CN102321595B - Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit - Google Patents
Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit Download PDFInfo
- Publication number
- CN102321595B CN102321595B CN2011102530390A CN201110253039A CN102321595B CN 102321595 B CN102321595 B CN 102321595B CN 2011102530390 A CN2011102530390 A CN 2011102530390A CN 201110253039 A CN201110253039 A CN 201110253039A CN 102321595 B CN102321595 B CN 102321595B
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- sterol esterase
- host cell
- recombinant
- esterase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cholesterol esterase. An amino acid sequence of the cholesterol esterase is an amino acid sequence shown in the formula of SEQ ID NO: 1, or is an amino acid sequence which is obtained by processes of deletion, addition and/or replacement of one or more amino acids on the amino acid sequence shown in the formula of SEQ ID NO: 1 and maintains original cholesterol esterase functions. The invention also discloses a nucleotide sequence for coding the cholesterol esterase, a recombinant vector of the nucleotide sequence, a recombinant host cell of the recombinant vector, a method for purifying the cholesterol esterase from the recombinant host cell, and a kit containing at least one of the cholesterol esterase, the nucleotide sequence, the recombinant vector and the recombinant host cell. The cholesterol esterase has good heat resistance and high stability. The kit can carry out rapid, effective and accurate detection on genes to guarantee prompt case diagnosis and treatment, accurate aetiology investigation, and establishment of scientific prevention and control policies.
Description
Technical field
The present invention relates to a kind of enzyme, the encode nucleotide sequence of this enzyme, the recombinant vectors that comprises described nucleotide sequence, the recombinant host cell that comprises described recombinant vectors, the method of this enzyme of purifying from aforementioned recombinant host cell, and comprise at least a test kit in above-mentioned enzyme, nucleotide sequence, recombinant vectors and the recombinant host cell.More specifically, the present invention relates to a kind of Sterol esterase, the encode nucleotide sequence of this Sterol esterase, the recombinant vectors that comprises described nucleotide sequence, the recombinant host cell that comprises described recombinant vectors, the method of this enzyme of purifying from aforementioned recombinant host cell, and comprise at least a test kit in above-mentioned Sterol esterase, nucleotide sequence, recombinant vectors and the recombinant host cell.
Background technology
Sterol esterase is a kind of enzyme that the catalysis cholesteryl ester is hydrolyzed into cholesterol and lipid acid.It is one of important enzyme of clinical detection serum total cholesterol.It can detect the concentration of total cholesterol in the serum fast and accurately, diagnoses such as arteriosclerotic lipid disorders disease to be used as, and, can be used for studying other many clinical relative diseases such as diabetes, ephrosis etc.The cholesterol of esterification after enzymic hydrolysis, through the rCO oxidation, the H that produces
2O
2Generate quinonimine with 4-AA and phenol reactant.Quinonimine has special absorption at 505nm, and the colour intensity that reaction produces is directly proportional with cholesterol level, therefore can use the amount of colorimetric method for determining cholesterol.
Sterol esterase not only extensively is present in the tissues such as mammiferous pancreas, liver, suprarenal gland, and can from the tunning of microorganism, extract acquisition, can produce the microorganism of Sterol esterase, for example, pseudomonas (Pseudomonas sp.), Alcaligenes (Alcaligenes sp.), Fusariumsp (Fusarium sp.), streptomycete (Streptomyces sp.) etc.
But the used Sterol esterase of present test kit exists the shortcoming of poor heat resistance, transportation, preservation and the use procedure of test kit are had relatively high expectations to envrionment temperature, easily have influence on validity and the accuracy of kit measurement owing to the sex change of Sterol esterase.In addition, the used Sterol esterase of present test kit generally carries out the nature strain fermentation with the pseudomonas that produces Sterol esterase, and output is lower, and natural cholesterol esterase poor heat resistance, and enzyme is lived loss seriously in the separation and purification process.
Summary of the invention
An object of the present invention is to overcome the shortcoming of existing Sterol esterase poor heat resistance, a kind of good heat resistance is provided, can in wide temperature range, keeps higher stability and active Sterol esterase.
Second purpose of the present invention provides the nucleotide sequence of the described Sterol esterase of coding.
The 3rd purpose of the present invention provides the recombinant vectors that comprises described nucleotide sequence.
