of 75% ethanol, centrifugation step is the same; Abandon the dry RNA of supernatant, add 20-30 μ LDEPC-H ₂o dissolves ,-80 DEG C of preservations.

The RNA extracted runs agarose electrophoresis, after electrophoretic separation and ethidium bromide staining, judges the integrity of RNA according to the brightness of abundant 28S and 18S ribosome-RNA(rRNA) (rRNA) band.The RNA of thick extraction detects through the agarose gel electrophoresis of non denatured 1%, and as shown in Figure 1,18S and 28S two RNA feature bright bands appear in sample, and RNA quality is better, can follow-uply use.

(3) extraction of Coprinus comatus genomic dna

The extracting method of fungal DNA is with reference to laboratory manual: get 1g mycelia, abundant by liquid nitrogen grinding; Add 10mL DNA lysis buffer(0.1M Tris-Hcl(pH8.0), 0.05M EDTA, 0.5%SDS, 1% beta-mercaptoethanol, 65 DEG C of insulation 1h; Add equal-volume phenol: chloroform: primary isoamyl alcohol (25:24:1), 10000g, 4 DEG C, 15min; Turn the clean centrifuge tube of supernatant to, add equal-volume chloroform: primary isoamyl alcohol (24:1), 10000g, 4 DEG C, 15min; Turn supernatant liquor, add the 3M NaAc(pH5.2 of 1/3 volume), monoploid amasss Virahol; Place 1 hour for-20 DEG C, 10000g, 4 DEG C, 5min; Add 15mL75% ethanol, rinsing DNA precipitates, and room temperature places dry 30min(extremely without ethanol taste); Add 500 μ L TE buffer to dissolve, transfer to the centrifuge tube of 1.5mL; Add RNase10uL, 37 DEG C of insulation 1h; Phenol imitates extracting: 1. add 1 times of volume phenol, and room temperature places 10min, 13000rmp, 10min, gets supernatant; 2. 1/2 volume phenol+1/2 volume of chloroform, room temperature places 10min, 13000rmp, 10min, gets supernatant; 3. monoploid amasss chloroform, and room temperature places 10min, 13000rmp, 10min, gets supernatant.Alcohol settling: 1. 2 times of volume dehydrated alcohols, 1/10 volume 3M NaAc(pH5.2), place a few hours for-20 DEG C; 2. 4 DEG C, 16000rmp, centrifugal 15min, abandons supernatant; 3. add 75% ethanol rinse and precipitate 2 times, air-dry; 4. 500 μ L TE buffer dissolution precipitations are added ,-20 DEG C of preservations.

The DNA agarose gel electrophoresis extracted is identified, as shown in Figure 2, have clear band as seen at more than 5000bp, this DNA can be used as follow-up test.

(4) acquisition of Coprinus comatus laccase gene group DNA sequence dna

Most fungal laccase is monomeric protein, and generally all contain 4 copper atoms in enzyme molecule, the conserved amino acid sequence according to copper land can design degenerated primers, clone's laccase.

Amplification laccase gene fragment primer: position forward primer: 5 '-CAYTGGCAYGGNTTYTTYCA-3 '; No. two position reverse primer: 5 '-GRCTGTGGTACCAGAANGTNCC-3 '; No. four position reverse primers: 5 '-TGCCARTCDATRTGRCARTG _-3 '.

Regular-PCR, adopts 25 μ L PCR system: 2 μ L25 × dNTP Mix, 1.5 μ L Mg ⁺(MgCl ₂), 2.5 μ L10 × Advantage2PCR buffer, 15.375 μ L PCR-H ₂o, 2.5 μ L template DNAs, 0.125 μ L RTaq, 0.5 μ L forward primer, 0.5 μ L reverse primer.

PCR condition: 95 DEG C (1min), 95 DEG C (30s), 55 DEG C (30s), 72 DEG C (2min); 28circles.

The recovery of object fragment, step is as follows: (1) first weighs the quality of the centrifuge tube of empty 1.5mL, weighs the weight putting into the centrifuge tube of glue subsequently.To record the weight of glue, the corresponding 1 μ L of 1mg.(2) add buffer GC 6 ~ 8min in 68 DEG C of waters bath with thermostatic control extremely to dissolve completely (period often crosses 2 minutes best shaken several times to guarantee abundant dissolving).(3) solution after dissolving is proceeded in the special centrifuge tube of purifying, 12000g, 1min.(4) solution in pipe abandon, adds 500 Μ LDNA Washing Buffer, 12000g, 1min.(5) solution in pipe abandon, idle running is once to remove alcohol residual in DNA Washing Buffer.(6) get a clean centrifuge tube, strainer is placed in centrifuge tube.(7) about 30 μ L ddH are added ₂o fully dissolves, 12000g, centrifugal 1min.(8) for ensureing that object sample dissolves completely, the lysate sucking-off in test tube is also squeezed into strainer, recentrifuge again.(9) get the DNA after 5 μ L purifications, carry out identification of dna quality.

Use a position forward primer and No. two position reverse primers, a position forward primer and No. four position reverse primers, with the DNA extracted for template, PCR primer carries out agarose gel electrophoresis qualification, result as shown in Figure 3, the amplified production size of a position and No. two position primers is at about 200bp, the amplified production size of a position and No. four position primers is at about 1600bp, and this is identical with expected results, and these amplified productions available carry out follow-up test.

The connection of purified product and PCR carrier: purified product adds A(VITAMIN B4) put into PCR instrument, 70 DEG C, 30min after tail.Tailing system is: 1 μ L10 × PCR buffer(Mg ²⁺free), 1 μ L MgCl ₂(25mM), 1 μ L dATP(50 ×), 1 μ L Taq polymerase, 7 μ L purified products.

Be connected on PCR carrier by the fragment of the above-mentioned A of adding tail, 4 DEG C of connections are spent the night.Linked system is: 1 μ L10 × ligation buffer, 2 μ L PCR2.1vector, 6 μ L add the product after A tail, 1 μ L T4DNA ligase.

Prepare competent escherichia coli cell: activation intestinal bacteria, cultivate bacterium, about 2 hours with the triangular flask (adding 250mL LB substratum) of 1L, survey OD value 0.5.Centrifugal in packing 50mL centrifuge tube, 2000g, centrifugal 6mim.Add 10mL calcium chloride (first placing in ice) to suspend, 3 pipes are 1 pipe also, is finally settled to 20mL.1200g, 6min are centrifugal.Add 10mL calcium chloride to suspend gently, in ice, place 30min.1200g, 6min are centrifugal.Add 2mL ~ 3mL calcium chloride to suspend, packing 100ul mono-manages ,-80 DEG C of preservations.

Transformation of E. coli DH5 α competent cell: 1. DH5 α competent cell (200 μ l) is taken out from-80 DEG C of refrigerators, thaw on ice.2. connection product is added in the DH5 α thawed, mix with liquid-transfering gun.3. the ice bath 30min even longer time.4. 42 DEG C of thermal shock 2min(are accurate).5. add 0.5mL LB substratum, 37 DEG C, 200rpm, shaking table cultivates 1 hour.6. because bacterium liquid is denseer, therefore do not carry out centrifugal concentrating, IPTG40 μ L and X-Gal20 μ L mixes, after thalline added to be coated with LBA dull and stereotyped.7. overnight incubation in 37 DEG C of incubators.

Blue hickie and bacterium colony PCR screening positive clone also check order: be template from coating containing picking hickie the LBA flat board of IPTG and X-Gal, with T7, M13reverse for primer program 2.2.4.2 carries out pcr amplification, screen the hickie be of convenient length, get positive strain order-checking.Two groups of PCR primer are connected with PCR carrier, proceed to E. coli competent, the LBA of coating containing IPTG and X-Gal is dull and stereotyped, and 37 DEG C of incubated overnight obtain blue hickie, according to the α-complementary principle of β-glucose Glycosylase, know that the hickie obtained is the positive colony inserting exogenous genetic fragment.Bacterium colony PCR screening is carried out to hickie, to determine the recombinant plasmid inserting exogenous genetic fragment.

Due to the about 180bp of length between M13reverse, T7 primer, so amplification fragment is out larger than Insert Fragment, as shown in Figures 4 and 5, recombinant conversion efficiency is very high for result, the some order-checkings of random each picking.Be that primer PCR filters out and amplifies the suitable thalline of fragment length with general M13reverse, T7, order-checking.Obtain Coprinus comatus genomic dna sequence fragment.Online at NCBI, through blast, above sequence is determined that they are that laccase gene fragment is errorless successively.

Design of primers is the important factor of RACE success.The Coprinus comatus genomic dna sequence fragment obtained according to checking order devises the gene-specific primer for the Coprinus comatus 5 ' terminal sequence that increases:

Laccase6GSP1：5’-GGACATTGATTGACACCAGTCGCGCCA-3’；

5 ' RACE reaction system: 2.5 μ L5 ' RACE-ready cDNA, 5 μ L UPM(10 ×), 1 μ L LaccaseGSP1,41.5 μ L Master Mix(34.5 μ L PCR-H ₂o, 1 μ L50 × Advantage2polymerase Mix, 5 μ L10 × Advantage2PCR buffer, 1 μ L50 × dNTP Mix).

PCR program: 94 DEG C of denaturation 5min; 94 DEG C of 30s, 65 DEG C of 30s, 72 DEG C of 3min; 34cycles; 72 DEG C of 5min.PCR primer detects through the agarose gel electrophoresis of 1.0%.

Use the SMARTTM RACE cDNA Amplification test kit of CLONTECH company, take total serum IgE as 5 '-RACE ready cDNA of Material synthesis be masterplate (method is with 3 '-RACE ready cDNA), carry primer UPM and laccase Auele Specific Primer Laccase6GSP1 with test kit to increase, electrophoresis detection result as shown in Figure 6, a specificity bright band is there is at 500bp right position in laccase gene 5 '-RACE after increasing, expanding effect is obvious ,-20 DEG C of preservations after the Universal DNA Purification Kit purifying of amplified production use TIANGEN.

The connection of the recovery purifying of object fragment, purified product and PCR carrier, recombinant plasmid transformed competent escherichia coli cell, blue hickie screening positive clone, order-checking, method is all the same.

Fragment after laccase 5 '-RACE amplification, purifying is connected with PCR2.1Vector, transform DH5 α, the LBA of coating containing IPTG and X-Gal is dull and stereotyped, and according to the α-complementary principle of β-glucose Glycosylase, the hickie obtained is probably the positive colony inserting exogenous genetic fragment.Therefore often organize random picking 10 white colonies and carry out colony PCR amplification, then identified by agarose gel electrophoresis, select the company that send of band correct position to check order.Obtain 5 '-RACE sequence fragment sequence as follows:

CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGTACGCGGGGGCTACTAATATTGTCTTACATACAACACAGGAGATTCTTCTGCATATACCTCGGGGGGAAAATCTACATTTTTTCCCAGGCTTGAAGAGAACATCGCACCGCCACCTCCTTTAAAACTTCTCCTTAAACCGAAAATAATGTCTCAAGCAGATGCATATTTAAACGCTGGTTCCGACACTCAACTTTAGACTCATCTTCTCTTATCATGACACTCACGACCTCCCGCTTGGGAATAACCAACTCTCTTTTTGTCGCTCTTTTGGGTGTGAACACCTACACTCTTGCTTCAGTCCTCATACCGCACTCGACTCTGACTCTCACGAATCAGTTGATTGCTCCCGATGGCTTCCAACGCTCTGCCATTGTGGTCAACGGCGAACATCCAGGACCACTGATTCAGGCGACTAAGGGTGACGGATTTATGGTAAATGTGGTTAATCAACTCACAGACCCTACCATGCAGAGGGCAGCGTCTGTACA TTGGCATGGTTTTTTTCAACGAGGAA

In sequence, wavy line line part is the base sequence of gene-specific primer GSP1 complementation, and italic dashed part is 5 '-RACE template, 5 ' Long UP+Smart II oligo held, and the ATG of dash area is laccase lac6 initiator codon.Short fragment sequence is translated into protein, uses SignalP4.0server to carry out the analysis of signal peptide, result display 5 '-RACE amplified reaction arrive 5 ' to be held, and include the signal peptide of gene self, front 28 amino acid are signal peptide sequence.

(5) acquisition of laccase cDNA total length

The synthesis of 3 '-RACE Ready cDNA, operation steps: 1. add in centrifuge tube: the Coprinus comatus total serum IgE 1 μ l of extraction, 3 '-CDS primer1 μ l, Smart II oligo1 μ l, H ₂o2 μ l, mixes solution, and micro-centrifugal solution aggregation that makes is bottom centrifuge tube.2. 70 DEG C of water-bath 2min.3. cooled on ice 2min, to be micro-ly centrifugally sunken to solution bottom centrifuge tube.4. following material is added in this centrifuge tube: 5 × Frist strand buffer2 μ l, DTT(20mM) 1 μ l, dNTP Mix(10mM) 1 μ l, PowerScript Reverse Transcriptase1 μ l.5. mixed by solution with rifle, micro-centrifugal solution that makes sinks to bottom centrifuge tube.6. the non-water-bath of 42 DEG C of insulation 1.5h().7. the Tricine-EDTA buffer of 100 μ l is added.8. heat 72 DEG C of 7min, sample retention is at-20 DEG C.

The design of 3 '-RACE gene-specific primer (GSP2): according to acquired 5 ' end sequence, use primer-design software Primer Premier5.0, have devised the gene-specific primer GSP2 that holds near 5 ' to obtain cDNA total length according to the annealing temperature of required primer and primer length.

Laccase6GSP2：5’-CTCACGACCTCCCGCTTGGGAATAACCAAC-3’；

3 '-RACE reaction system: 2.5 μ L3 ' RACE-ready cDNA, 5 μ L UPM(10 ×), 1 μ L LaccaseGSP2,41.5 μ L Master Mix(34.5 μ L PCR-H ₂o, 1 μ L50 × Advantage2polymerase Mix, 5 μ L10 × Advantage2PCR buffer, 1 μ L50 × dNTP Mix).

Use the SMARTTM RACE cDNA Amplification test kit of CLONTECH company, take total serum IgE as 3 '-RACE ready cDNA of Material synthesis be masterplate, after carrying primer UPM and laccase Auele Specific Primer GSP2 amplification with test kit, electrophoresis detection result, as shown in Figure 7, a specificity bright band is there is at 1500bp right position in laccase gene 3 '-RACE after increasing, expanding effect is obvious ,-20 DEG C of preservations after the Universal DNA Purification Kit purifying of amplified production use TIANGEN.

Fragment after laccase 3 '-RACE amplification, purifying is connected with PCR2.1Vector, transform DH5 α, the LBA of coating containing IPTG and X-Gal is dull and stereotyped, and according to the α-complementary principle of β-glucose Glycosylase, the hickie obtained is probably the positive colony inserting exogenous genetic fragment.Therefore often organize random picking 10 white colonies and carry out colony PCR amplification, then identified by agarose gel electrophoresis, select the company that send of band correct position to check order.

The rubber tapping Purification Kit PCR primer of TIANGEN is adopted to obtain cDNA total length, be connected on PCR carrier, transformation of E. coli competent cell DH5 α, hickie is chosen with T7 after blue hickie screening, M13Reverse is that primer is tested, choose and expand the suitable bacterium colony of fragment length, check order after enlarged culturing, obtain full length sequence 2046bp, as shown in SEQ ID NO.1, online at NCBI, through blast, above sequence is determined that they are that laccase gene fragment is errorless successively, called after laccase gene lac6, the aminoacid sequence of its expressing protein is as shown in SEQ ID NO.2.

Embodiment 2

The bacterial classification that the present embodiment uses, reagent, substratum are as follows:

Yeast KM71H(Mut ^s, Arg ⁺) and (Invitrogen) of expression vector pPicz α B.PGEM-T EasyVector system I(Promega), Plasmid Miniprep Kit(BIOMIGA), AxyPrep PCR Cleanup Kit(AXYGEN), EasySelectTM Pichia Expression Kit(Invitrogen), rTaqDNA Ploymerase(TakaRa), Pfu DNA Ploymerase(Promega), T4DNA Ligase(Promega, Invitrogen), Xba I(promega), sacII(Takara), Sac I(Fermentas), Amp(penbritin SIGMA), EtBr(ethidium bromide AMERSCO), dNTP(TakaRa, Promega), Seakem LE agarose(BMA), all the other reagent are conventional use reagent.