The 4th purpose of the present invention provides the recombinant host cell that comprises described recombinant vectors.
The 5th purpose of the present invention provides at least a test kit that comprises in above-mentioned Sterol esterase, nucleotide sequence, recombinant vectors and the recombinant host cell.
The present inventor has paid in large quantities creative work, utilize the method for random mutation, obtain the Sterol esterase that the present invention has the aminoacid sequence shown in the SEQ ID NO:1 from existing streptomyces venezuelae (Streptomyces venezuelae ATCC 10712) cholesteryl ester enzyme sequence.And the present inventor is surprised to find that, the gained Sterol esterase has good thermotolerance, can keep higher stability in wide temperature range.
The invention provides a kind of Sterol esterase, wherein, the aminoacid sequence of described Sterol esterase is
(1) aminoacid sequence shown in the SEQ ID NO:1, perhaps
(2) (1) described aminoacid sequence is carried out one or several amino acid whose disappearance, interpolation and/or replacement, but the constant aminoacid sequence of the function of its Sterol esterase.
The present invention also provides the nucleotide sequence of the Sterol esterase of the present invention of encoding.
The present invention also provides the recombinant vectors that comprises nucleotide sequence of the present invention.
The present invention also provides the recombinant host cell that comprises recombinant vectors of the present invention.
The present invention also provides at least a test kit that comprises in Sterol esterase of the present invention, nucleotide sequence, recombinant vectors and the recombinant host cell.
Sterol esterase provided by the invention has advantages of good heat resistance.Referring to Fig. 3 as can be known, Sterol esterase of the present invention still has 60% relative reactivity after leaving standstill 15 minutes under 65 ℃ in the damping fluid of pH6.0, apparently higher than the relative reactivity (less than 20%) of the Sterol esterase of under the same conditions Comparative Examples 1.
Description of drawings
The isogenic sepharose of the COE of Fig. 1 embodiment 1 is identified photo;
The COE abduction delivering of Fig. 2 embodiment 1 and the SDS-PAGE of purifying identify photo;
The cholesteryl ester enzyme heat stability comparison diagram of Fig. 3 Preparation Example 1 and Comparative Examples 1-2;
The Sterol esterase pH beta stability line figure of Fig. 4 Preparation Example 1 and Comparative Examples 1-2.
Embodiment
The invention provides a kind of Sterol esterase, wherein, the aminoacid sequence of described Sterol esterase is
(1) aminoacid sequence shown in the SEQ ID NO:1, perhaps
(2) (1) described aminoacid sequence is carried out one or several amino acid whose disappearance, interpolation and/or replacement, but the constant aminoacid sequence of the function of its Sterol esterase.
Those skilled in the art are known, and 20 seed amino acid residues of constitutive protein matter can be divided into four classes according to side chain polarity:
1, nonpolar amino acid: L-Ala (Ala), α-amino-isovaleric acid (Val), leucine (Leu), Isoleucine (Ile), methionine(Met) (Met), phenylalanine (Phe), tryptophane (Trp) and proline(Pro) (Pro);
2, the uncharged amino acid of polarity: glycine (Gly), Serine (Ser), Threonine (Thr), halfcystine (Cys), l-asparagine (Asn), glutamine (Gln) and tyrosine (Tyr);
3, positively charged amino acid: arginine (Arg), Methionin (Lys) and Histidine (His);
4, electronegative amino acid: aspartic acid (Asp) and L-glutamic acid (Glu) (referring to " biological chemistry " (second edition) first volume, Shen is same, Wang Jingyan, 82-83 page or leaf, Higher Education Publishing House, December nineteen ninety).If belonging to the amino-acid residue of a classification in the protein together replaces, for example replace Lys or replace Ile by Leu by Arg, described residue role (such as positive charge being provided or forming the effect of hydrophobic pouch structure) in protein domain does not change, therefore can't exert an influence to the three-dimensional arrangement of protein, therefore still can realize the function of albumen.For example, as well known to those skilled in the art, Ala and Ser, Val and Ile, Asp and Glu, Ser and Thr, Ala and Gly, Ala and Thr, Ser and Asn, Ala and Val, Ser and Gly, Tyr and Phe, Ala and Pro, Lys and Arg, Asp and Asn, Leu and Ile, Leu and Val, Ala and Glu and Asp and Gly, mutually replace between any two, can not affect three-dimensional arrangement and the function of albumen.The described amino-acid residue that belongs to a classification together replaces on any one amino acid residue position that can occur on the Sterol esterase.On the contrary, different classes of amino-acid residue replaces, and perhaps amino acid whose replacement does not meet the above-mentioned replacement rule of enumerating, and the structure of albumen is changed, and difference appears in function.