LBA solid medium: often liter of substratum adds 25g agar except same LB substratum equally adds peptone, yeast decoction, NaCl, autoclave sterilization 20min at 121 DEG C, Amp is added when substratum is cooled to 55 DEG C, make ultimate density reach 100 μ g/mL, then pour culture dish into and make flat board.

LBZ(1L): 10g Tryptone, 5g Yeast Extract, 5g NaCl, be cooled to about 60 DEG C, add 1mL ZeocinTM after autoclave sterilization.To make flat board, then add 15g Agar before sterilization.

YPD(1L): 10g Yeast Extract, 20g peptone, be dissolved in 900mL water, autoclave sterilization, adds the glucose of 10 sterilized × D(20% of 100mL), to make flat board, then 15g Agar is added before sterilization.

YPDS+ZeocinTM is dull and stereotyped: 10g Yeast Extract, 20g peptone, 182.2g Sorbitol, 20g Agar is dissolved in 900mL water, autoclave sterilization, adds the glucose of 10 sterilized × D(20% of 100mL), be cooled to about 60 DEG C, add 1mL100mg/mL ZeocinTM, be down flat plate flat board and solidify rear 4 DEG C of preservations.

BMGY:10g Yeast Extract, 20g peptone is dissolved in 700mL water, autoclave sterilization, the potassium phosphate buffer (warm autoclaving) of the 1M of 100mL pH=6 is added after cool to room temperature, the sterilizing of 100mL10 × YNB(filter membrane), 2mL500 × B(20mg biotin is dissolved in the water of 100mL, filter membrane sterilizing), 100mL10 × GY(100mL glycerine is dissolved in 900mL water autoclave sterilization), mix rear 4 DEG C of preservations.

BMMY:10g Yeast Extract, 20g peptone is dissolved in 700mL water, autoclave sterilization, add after cool to room temperature, the potassium phosphate buffer (warm autoclaving) of the 1M of 100mL pH=6, the sterilizing of 100mL10 × YNB(filter membrane), 2mL500 × B(20mg biotin is dissolved in the water of 100mL, filter membrane sterilizing), the methyl alcohol of 100mL10 × M(5%), mix rear 4 DEG C of preservations

MM flat board (1L) is (containing 0.2mM Cu ²⁺, 0.1mM ABTS): 0.05gABTS, 0.032gCuSO4,15g Agar is dissolved in 800mL water autoclave sterilization, adds the sterilizing of 100mL10 × YNB(filter membrane after cool to room temperature), 2mL500 × B(20mg biotin is dissolved in the water of 100mL, filter membrane sterilizing), the methyl alcohol of 100mL10 × M(5%)

Separation and purification solution: A liquid (20mM Tris-HCl, pH8.0): take Tris2.4228g, adding distil water, to 800mL, is settled to 1L, 4 DEG C storages after regulating pH to 8.0 with HCl.B liquid (containing the Tris-HCl damping fluid of 1M NaCl, pH8.0): take Tris2.4228g, NaCl58.44g, adding distil water, to 800mL, is settled to 1L, 4 DEG C storages after regulating pH to 8.0 with HCl.

Sieve chromatography buffer: NaH ₂pO ₄-Na ₂hPO ₄buffer:20mM NaH ₂pO ₄, 20mM NaH ₂pO ₄, adjust pH to 7.0.

SDS-PAGE reagent: polyacrylamide list binary: (30:0.8) takes 30g Arc, 0.8g Bis adds after 50mL distilled water fully dissolves and is settled to 100mL, 4 DEG C of storages.

5 × seperating buffer(pH8.8): 22.69g Tris base0.125mL TEMED, 0.5g SDS adjusts pH to 8.8, is settled to 100mL.

5 × stacking buffer(pH6.8): 9.85g Tris base, 0.125mL TEMED, 0.5g SDS adjust pH to 6.8, are settled to 100mL.

5 × sample buffer:0.98g Tris base, 2.0g SDS, 7.5mL glycerine, 5mL beta-mercaptoethanol adjusts pH to 6.8, is settled to 100mL.

1 × Running buffer(pH8.3Tris-Gly): 3.027g Tris base, 14.41g glycine, 1.0g SDS adjust pH to 8.3, are settled to 1L.

5% ammonium persulphate: take 0.5g AP and add water and be settled to 10mL, point is filled in 1.5mL centrifuge tube ,-20 DEG C of storages.

Destainer (Destaining solution): methyl alcohol 400mL, distilled water 500mL, Glacial acetic acid 100mL.

One, the structure of expression vector

(1) design of laccase two ends restriction enzyme site

That select is pPICZ α B, if make the laccase gene reading frame of insertion correct, must introduce the restriction enzyme site of correct restriction enzyme on laccase gene.By analysis, the restriction enzyme site of these two restriction enzymes of Xba I and sac II be introduced, design primer:

Introducing 10 aminoacid sequences is: TPFPPFNTNS;

Corresponding nucleotides sequence is classified as: ACGCCATTCCCCCCTTTCAACACCAACTCT;

Restriction enzyme site XbaI:TCTAGA, sacII:CCGCGG;

Lac6gcDNAF：5’-GCTCTAGATGACGCCATTCCCCCCTTTCAACACCAACTCTTCAGTCCTCATACCGCACTCG-3’；

Lac6gcDNAR：5’-GTCCCCGCGGAACTGGCATTGGTAAAGAAGAGACA-3’；

The aminoacid sequence of the lac6+10AA built is as shown in SEQ ID NO.3.

(2) acquisition of the gene containing Xba I and sac II restriction enzyme site

Take recombinant plasmid as template, with Lac6gcDNAF, Lac6gcDNAR for upstream and downstream primer, use the pfu enzyme (reaction system: 5 μ L10 × pfu buffer with high-fidelity performance, 4 μ L dNTP(2.5mM), 1 μ L contains the recombinant plasmid of laccase gene, 1 μ L Primer lacgcDNAF, 1 μ L Primer lacgcDNAR, 0.5 μ L pfu DNA polymerase, 37.5 μ L PCR-H ₂o), with program D553(94 DEG C of denaturation 5min, 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 3min, 30cycles, 72 DEG C of 10min) amplification introducing restriction enzyme site, amplified production agarose gel electrophoresis detects, and result as shown in Figure 8, all meets the requirements with the primer amplified lac6+10AA band out containing restriction enzyme site designed.

(3) double digestion laccase gene and plasmid pPICZ α B

Laccase lac6+10AA gene PCR being introduced Xba I and sac II double enzyme site uses the product purification of TIANGEN to reclaim test kit by after PCR primer purifying, Xba I and sac II double digestion (double digestion reaction system: 4 μ L10 × buffer C is used respectively with plasmid pPICZ α B, 0.4 μ L0.1%BSA, 2 μ L Xba I, 1 μ L sac II, 15 μ L goal gene, 17.6 μ L PCR-H ₂o, 37 DEG C of enzymes are cut 3h and are continued follow-up test).Use the PCR clean up Kit purifying of TIANGEN to reclaim enzyme the lac6+10AA gene fragment after double digestion and expression vector pPICZ α B and cut after product, 1% agarose gel electrophoresis detects enzyme and cuts front and back, and result is correct.

(4) connection of laccase gene and pPICZ α B

Laccase lac6+10AA gene after double digestion is connected (linked system: the laccase gene fragment after 6 μ L double digestions respectively with expression vector pPICZ α B fragment, pPICZ α B after 2 μ L double digestions, 1 μ L10 × ligation buffer, 1 μ L T4DNA ligase) after, 4 DEG C are spent the night.