Sterol esterase provided by the invention can also be modified or suddenly change, the protein that obtains deriving." derivative protein " of the present invention refers to have difference on the aminoacid sequence with the Sterol esterase with above-mentioned aminoacid sequence, and the difference on the modified forms that does not affect sequence is perhaps arranged, and perhaps haves both at the same time.These albumen comprise genetic variant natural or that induce.Described induce variation body can obtain by various technology, such as the random mutation that radiation or mutagenic compound etc. produce, and also can be by obtaining such as fixed-point mutation method or the biological technology of other known moleculars.Described " derivative protein " also comprises the analogue (such as D type amino acid) with the amino acid whose residue of natural L-type, and the analogue with that non-natural exists or synthetic amino acid (such as beta-amino acids, gamma-amino acid etc.).
(usually the not changing primary structure) form of modification comprises: the chemically derived form of the albumen that body is interior or external, and such as acetylize or carboxylated.Modification also comprises glycosylation, carries out glycosylation modified and albumen that produce in the procedure of processing such as those in the synthetic and processing of albumen or further.This modification can be carried out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and finishes by albumen is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (such as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the albumen that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
Under the preferable case, the aminoacid sequence of described Sterol esterase is the aminoacid sequence shown in the SEQ ID NO:1.
The present invention also provides the nucleotide sequence of the Sterol esterase of the present invention of encoding.
Known in this field, in 20 kinds of different amino acid of constitutive protein matter, except Met (ATG) or Trp (TGG) were respectively single password coding, other 18 seed amino acids were respectively by 2-6 codon encode (Sambrook etc., molecular cloning, press of cold spring harbor laboratory, New York, the U.S., second edition, 1989, see 950 pages of appendix D).Namely because the degeneracy of genetic codon, determine more than one mostly of an amino acid whose codon, the displacement of the 3rd Nucleotide often can not change amino acid whose composition in the triplet codon, and the nucleotide sequence of the gene of the same protein of therefore encoding can be different.Those skilled in the art are according to known password sublist, from aminoacid sequence disclosed by the invention, and the constant aminoacid sequence of cholesteryl ester enzymic activity that is obtained by described aminoacid sequence, can derive their nucleotide sequence of gene of to encode fully, nucleotide sequence as described in obtaining by biological method (such as PCR method, mutation method) or chemical synthesis process, so this partial nucleotide sequence all should be included in the scope of the present invention.On the contrary, utilize dna sequence dna disclosed herein, also can be by means commonly known in the art, such as method (molecular cloning, the press of cold spring harbor laboratory of Sambrook etc., New York, the U.S., second edition, 1989) carry out, by revising nucleotide sequence provided by the invention, obtain the aminoacid sequence consistent with pyruvic acid enzymic activity of the present invention.
Under the preferable case, nucleotides sequence of the present invention is classified as
(1) nucleotide sequence shown in the SEQ ID NO:2; Perhaps
(2) nucleotide sequence shown in the SEQ ID NO:2 is carried out the nucleotide sequence that one or several Nucleotide replaces, lacks or increase and obtains, this nucleotide sequence coded Sterol esterase function is constant.Described nucleotide sequence is the nucleotide sequence shown in the SEQ ID NO:2 more preferably.
Nucleotide sequence provided by the invention can obtain with the method for pcr amplification method, recombination method or synthetic usually.For example, those skilled in the art can be easy to obtain template and primer according to nucleotide sequence provided by the present invention and recombinant bacterial strain, utilize PCR to increase and obtain relevant sequence.When sequence is longer, can carry out twice or pcr amplification repeatedly, then the gained fragment be pressed the proper order splicing.In case obtained relevant nucleotide sequence, just can use the relevant aminoacid sequence of the large batch of acquisition of recombination method.Usually the gained nucleotide sequence is cloned into carrier, again in the transgene engineering bacteria, then the host cell of the method by routine after the propagation separates and obtains relevant nucleotide sequence.In addition, also can synthesize relevant nucleotide sequence with the synthetic method of known artificial chemistry.