(5) conversion of product, screening and order-checking is connected

LBZ flat board is coated with by after the laccase recombinant plasmid pPICZ alpha B-10AA-lac6 transformation of E. coli competent cell DH5 α connected, after 37 DEG C of incubators spend the night, from plate, picking 1-10 single bacterium colony is with 3 ' AOX, and 5 ' AOX is primer (5 ' AOX:5'-GACTGGTTCCAATTGACAAGC-3'; 3 ' AOX:5'-GGCAAATGGCATTCTGACAT-3'), D553PCR increases, and the bacterium colony line conservation that screening amplified production is of convenient length, chooses 1-2 order-checking simultaneously.As shown in Figure 9, recombinant plasmid sequencing result translates into the aminoacid sequence of corresponding protein through expasy to electrophoresis result, and 5 ' part adds ten amino acid, 3 ' part has myc to mark, sequence is finally 6 Histidines, and translates smoothness completely, shows construction of recombinant plasmid success.

Two, recombinant plasmid electricity is transformed into Pichia pastoris

(1) alkaline process upgrading grain

The preparation of solution: Solution I:25mM Tris HCl(pH8.0), 10mM EDTA, 50mM Glucose.Solution II:0.2N NaOH, 1%SDS, mix 0.4NNaOH and 2%SDS before the use.Solution III(3M K+, 5M acetate): 29.4g potassium acetate+, 11.5mL glacial acetic acid, constant volume, can not heat sterilization to 100mL, room temperature preservation.Lysozyme（10mg/mL）

Operation steps: 1) inoculation is containing the DH5 α of laccase lac6+10AA gene in LBZ liquid nutrient medium, and the product getting 0.5-1mL overnight incubation is in the fresh substratum of 100mL, and 37 DEG C, 200rpm shaking table is cultivated until thalline saturated (cultivating about 20h); 2) with 50mL centrifuge tube 5000rpm, the centrifugal thalline of 10min; 3) 2mL Solution I and 100ul Lysozyme(10mg/mL is added) mix, room temperature places 5min; 4) add 4mL Solution II, vibration is until solution becomes clarification gently, places 5min on ice; 5) add 3mL Solution III, vibrate gently, room temperature places 5min; 6) the centrifugal 10min of 10000rpm; 7) supernatant liquor is transferred in a clean 50mL centrifuge tube; 8) add equal-volume Virahol to mix, place 10min or longer for-20 DEG C; 9) the centrifugal 30min of 12000rpm, removes supernatant, air-dry precipitation; 10) the TE buffer(pH8.0 of 1mL is added) dissolution precipitation, solution is proceeded in the centrifuge tube of 1.5mL; 11) RNase10ul is added, 37 DEG C of water-bath 30min; 12) phenol imitates extracting plasmid: add 1/2 volume of phenol, 1/2 volume of chloroform puts 10min, and 13000rpm is centrifugal, and 10min gets supernatant; 13) add equal-volume chloroform and put 10min, the centrifugal 10min of 13000rpm, gets supernatant; 14) add the sodium-acetate of 1/10 volume 3M, 2 times of volumes 100% ethanol place 5min on ice; 15) 4 DEG C of centrifugal 10min of 12000rpm, abandon supernatant, and the ethanol precipitated with 75% is washed; 16) add 70 μ l PCR-H2O after centrifugal airing, take out 2 μ l leakage of electricity swimming, and survey A260 calculating DNA concentration.

Utilize the alkaline process of plasmid to extract recombinant plasmid in a large number, the results are shown in Figure 10.

(2) plasmid linearization: with SacI single endonuclease digestion plasmid, make plasmid linearization.The endonuclease reaction system of SacI: 10 μ L contain the pPICZ α B of laccase lac+10AA gene, 5 μ L10 × buffer SacI, 3.5 μ L SacI restriction enzymes, 31.5 μ L PCR-H ₂o.After 37 DEG C of enzymes cut 1h, detection enzyme is cut quality and is met service requirements.

(3) plasmid electricity transformed yeast competent cell, step: 1) get competent cell that 80 μ L prepare and the linearizing plasmid DNA of 5-10ug (is dissolved in 5-10 μ L PCR-H ₂o), mix, the electricity they being proceeded to ice-cold 0.2cm transforms in cup; 2) electricity conversion cup and linearizing plasmid DNA place 5min on ice; 3) pulsed cell; 4) rapidly 1M sorbyl alcohol ice-cold for 1mL is added electricity and transform cup, after the thalline transformed by electricity in cup mixes, proceed in the centrifuge tube of 1.5mL; 5) centrifuge tube is incubated 1-2h at 30 DEG C, does not vibrate; 6) coated plate YPDS+ZeocinTM; 7) cultivate 2-3 days for 30 DEG C, formed to single bacterium colony; 8) choose 10-30 single bacterium colony, rule at fresh YPDS+ZeocinTM.

Three, there is the screening of the positive colony of laccase activity

Flat band method screening has bioactive bacterial strain: with toothpick picking positive colony list bacterium colony from YPDSZ flat board, point sample with containing Cu ²⁺with on the MM flat board of ABTS after be positioned in 28 DEG C of incubators and cultivate, the methyl alcohol adding 100 μ L100% every day induces it to produce expression of enzymes on the lid of culture dish, observes its colour-change every day.If seen at the distinctive blackish green haloing of single periphery of bacterial colonies appearance, prove express and have activity.As shown in figure 11, lac6+10AA has expression to dull and stereotyped detected result.

Whether shaking culture qualification recombinant bacterial strain expresses: 1. recombination yeast 28 DEG C of shaking tables in 3mL YPD+3 μ l Zeocin test tube are cultivated; 2. press 1% inoculum size by bacterium liquid in test tube, be inoculated in and be equipped with in the 250mL triangular flask of 50mLBMGY substratum, 28 DEG C of 250rpm shaking tables are cultured to OD ₆₀₀=30; 3. the centrifugal 5min of 1500-3000g room temperature collects thalline, abandons supernatant; 4. use the resuspended thalline of BMMY, be concentrated to the 2/5(20mL of original volume); 5. resuspended thalline is put into the triangular flask of 250mL, every bottle adds Cu ²⁺be 500 μMs of 250rpm to final concentration, 25 DEG C of cultivations; 6. within every 24 hours, adding the methyl alcohol of one time 100%, is 1% to final concentration; 7. every 24 hours sampling 0.2mL, 5000rpm centrifuging and taking supernatants.Sample 15 days altogether; 8. detect supernatant liquor enzyme according to ABTS method to live, make growth curve chart.

As shown in figure 12, use the result of shaking culture and the MM dull and stereotyped result that develops the color consistent, lac6+10AA has expression to result.

Four, different concns cupric ion is on the impact of restructuring laccase induction

Impact restructuring laccase expression level a lot of because have in pichia spp, because cupric ion is the structure element of laccase, the impact that research different concns cupric ion is induced restructuring laccase.Cultivate restructuring laccase lac6+10AA, when transferring in BMMY using do not add cupric ion as blank, establish 100 μMs, 200 μMs, 300 μMs, 400 μMs, 500 μMs, 600 μMs 6 concentration gradients respectively, each concentration 3 bottles of Duplicate Samples, starting cell concentration OD600 is 30,25 DEG C of 250rpm shaking tables are cultivated, and every 24h samples and adds methyl alcohol to final concentration is 1%, and centrifuging and taking supernatant is surveyed enzyme and lived.

Different Cu ionic concn produces the impact of enzyme as shown in figure 13 to lac6+10AA induction, adds different concns Cu ²⁺with do not add Cu ²⁺substratum compare, enzyme is lived and is all greatly increased, and different Cu ²⁺the impact that concentration produces enzyme to laccase is also different.The present embodiment lac6+10AA culture effect is it is preferred that add 600 μMs of Cu when abduction delivering ²⁺.

Five, the separation and purification of restructuring laccase

The process of crude enzyme liquid: cultivate the enzyme liquid after 7d through BMMY abduction delivering, 4 DEG C of centrifugal 10min of 5000rpm get clear enzyme solution, through suction filtration, ultrafiltration and concentration 20mM Tris-HCl(pH8.0) dialysis after prepared anion column, often walk all detects enzyme work and protein content.

The separation and purification process of DEAE-SepharoseTMCL-6B: the crude enzyme liquid after process carries out DEAE-SephroseTMCL-6B ion-exchange chromatography, adopts balance liquid A phase: 20mM Tris-HCl buffer(pH8.0); Elution buffer B phase: containing the 20mmol/L Tris-HCl damping fluid (pH8.0) of 1M NaCl.Loading flow velocity: 0.5mL/min, elution speed: 0.5mL/min.Type of elution: B phase 0-1.0M NaCl linear elution; Be in charge of collection elutriant, every 10min collects a pipe, detects laccase activity, obtains the collection liquid of laccase activity.

Sephadex G-75 sieve chromatography: the collection liquid of laccase activity that has collected after DEAE ion-exchange chromatography is loaded in dialysis tubing, 4 DEG C of gentle agitation dialysis 24h(dialyzates: 20mmol/L NaH ₂pO ₄-Na ₂hPO ₄buffer, pH7.0), change 3-4 damping fluid therebetween.Salt ionic concentration through the enzyme liquid of dialysis is adjusted.Enzyme liquid after process carries out Sephadex G-75 sieve chromatography, elution buffer (20mmol/L NaH ₂pO ₄-Na ₂hPO ₄buffer, pH7.0).Loading flow velocity: 0.5mL/min, elution speed: 0.5mL/min.Every 4min collects a pipe, detects laccase activity, obtains the collection liquid of laccase activity.Enzyme liquid again chromatography 4 DEG C of gentle agitation dialysis 24h(dialyzates: pH7.0, phosphate buffered saline buffer), put into-20 DEG C of preservations.

The mensuration of protein content: the protein content measuring enzyme liquid adopts BCA Protein Assay Kit.First react production standard curve with the bovine serum albumin of different concns and working fluid.Allow enzyme liquid and working fluid react according to the making method of typical curve, record absorbance, typical curve is found out the protein concn corresponding to this absorbance.

The making of BCA protein assay kit standard curve: the bovine serum albumin standardized solution preparing a series of concentration, 0 μ g/mL, 25 μ g/mL, 125 μ g/mL, 250 μ g/mL, 500 μ g/mL, 750 μ g/mL, 1000 μ g/mL, 1500 μ g/mL, 2000 μ g/mL, get 25 μ l and often plant standard protein, add the working fluid that in test kit, A reagent and B reagent are made into, after mixing rear 37 DEG C of insulation 30min, be cooled to the absorbance that room temperature surveys 562nm.With the absorbance recorded for ordinate zou, protein concentration is X-coordinate production standard curve: y=0.0012x.

The detection of six, separation and purification effect

SDS-PAGE electrophoresis detection purification effect, step is as follows:

1) preparation (amounts of two pieces of glue) of separation gel: 4.0mL Acer-Bis(30:0.8), 2.4mL5 × Separatingbuffer, 5.4mL Distilled water, 4 μ L TEMED, 120 μ L AP.After separation gel solution is mixed successively (finally adding AP), rapidly glue is injected gel mold, after reaching desired height, glue face is injected the distilled water of one deck 1-5mm gently, then leave standstill 20-60 minute and wait for gel polymerisation.

2) preparation (amounts of two pieces of glue) of concentrated glue: 1.25mL Acer-Bis(30:0.8), 2.0mL5 × Stacking buffer, 6.6mL Distilled water, 4 μ L TEMED, 120 μ L AP.After glue polymerization to be separated, first remove the water layer on separation gel, then will concentrate on sol solution immediate stability ground injection separation gel until top.Careful tilts to insert comb on top, and in time arriving sheet glass top at the bottom of its tooth, flatten comb, attention should avoid increment to leave bubble, leaves standstill 30 minutes and waits for gel polymerisation, then carefully take out comb, do not tear well.

3) process of sample: the ratio of sample and sample buffer is 4:1,40 μ l samples are got in this experiment and 10 μ l5 sample buffer (containing SDS) doubly mixes.100 DEG C are boiled 10min.Of short durationly centrifugal water of condensation on tube wall is deposited at the bottom of pipe.

4) application of sample: gel is put into electrophoresis chamber, adds electrophoretic buffer, makes gel two ends be immersed in damping fluid, connects electrode, loading.Draw 40 μ l enzyme liquid with microsyringe, carefully stretch into bottom well, stable by sample addition one arrowband.Sample buffer should be added, to prevent fringing effect in emptying aperture.

5) electrophoresis: after application of sample, adds voltage at electrophoresis chamber the two poles of the earth, and before sample enters separation gel, voltage is 100V, after entering separation gel, voltage is increased to 200V, when going to bottom separation gel to blue forward position, stops electrophoresis.

6) dyeing and decolouring: take out gel, preparation coomassie brilliant blue staining about 4 hours, then decolour once for every 5 hours with destainer.Glue there will be obviously and clearly blue bands, photographic recording.

Enzyme liquid SDS-PAGE after separation and purification detects, and the results are shown in Figure 14, the Lac6+10AA molecular weight after purifying is 75kDa, and after the process of pure enzyme deglycosylating enzyme, molecular weight is 55kDa.

Seven, the mensuration of laccase activity

1) ABTS method: in 1mL reaction mixture, containing 100 μ L1mmol/L(final concentrations) ABTS, 800 μ L0.1mol/L NaAc-HAc damping fluid (pH4.5), 100 μ L enzyme liquid are 1 Ge Meihuo unit (IU) at 40 DEG C with the enzyme amount of the 1 μm of olABTS of catalyzed oxidation in 1min.The OD changing value in 1min is measured at 420nm place.The molar extinction coefficient of known 420nm place ABTS is ε 420=3.6 × 104M ^-1.cm ^-1.

Enzyme (IU/mL)=OD alive ₄₂₀/ (3.6 × 104 × V/106) (V is that enzyme liquid amasss)

2) guaiacol method: by enzyme liquid at 4 DEG C, supernatant liquor 0.1mL is got after the centrifugal 20min of 10000r/min, add 0.3mL distilled water and 2mL50mmol/mL(containing 1mmol/L methyl catechol) succinate buffer (pH5.0), mix and be placed on 37 DEG C of water-bath 30min, ice bath termination reaction, surveys its light absorption value at 465nm place.Enzyme unit definition of living be the enzyme amount that per minute is oxidized 1 μm of ol methyl catechol is a Ge Meihuo unit.

Enzyme (IU/mL)=2.4 × OD alive ₄₆₅/ (12100 × 30 × V/106) (V is that enzyme liquid amasss)

3) syringaldazine method: in 1mL reaction mixture, containing 100 μ L1mmol/L(final concentrations) syringaldazine, 800 μ L0.1mol/L NaAc-HAc damping fluid (pH4.5), 100 μ L enzyme liquid are 1 Ge Meihuo unit (IU) at 40 DEG C with the enzyme amount of the 1 μm of ol syringaldazine of catalyzed oxidation in 1min.The OD changing value in 1min is measured at 525nm place.The molar extinction coefficient of known 525nm place syringaldazine is ε 525=6.5 × 105M ^-1.cm ^-1.

Enzyme (IU/mL)=OD alive ₅₂₅/ (6.5 × 105 × V/106) (V is that enzyme liquid amasss)

4) 2,6-xylenol method: in 1mL reaction mixture, containing 100 μ L1mmol/L(final concentrations) 2,6-xylenol, 800 μ L0.1mol/L NaAc-HAc damping fluid (pH4.5), 100 μ L enzyme liquid are 1 Ge Meihuo unit (IU) at 40 DEG C with the enzyme amount of 1 μm of ol2, the 6-xylenol of catalyzed oxidation in 1min.The OD changing value in 1min is measured at 421nm place.The molar extinction coefficient of known 421nm place 2,6-xylenol is ε 421=5.78 × 104M ^-1.cm ^-1.

Enzyme (IU/mL)=OD alive ₄₂₁/ (5.78 × 104 × V/106) (V is that enzyme liquid amasss)

Eight, the analysis of restructuring Coprinus comatus laccase enzymatic property

1) optimum temperuture of restructuring Coprinus comatus laccase: be the reaction vigor of restructuring Coprinus comatus laccase under different amboceptor and differing temps after investigating purifying, obtain optimal reaction temperature, devise different temperature of reaction, it is 20 DEG C-90 DEG C, gradient is 5 DEG C, amboceptor is respectively ABTS, methyl catechol, syringaldazine and 2,6-syringol.Laccase activity is detected according to the method described above under differing temps.Live soprano for 100% with enzyme.As shown in figure 15, Lac6+10AA corresponding A BTS, methyl catechol, syringaldazine, the optimum temperuture of each substrate of 2,6-syringol is 65 DEG C to result respectively, 50 DEG C, 60 DEG C, 60 DEG C.