The present invention also provides the recombinant vectors that comprises nucleotide sequence of the present invention.Known in this field, described recombinant vectors generally comprises empty carrier and inserts the goal gene of this empty carrier, and described goal gene is the nucleotide sequence of Sterol esterase of the present invention.
In the present invention, various carrier known in the art can be selected in described " empty carrier " (or title " carrier "), such as commercially available various plasmids, clay, phage and retrovirus etc., the carrier that the preferred described empty carrier of the present invention is the lac promotor is in the group that more preferably free pUC19, pGEM and pBluescript form.Described empty carrier can comprise multiple certification mark commonly used (reporter genes such as fluorescent mark, antibiotic marker) and restriction enzyme site.Construction of recombinant vector can adopt the various endonucleases of the multiple clone site of empty carrier own (as for pUC19, available Ava I, Sac I, EcoR I, Hind III and BamH I etc.) carry out enzyme and cut the acquisition linear plasmid, be connected with the gene fragment that adopts the cutting of identical nucleic acid restriction endonuclease, obtain recombinant plasmid.The present invention preferably with the pseudomonas replicon gene clone among the plasmid pCN51 to pUC19, again Sterol esterase gene (COE) also is cloned into replicon before, be built into the carrier that can in pseudomonas, copy and express.
The present invention also provides the recombinant host cell that comprises recombinant vectors of the present invention.
Can described recombinant vectors be transformed, transduce or be transfected in the host cell by the method for this area routine, such as Calcium Chloride Method chemical conversion, electroporation, preferred electric shock transforms; Described host cell can be prokaryotic cell prokaryocyte or eukaryotic cell, be preferably intestinal bacteria, Bacillus subtilus, yeast (such as pichia spp) or various animal and plant cells, more preferably described host cell is this area genetic engineering bacterium commonly used, such as intestinal bacteria, subtilis, pseudomonas putida or pichia spp.More preferably described host cell is e. coli jm109 and/or pseudomonas putida.Most preferably described host cell is pseudomonas putida, and its medium optimization is: the glucose of the yeast powder of the ammonium chloride of the potassium primary phosphate of 0.03-0.3%, the Sodium phosphate dibasic of 0.1-1%, 0.05-0.5%, the sal epsom of 0.01-0.1%, 0.5-5%, the peptone of 0.1-1%, 0.001-0.05%, the glycerine of 2.5%-10%, the lactose of 0.1%-0.8%, the oleic acid of 0.1-2%, the Yelkin TTS of 0.1-1%, and regulate pH to 6.8.
Can use this area method commonly used from recombinant host cell, to separate and the purifying Sterol esterase.For example, centrifugation substratum and recombinant host cell, cell debris, affinitive layer purification Sterol esterase are removed in high-pressure homogenization smudge cells, centrifuging.For the product of the Sterol esterase of separation and purification gained, can use this area method commonly used to carry out Purity.For example, Xylene Brilliant Cyanine G method, Kjeldahl determination, biuret method, lowry method, ultraviolet absorption method, affinity chromatography, enzymic activity, antigen-antibody method, electrophoretic analysis (such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis), analysis by sedimentation, diffusion analysis, permanent solubility method, protein spectrum etc.Because therefore Sterol esterase good heat resistance of the present invention can adopt the broken liquid of reconstitution cell was heated 15-40 minute at 45-65 ℃, then at the centrifugal 10-20min of 8000-15000rpm, remove heat labile foreign protein in addition.Preferably, adopt the broken liquid of reconstitution cell is heated 30min at 55 ℃, the centrifugal 15min of 10000rpm removes most of heat labile foreign protein.