Laccase Lac6+10AA after purifying, after 30 DEG C-70 DEG C scope inside holding 15min, 30min, 45min, 60min, take ABTS as the laccase activity under substrate detects differing temps insulation different time.Preserve uninsulated enzyme with 4 DEG C to live as 100%, the results are shown in Figure 16, laccase Lac6+10AA after purifying lives to enzyme after 30 DEG C of insulations promoter action, 40 DEG C, 50 DEG C insulations one hour, residual enzyme work is more than 80%, in 50 DEG C of insulations residual enzyme work in one hour more than 60%, and be left 3.3% at 60 DEG C; Lac6+10AA is incubated the basic inactivation of 15min at 70 DEG C.Result shows, and laccase Lac6+10AA has good thermostability between 30 DEG C-50 DEG C.

2) optimal pH of restructuring Coprinus comatus laccase: be the reaction vigor of restructuring Coprinus comatus laccase under different amboceptor and different pH after investigating purifying, obtain optimum response pH, configuration pH is the extensive damping fluid of 1.0-12.0, gradient is 0.5, amboceptor is respectively ABTS, methyl catechol, syringaldazine and 2,6-syringol.Laccase activity is measured according to the method described above under different pH damping fluid.Live soprano for 100% with enzyme.The results are shown in Figure 17, Lac6+10AA corresponding A BTS, methyl catechol, syringaldazine, the optimal pH of each substrate of 2,6-syringol is 3,5,5.5,5 respectively.

Laccase Lac6+10AA after purifying 4 DEG C of placements under the condition of pH1-12 are surveyed enzyme and are lived after 24 hours, live as 100% with the highest enzyme.The results are shown in Figure 18, display Lac6+10AA has good stability between pH3-10, and residual enzyme work reaches more than 80%.

With reference to aforesaid method, the laccase gene of clone is directly connected with pPICZ α B carrier by the present embodiment, but lac6 does not express.

Embodiment 3 is recombinated the decolouring of Coprinus comatus laccase to dyestuff

The preparation of enzyme liquid: triangular flask cultivates the restructuring laccase Lac6+10AA of clone, at 25 DEG C, 500MCu ²⁺every 24h adds 1% methanol induction to express, and cultivate and collect enzyme liquid afterwards in 10 days, after suction filtration, ultrafiltration and concentration ,-80 DEG C save backup.

(1) to recombinate under different time the decolouring of Coprinus comatus laccase to dyestuff

In 2mL decolouring system, dye concentrations 50mg/L, 0.1mol/L NaAc-HAc damping fluid, to enzyme amount 0.5IU/mL, the final concentration 0 of HBT or 0.1g/L, pH4.5, temperature 40 DEG C, respectively the time be 1,2,3,4,12h time, measure the light absorption value (A of each reaction solution in corresponding dyestuff maximum absorption wave strong point ₁), in contrast with inactivator liquid, same method records its light absorption value A simultaneously ₀, percent of decolourization is R=(A ₀-A ₁)/A ₀× 100%.

As shown in Figures 19 and 20, restructuring Coprinus comatus laccase Lac6+10AA increases the increase of the percent of decolourization of dyestuff along with the reaction times, and the increase of percent of decolourization, mainly in 1-3h, increases subsequently and gradually delays, and reaches maximum to dye decolored rate most during 12h.Restructuring laccase is to orange G, Crystal Violet, and the percent of decolourization of Malachite green is respectively 44.6%, and 54.8%, 87.2%.

(2) pure enzyme and thick enzyme are to the contrast of the dye decolored effect of three classes

In 2mL decolouring system, dye concentrations 50mg/L, 0.1mol/L NaAc-HAc damping fluid, to enzyme amount (0.5IU/mL), have medium (0.1g/L) with without in the reaction conditions of medium, pH4.5, temperature 40 DEG C, the time is 12h, measures the light absorption value (A of each reaction solution in corresponding dyestuff maximum absorption wave strong point ₁), in contrast with inactivator liquid, same method records its light absorption value A simultaneously ₀, percent of decolourization is R=(A ₀-A ₁)/A ₀× 100%.

As shown in figures 21-23, when without amboceptor, the thick enzyme of Lac6+10AA, to triphenylmethane dye decolorization best results, is secondly anthraquinone dyes, dye decolored relatively poor to azo.The thick enzyme of Lac6+10AA is after adding HBT, and the percent of decolourization of all dyestuffs all increases, and increases maximum to be reaction brilliant red X-3B in azo dyes, to add 30%.Thunder agate azoles light blue, Reactive Brilliant Blue X-BR, reactive brilliant bule K-GR and reactive brilliant bule K-3R(anthraquinone dyes) percent of decolourization be increased to 46.25%, 20.34%, 36.46%, 48.73% by 32%, 9.39%, 26.76%, 43.75% respectively.Reactive orange, reaction brilliant red X-3B, percent of decolourization that is Congo red and reactive deep blue K-R (azo dyes) are increased to 6.51%, 34.78%, 29.52%, 77.85% by 4.4%, 4.55%, 19.14%, 72.32% respectively.The percent of decolourization of malachite green, Coomassie brilliant G-250, methyl violet, tetrabromophenol sulfonphthalein and victoria blue B (triphenylmethane dye) is added to 83.6%, 20.64%, 42.24%, 31.28%, 31.41% by 70.3%, 16.04%, 16.49%, 22.67%, 19.03% respectively.

The pure enzyme of Lac6+10AA is best to triphenylmethane dye decolorization, is secondly anthraquinone dyes, poor to the dye decolored effect of azo.After adding amboceptor HBT, decolorizing effect obviously increases.The pure enzyme of Lac6+10AA is after adding HBT, and the percent of decolourization of all dyestuffs all increases, and to increase maximum be azo class dyestuff, and be secondly triphenylmethane dye, anthraquinone dyes increase is less.Thunder agate azoles light blue, Reactive Brilliant Blue X-BR, reactive brilliant bule K-GR and reactive brilliant bule K-3R(anthraquinone dyes) percent of decolourization be increased to 95.34%, 75.5%, 80.24%, 89.04% by 80.98%, 41.71%, 67.93%, 83.65% respectively.Reactive orange, reaction brilliant red X-3B, percent of decolourization that is Congo red and reactive deep blue K-R (azo dyes) are increased to 58.4%, 87.16%, 65.15%, 91.7% by 8.6%, 7.15%, 32.25%, 85.49% respectively.The percent of decolourization of malachite green, Coomassie brilliant G-250, methyl violet, tetrabromophenol sulfonphthalein and victoria blue B (triphenylmethane dye) is added to 96.33%, 62.48%, 78.97%, 75.48%, 61.8% by 89.73%, 32.97%, 47.1%, 57.24%, 34.52% respectively.

In a word, the decolorizing effect of pure enzyme is better than thick enzyme, may be that crude enzyme liquid has background color, have impact to the mensuration of light absorption value, and may also have a certain impact to the decolorization of enzyme containing various impurity in crude enzyme liquid.Add medium HBT rear decoloring successful to strengthen, the pure enzyme of Lac6+10AA adds in the decolouring to 13 kinds of dyestuffs after HBT, and 3 reach more than 90%, and 6 reach more than 70%, except all the other percent of decolourizations of reactive orange 1 are all more than 60%.

SEQUENCE LISTING

<110> Nanjing Forestry University

<120> laccase gene Lac6 and expressing protein thereof and application

<130> 100

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 2046

<212> DNA

<213> Cabassous unicinctus

<400> 1

ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagtacgcg ggggctacta 60

atattgtctt acatacaaca caggagattc ttctgcatat acctcggggg gaaaatctac 120

attttttccc aggcttgaag agaacatcgc accgccacct cctttaaaac ttctccttaa 180

accgaaaata atgtctcaag cagatgcata tttaaacgct ggttccgaca ctcaacttta 240

gactcatctt ctcttatcat gacactcacg acctcccgct tgggaataac caactctctt 300

tttgtcgctc ttttgggtgt gaacacctac actcttgctt cagtcctcat accgcactcg 360

actctgactc tcacgaatca gttgattgct cccgatggct tccaacgctc tgccattgtg 420

gtcaacggcg aacatccagg accactgatt caggcgacta agggtgacgg atttatggta 480

aatgtggtta atcaactcac agaccctacc atgcagaggg cagcgtctgt acattggcat 540

ggtctctcac aacgaggaac caactgggct gatggcgcga ctggtgtcaa tcaatgtcca 600

atctctccca accattcctt tgaatacaca tttacaggtg gcgacagcca agcagggact 660

ttttggtatc attctcatta ctttctacaa tattgtgatg gattgcgagg acctctcgtc 720

atctatgatc ctgaggatcc atggaaaaat ctttacgatg ttgatgatga gtcaacagtt 780

ctcacactcg ccgattggta ccatacgccc ttcccttcta ttcctggctt ccccctcccc 840

gaatccactc tcatcaacgg caaaggacgc tatcctgatg gaccgaatgt tgacctttcc 900

atcgtgaacg tagaaaaggg aaaacggtac cgcttccgcc ttgtttcact tgcttgcgag 960

actagttact tgtttggaat tgatggtcat caacttcaag tgatcgagac tgacggacag 1020

aacacagtac ctgtagtagt ggataagctt aggatcttcg caggccaacg ttactccttt 1080

gtattggatg ccaaccagaa tatcgacaac tattgggttc gaagtcttcc tgcaaacggg 1140

atgccgaagt tggtggctgg ttatgagggc ggtatcaact ctgcaatcct tcgttacaga 1200

ggcgctccaa tttcagatcc tcaaaccaac gacaaccaaa acctgatctt actcgaggaa 1260

gccaaacttg ttcctgcaca ggacccattc cctcctggaa acccgactgc tggtggagcc 1320

gatttcaatg tcacactgaa ttttgtgctc gatgtcgact tagcttctgg tgaacctcaa 1380

ttcaagctaa acgataaagt ctatcgccct ccgtcagttc cgatccttct caagattctc 1440

agcggtgctc gcagacccga agaactatta cctgaaggca acttgttctc tgtccctcgt 1500

gacaaggtaa tcgaagtgac tgttccgggt ggtatcgctg ctggacctca cccaatgcat 1560

ctccatggtc atacattcag tgtagtcaag agtgcgggca agaacaacca acccaactac 1620

ctgacacctg ttcgccgcga cgtaaccgcc acctctcaag aagttgacga ttacattacc 1680

atccgattca ccactgataa ccctggaccc tggcttcttc actgccatct taacaaacat 1740

cacgaatcgg gtatggttgt cgtgttcgtt gccgacgtcg actcagtcgc ggaggagaac 1800

ccagttcctg atgcctggaa cgacctttgt cctatctatg atgccctttc cgatgctgag 1860

aaggaagtca agattgtctc ttctttacca atgccagttt gatcgcctgc cccaagtccc 1920

agatcaaaga tacctgtaat gacttttatg acccctcata catatgatat cctttctctt 1980

ctattgtaca catacaccca ttcctatata tactatacaa aaatttgtta actttgaaaa 2040

aaaaaa 2046

<210> 2

<211> 547

<212> PRT

<213> Cabassous unicinctus

<400> 2

Met Thr Leu Thr Thr Ser Arg Leu Gly Ile Thr Asn Ser Leu Phe Val

1 5 10 15

Ala Leu Leu Gly Val Asn Thr Tyr Thr Leu Ala Ser Val Leu Ile Pro

20 25 30

His Ser Thr Leu Thr Leu Thr Asn Gln Leu Ile Ala Pro Asp Gly Phe

35 40 45

Gln Arg Ser Ala Ile Val Val Asn Gly Glu His Pro Gly Pro Leu Ile

50 55 60

Gln Ala Thr Lys Gly Asp Gly Phe Met Val Asn Val Val Asn Gln Leu

65 70 75 80

Thr Asp Pro Thr Met Gln Arg Ala Ala Ser Val His Trp His Gly Leu

85 90 95

Ser Gln Arg Gly Thr Asn Trp Ala Asp Gly Ala Thr Gly Val Asn Gln

100 105 110

Cys Pro Ile Ser Pro Asn His Ser Phe Glu Tyr Thr Phe Thr Gly Gly

115 120 125

Asp Ser Gln Ala Gly Thr Phe Trp Tyr His Ser His Tyr Phe Leu Gln

130 135 140

Tyr Cys Asp Gly Leu Arg Gly Pro Leu Val Ile Tyr Asp Pro Glu Asp

145 150 155 160

Pro Trp Lys Asn Leu Tyr Asp Val Asp Asp Glu Ser Thr Val Leu Thr

165 170 175

Leu Ala Asp Trp Tyr His Thr Pro Phe Pro Ser Ile Pro Gly Phe Pro

180 185 190

Leu Pro Glu Ser Thr Leu Ile Asn Gly Lys Gly Arg Tyr Pro Asp Gly

195 200 205

Pro Asn Val Asp Leu Ser Ile Val Asn Val Glu Lys Gly Lys Arg Tyr

210 215 220

Arg Phe Arg Leu Val Ser Leu Ala Cys Glu Thr Ser Tyr Leu Phe Gly

225 230 235 240

Ile Asp Gly His Gln Leu Gln Val Ile Glu Thr Asp Gly Gln Asn Thr

245 250 255

Val Pro Val Val Val Asp Lys Leu Arg Ile Phe Ala Gly Gln Arg Tyr

260 265 270

Ser Phe Val Leu Asp Ala Asn Gln Asn Ile Asp Asn Tyr Trp Val Arg

275 280 285

Ser Leu Pro Ala Asn Gly Met Pro Lys Leu Val Ala Gly Tyr Glu Gly

290 295 300

Gly Ile Asn Ser Ala Ile Leu Arg Tyr Arg Gly Ala Pro Ile Ser Asp

305 310 315 320

Pro Gln Thr Asn Asp Asn Gln Asn Leu Ile Leu Leu Glu Glu Ala Lys

325 330 335

Leu Val Pro Ala Gln Asp Pro Phe Pro Pro Gly Asn Pro Thr Ala Gly

340 345 350

Gly Ala Asp Phe Asn Val Thr Leu Asn Phe Val Leu Asp Val Asp Leu

355 360 365

Ala Ser Gly Glu Pro Gln Phe Lys Leu Asn Asp Lys Val Tyr Arg Pro

370 375 380

Pro Ser Val Pro Ile Leu Leu Lys Ile Leu Ser Gly Ala Arg Arg Pro

385 390 395 400

Glu Glu Leu Leu Pro Glu Gly Asn Leu Phe Ser Val Pro Arg Asp Lys

405 410 415

Val Ile Glu Val Thr Val Pro Gly Gly Ile Ala Ala Gly Pro His Pro

420 425 430

Met His Leu His Gly His Thr Phe Ser Val Val Lys Ser Ala Gly Lys

435 440 445

Asn Asn Gln Pro Asn Tyr Leu Thr Pro Val Arg Arg Asp Val Thr Ala

450 455 460

Thr Ser Gln Glu Val Asp Asp Tyr Ile Thr Ile Arg Phe Thr Thr Asp

465 470 475 480

Asn Pro Gly Pro Trp Leu Leu His Cys His Leu Asn Lys His His Glu

485 490 495

Ser Gly Met Val Val Val Phe Val Ala Asp Val Asp Ser Val Ala Glu

500 505 510

Glu Asn Pro Val Pro Asp Ala Trp Asn Asp Leu Cys Pro Ile Tyr Asp

515 520 525

Ala Leu Ser Asp Ala Glu Lys Glu Val Lys Ile Val Ser Ser Leu Pro

530 535 540

Met Pro Val

545

<210> 3

<211> 555

<212> PRT

<213> Artificial

<220>

The aminoacid sequence of <223> Lac6+10AA

<400> 3

Thr Pro Phe Pro Pro Phe Asn Thr Asn Ser Ser Arg Ser Val Leu Ile

1 5 10 15

Pro His Ser Thr Leu Thr Leu Thr Asn Gln Leu Ile Ala Pro Asp Gly

20 25 30