The present invention also provides at least a test kit that comprises in Sterol esterase of the present invention, nucleotide sequence, recombinant vectors and the recombinant host cell.Under the preferable case, test kit of the present invention comprises Sterol esterase, and do not comprise nucleotide sequence, recombinant vectors and recombinant host cell.More preferably test kit of the present invention comprises the dry powder of Sterol esterase, and does not comprise nucleotide sequence, recombinant vectors and recombinant host cell.The dry powder that can prepare with this area method commonly used Sterol esterase, as long as the method can access the dry powder of Sterol esterase, and the activity of not destroying the dry powder of Sterol esterase gets final product.Then the enzyme liquid that for example uses the vacuum-concentrcted device to obtain concentrating use the dry concentrated enzyme liquid of freeze drier; Perhaps use the equipment such as vacuum decompression moisture eliminator.Because Sterol esterase good heat resistance of the present invention can also use spray-dired technology to obtain the dry powder of this enzyme.Be converted into liquid form in the buffer solution system (for example acetate buffer, phosphate buffered saline buffer, preferred pH is 5.5-7.0) that the dry powder of Sterol esterase in use can be by being dissolved in pH5.0-8.0.
Test kit of the present invention can also comprise that this area is usually used in measuring the composition of the test kit of serum total cholesterol.Can be liquid form or solid dry powder form corresponding to the Sterol esterase in the test kit of the present invention, other compositions in the test kit of the present invention also can be liquid form and/or solid dry powder form.For example, when test kit of the present invention is liquid form, generally can contain the Sterol esterase of 0.01-0.5mol/L pH 6.5 phosphate buffered saline buffers, 10-1000U/L, the peroxidase of 1000-10000U/L, rCO, 0.01-10g/L phenol, 0.01-1g/L 4-AA, 0.1-10g/L bovine serum albumin and the 0.5-10g/L triton x-100 of 100-5000U/L.Test kit of the present invention preferably contains the phosphate buffered saline buffer of 0.05-0.2mol/L pH 6.5, the Sterol esterase of 100-300U/L, the peroxidase of 2000-5000U/L, rCO, 1-10g/L phenol, 0.05-0.1g/L 4-AA, 0.1-1g/L bovine serum albumin and the 5-10g/L triton x-100 of 500-1000U/L.
The kit components of liquid form of the present invention can be passed through Freeze Drying Technique, in conjunction with reduced pressure distillation technique, reverse osmosis technology and ultra-filtration technique etc., is prepared into reagent dry powder.Described dry powder can redissolve to original volume of described reagent with the solvent that is selected from deionized water, distilled water and distilled water before detecting sample to be measured.Test kit of the present invention can comprise the specification sheets that records above-mentioned various component using method and consumption.Therefore, described solution also can be prepared according to prior art according to the record of test kit specification sheets before use by the user and get final product.
Being suitable for using the sample to be measured of test kit of the present invention can be under animal body (the comprising human body) state of health and the serum of separating out after the blood natural coagulation under the pathological state.
Further specify the present invention below in conjunction with embodiment, the used reagent of the present invention, substratum are the commercial goods unless stated otherwise.
Preparation Example 1
A) acquisition (namely obtaining the nucleotide sequence shown in the sequence 3) of existing Sterol esterase COE gene
A-1) cultivation of Streptomyces venezuelae
Preparation LB substratum:
Peptone: 10g/L
Yeast powder: 5g/L
NaCl：10g/L
121 ℃ of 20min sterilizations.
Streptomyces venezuelae bacterial classification in the cryopreservation tube is inoculated in the LB substratum 26 ℃ of incubated overnight with inoculating needle.
A-2) extraction of genomic dna
Get step 1) overnight culture that obtains, at room temperature the centrifugal 5min of 8000rpm abandons supernatant, and the precipitation Eddy diffusion is in 1ml TE (10mM Tris-HCl, 1mM EDTA, pH8.0).The N,O-Diacetylmuramidase that adds 6 μ l50mg/ml, 37 ℃ of effect 2h add 2mol/L NaCl 50 μ l again, 10%SDS 110 μ l, the Proteinase K 3 μ l of 20mg/ml, 50 ℃ of effect 15min.Afterwards gained bacterium liquid is divided to install in the 10ml centrifuge tube, add isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1), place 5min behind the mixing.The centrifugal 10min of 12000rpm draws supernatant.Repeat twice of extracting.The Virahol that in supernatant, adds 0.6 times of volume, mixing, room temperature is placed 10min.The centrifugal 10min of 12000rpm, precipitation with 75% washing with alcohol, airing after, be dissolved in 50 μ l ddH
2Among the O.
A-3) with the acquisition of the plasmid of natural cholesterol esterase gene
Get step 2) genomic dna that obtains cuts 1h with 37 ℃ of enzymes of Ava I, simultaneously with the same terms digested plasmid pUC19,65 ℃ of water-baths use the T4 ligase enzyme of Niu Yinglun Bioisystech Co., Ltd (NEB) to connect 12h both after placing 10min deactivation restriction endonuclease, transform e. coli jm109.From transform flat board, filter out and have the clone who produces the Sterol esterase ability, check order and analyze the gene of Sterol esterase.Concrete operations are as follows:
Picking is 37 ℃ of single bacterium colonies of cultivating the e. coli jm109 of 16h on the LB solid medium, cultivate 16h at 37 ℃, the shaking table of 150rpm in liquid LB substratum again.Get 1ml gained liquid culture and transfer in 100ml fresh liquid LB substratum, the rotating speed thermal agitation with 200-250rpm on 37 ℃ of shaking tables is cultivated 2.5h.Draw the cultured bacterium liquid of 1.5ml to the 1.5ml centrifuge tube, in cooled on ice after 10 minutes, under 4 ℃, 3000g centrifugal 5 minutes.Supernatant discarded adds 100 μ l at the CaCl of the 0.1mol/L of precooling on ice
2Solution is inhaled up and down gently moving beating with liquid-transfering gun and is spared, and re-suspended cell was placed 20 minutes at ice.Then under 4 ℃, 3000g centrifugal 5 minutes, supernatant discarded added 100 μ l at the CaCl of the 0.1mol/L of precooling on ice
2Solution is inhaled up and down gently moving beating with liquid-transfering gun and is spared, and re-suspended cell obtains competent host cell e. coli jm109.
Get the above-mentioned competent e. coli jm109 of 200 μ l and place the 1.5ml centrifuge tube, the adding volume is that the connection product solution of 10 μ l shakes up gently, places on ice 30 minutes.Then thermal shock 120 seconds in 42 ℃ of water-baths placed rapidly cooled on ice 5 minutes.Add 1ml LB liquid nutrient medium (not containing penbritin) in the centrifuge tube, 37 ℃ of shaking culture 1h behind the mixing make bacterium restore normal growth state and the penbritin antibiotics resistance gene (Amp of expression plasmid coding
r).Getting 100 μ l after above-mentioned bacterium liquid shaken up coats on the LB screening flat board that contains penbritin, 0.05mM cholesterol linoleate, 1KU/L rCO, 500U/L horseradish peroxidase, 0.02mM 4-AA and 0.02mM phenol, face up and place half an hour, after bacterium liquid is absorbed by substratum fully, be inverted culture dish, cultivate 20h for 37 ℃.Colibacillary bacterium colony occurred at the screening flat board, namely the pUC19 recombinant plasmid has been converted in the escherichia coli jm109 competent cell; And there is the clone with variable color circle, the e. coli jm109 of the recombinant plasmid that has obtained including the whole gene of Sterol esterase is described.The variable color circle is cloned in 37 ℃ of 200rpm cultivation 20h among the LB, send hero (invitrogen) company to carry out determined dna sequence, analytical sequence obtains the plasmid with the gene order of the natural cholesterol esterase of Streptomyces venezuelae (being sequence 3).
A-4) amplification Sterol esterase gene (COE gene)
Sterol esterase gene (COE gene) primer of inventor's design is as follows:
Sterol esterase gene forward primer (COEF): AAGCTTG
Sterol esterase gene reverse primer (COER): GTCGAC
Sterol esterase gene amplification condition is: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH
4)
2SO
4, 2mM MgSO
4, 0.1%Triton X-100,50 μ M dATP, 50 μ M dGTP, 50 μ M dTTP, 50 μ M dCTP, 400nM primer COEF, 400nM primer COER, 1.5U PfuDNA polysaccharase (Promega, USA), 20ng steps A-3) the plasmid DNA template that obtains adds reaction system, transfers to reaction volume with sterilized water and reaches 50 μ L.
The amplified reaction program is: 95 ℃ of lower reactions 5 minutes, " 95 ℃ of 30s, 55 ℃ of 30s and the 72 ℃ of 1min " that then carry out 30 circulations were at last 72 ℃ of lower maintenances 10 minutes with above-mentioned reaction system.The pcr amplification gene product that obtains is separated with 1% agarose gel electrophoresis, and reclaim the dna fragmentation of the single band in the 700bp left and right sides.