Phe Gln Arg Ser Ala Ile Val Val Asn Gly Glu His Pro Gly Pro Leu

35 40 45

Ile Gln Ala Thr Lys Gly Asp Gly Phe Met Val Asn Val Val Asn Gln

50 55 60

Leu Thr Asp Pro Thr Met Gln Arg Ala Ala Ser Val His Trp His Gly

65 70 75 80

Leu Ser Gln Arg Gly Thr Asn Trp Ala Asp Gly Ala Thr Gly Val Asn

85 90 95

Gln Cys Pro Ile Ser Pro Asn His Ser Phe Glu Tyr Thr Phe Thr Gly

100 105 110

Gly Asp Ser Gln Ala Gly Thr Phe Trp Tyr His Ser His Tyr Phe Leu

115 120 125

Gln Tyr Cys Asp Gly Leu Arg Gly Pro Leu Val Ile Tyr Asp Pro Glu

130 135 140

Asp Pro Trp Lys Asn Leu Tyr Asp Val Asp Asp Glu Ser Thr Val Leu

145 150 155 160

Thr Leu Ala Asp Trp Tyr His Thr Pro Phe Pro Ser Ile Pro Gly Phe

165 170 175

Pro Leu Pro Glu Ser Thr Leu Ile Asn Gly Lys Gly Arg Tyr Pro Asp

180 185 190

Gly Pro Asn Val Asp Leu Ser Ile Val Asn Val Glu Lys Gly Lys Arg

195 200 205

Tyr Arg Phe Arg Leu Val Ser Leu Ala Cys Glu Thr Ser Tyr Leu Phe

210 215 220

Gly Ile Asp Gly His Gln Leu Gln Val Ile Glu Thr Asp Gly Gln Asn

225 230 235 240

Thr Val Pro Val Val Val Asp Lys Leu Arg Ile Phe Ala Gly Gln Arg

245 250 255

Tyr Ser Phe Val Leu Asp Ala Asn Gln Asn Ile Asp Asn Tyr Trp Val

260 265 270

Arg Ser Leu Pro Ala Asn Gly Met Pro Lys Leu Val Ala Gly Tyr Glu

275 280 285

Gly Gly Ile Asn Ser Ala Ile Leu Arg Tyr Arg Gly Ala Pro Ile Ser

290 295 300

Asp Pro Gln Thr Asn Asp Asn Gln Asn Leu Ile Leu Leu Glu Glu Ala

305 310 315 320

Lys Leu Val Pro Ala Gln Asp Pro Phe Pro Pro Gly Asn Pro Thr Ala

325 330 335

Gly Gly Ala Asp Phe Asn Val Thr Leu Asn Phe Val Leu Asp Val Asp

340 345 350

Leu Ala Ser Gly Glu Pro Gln Phe Lys Leu Asn Asp Lys Val Tyr Arg

355 360 365

Pro Pro Ser Val Pro Ile Leu Leu Lys Ile Leu Ser Gly Ala Arg Arg

370 375 380

Pro Glu Glu Leu Leu Pro Glu Gly Asn Leu Phe Ser Val Pro Arg Asp

385 390 395 400

Lys Val Ile Glu Val Thr Val Pro Gly Gly Ile Ala Ala Gly Pro His

405 410 415

Pro Met His Leu His Gly His Thr Phe Ser Val Val Lys Ser Ala Gly

420 425 430

Lys Asn Asn Gln Pro Asn Tyr Leu Thr Pro Val Arg Arg Asp Val Thr

435 440 445

Ala Thr Ser Gln Glu Val Asp Asp Tyr Ile Thr Ile Arg Phe Thr Thr

450 455 460

Asp Asn Pro Gly Pro Trp Leu Leu His Cys His Leu Asn Lys His His

465 470 475 480

Glu Ser Gly Met Val Val Val Phe Val Ala Asp Val Asp Ser Val Ala

485 490 495

Glu Glu Asn Pro Val Pro Asp Ala Trp Asn Asp Leu Cys Pro Ile Tyr

500 505 510

Asp Ala Leu Ser Asp Ala Glu Lys Glu Val Lys Ile Val Ser Ser Leu

515 520 525

Pro Met Pro Val Pro Arg Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu

530 535 540

Asn Ser Ala Val Asp His His His His His His

545 550 555

<210> 4

<211> 20

<212> DNA

<213> Artificial

<220>

<223> position forward primer

<220>

<221> misc_feature

<222> (12)..(12)

<223> n is a, c, g, or t

<400> 4

caytggcayg gnttyttyca 20

<210> 5

<211> 22

<212> DNA

<213> Artificial

<220>

<223> No. bis-position reverse primers

<220>

<221> misc_feature

<222> (17)..(17)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (20)..(20)

<223> n is a, c, g, or t

<400> 5

grctgtggta ccagaangtn cc 22

<210> 6

<211> 20

<212> DNA

<213> Artificial

<220>

<223> No. tetra-position reverse primers

<400> 6

tgccartcda trtgrcartg 20

<210> 7

<211> 27

<212> DNA

<213> Artificial

<220>

<223> Laccase6 GSP1

<400> 7

ggacattgat tgacaccagt cgcgcca 27

<210> 8

<211> 559

<212> DNA

<213> Artificial

<220>

<223> 5'-RACE sequence fragment sequence

<400> 8

ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagtacgcg ggggctacta 60

atattgtctt acatacaaca caggagattc ttctgcatat acctcggggg gaaaatctac 120

attttttccc aggcttgaag agaacatcgc accgccacct cctttaaaac ttctccttaa 180

accgaaaata atgtctcaag cagatgcata tttaaacgct ggttccgaca ctcaacttta 240

gactcatctt ctcttatcat gacactcacg acctcccgct tgggaataac caactctctt 300

tttgtcgctc ttttgggtgt gaacacctac actcttgctt cagtcctcat accgcactcg 360

actctgactc tcacgaatca gttgattgct cccgatggct tccaacgctc tgccattgtg 420

gtcaacggcg aacatccagg accactgatt caggcgacta agggtgacgg atttatggta 480

aatgtggtta atcaactcac agaccctacc atgcagaggg cagcgtctgt acattggcat 540

ggtttttttc aacgaggaa 559

<210> 9

<211> 30

<212> DNA

<213> Artificial

<220>

<223> Laccase6 GSP2

<400> 9

ctcacgacct cccgcttggg aataaccaac 30

<210> 10

<211> 30

<212> DNA

<213> Artificial

<220>

<223> introduces nucleotide sequence corresponding to 10 aminoacid sequences

<400> 10

acgccattcc cccctttcaa caccaactct 30

<210> 11

<211> 10

<212> PRT

<213> Artificial

<220>

<223> introduces 10 aminoacid sequences

<400> 11

Thr Pro Phe Pro Pro Phe Asn Thr Asn Ser

1 5 10

<210> 12

<211> 61

<212> DNA

<213> Artificial

<220>

<223> Lac6gcDNAF

<400> 12

gctctagatg acgccattcc cccctttcaa caccaactct tcagtcctca taccgcactc 60

g 61

<210> 13

<211> 35

<212> DNA

<213> Artificial

<220>

<223> Lac6gcDNAR

<400> 13

gtccccgcgg aactggcatt ggtaaagaag agaca 35

<210> 14

<211> 21

<212> DNA

<213> Artificial

<220>

<223> 5'AOX sequence

<400> 14

gactggttcc aattgacaag c 21

<210> 15

<211> 20

<212> DNA

<213> Artificial

<220>

<223> 3'AOX sequence

<400> 15

ggcaaatggc attctgacat 20

Claims

1. a laccase gene Lac6, its DNA sequence dna is sequence as shown in the 259-1902 position Nucleotide of SEQ ID NO.1.

2. the expressing protein of laccase gene described in claim 1, its aminoacid sequence is as shown in SEQ ID NO.2.

3. an expression method for the expressing protein of laccase gene described in claim 2, is characterized in that: the expression label being added with 10 aminoacid sequence compositions on aminoacid sequence shown in described SEQ IDNO.2, and described aminoacid sequence is TPFPPFNTNS; Expressed protein sequence is as shown in SEQ ID NO.3.

4. laccase gene Lac6 according to claim 1 is to the application in dye decolored.