B) with the structure of the pUC19 expression vector of pseudomonas replicon
Pseudomonas replicon gene clone among the plasmid pCN51 to pUC19, is built into the carrier that can copy and express in pseudomonas.Concrete steps are as follows:
Clone's replicon gene (Rep gene) primer is as follows:
Replicon gene forward primer (RepF): GGTACCCAGCTGACCAACGACCGGTA
Replicon gene reverse primer (RepR): GAATTCTCACTCGAGACTCAGTGCCA
The replicon amplification condition is: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH
4)
2SO
4, 2mM MgSO
4, 0.1%Triton X-100,50 μ M dATP, 50 μ M dGTP, 50 μ M dTTP, 50 μ MdCTP, 400nM primer RepF, 400nM primer RepR, 1.5U Pfu archaeal dna polymerase (Pu Luomaige Bioisystech Co., Ltd (Promega), USA), 20ng plasmid DNA template adds reaction system, transfers to reaction volume with sterilized water and reaches 50 μ L.
The amplified reaction program is: above-mentioned reaction system 95 ℃ of lower reactions 5 minutes, is then carried out " 95 ℃ 30 seconds, 55 ℃ 30 seconds and 72 ℃ 2 minutes " of 30 circulations, at last 72 ℃ of lower maintenances 10 minutes.The pcr amplification gene product that obtains is separated with 1% agarose gel electrophoresis, and reclaim the dna fragmentation of the single band in the 1800bp left and right sides with triumphant outstanding person (QIAGEN) rapid extraction gel reagents box.
The Rep gene that obtains through Sac I and EcoR I double digestion 4h, and is connected the pUC19 carrier through Sac I equally and is connected with EcoR I double digestion 4h.
C) recombinant vectors is to the conversion of host cell and the cultivation of gained recombinant host cell
C-1) with the Sterol esterase gene clone to step B) before the replicon of gained empty carrier, concrete steps are as follows:
With step B) the gained carrier is through Hind III and BamH I double digestion 4h, the while is with Hind III and BamH I double digestion steps A-4) gained COE gene, by using the two connection of T4DNA ligase enzyme, be configured to Sterol esterase expression vector pCOE.
C-2) preparation of competence pseudomonas putida (Pseudomonas Putida, ATCC12633)
Pseudomonas putida (Pseudomonas Putida with 70 ℃ of glycerine preservations, ATCC12633) after the activation of LB solid plate, 37 ℃ of 120 rev/mins of shaking tables of picking list bacterium colony were cultivated 16 hours, to spend the night and increase the pseudomonas putida of bacterium, be inoculated in 1: 100 ratio in the SOC substratum of 50ml, 37 ℃ of 120 rev/mins of shaking tables are cultured to bacterium liquid absorbancy and reach 1.0, draw the cultured bacterium liquid of 1.5ml to the 1.5ml centrifuge tube, in cooled on ice after 10 minutes, under 4 ℃, 6000 rev/mins conditions centrifugal 15 minutes.Abandon supernatant and add 100 μ l at the CaCl of the 0.1mol/L of precooling on ice
2Solution is inhaled up and down gently moving beating with liquid-transfering gun and is spared, and re-suspended cell was placed 20 minutes at ice.Then under 4 ℃, 3000g centrifugal 5 minutes, supernatant discarded added 100 μ l at the CaCl of the 0.1mol/L of precooling on ice
2Solution is inhaled up and down gently moving beating with liquid-transfering gun and is spared, and re-suspended cell obtains competent pseudomonas putida.
C-3) described expression vector pCOE electric shock is transformed into described competence pseudomonas putida
With step C-1) the Sterol esterase expression vector pCOE of gained joins step C-2) in the competent cell of gained, mixing and place different time after change the 2mm pole cup of precooling over to, avoid producing bubble, wherein, described expression vector pCOE final concentration is 0.5 μ g/ml, and competence pseudomonas putida concentration is 4.6 * 10
12Individual/ml, the electricity conversion condition is: 10% glycerine solution as electric referral matter, 4 ℃, electricimpulse field intensity be 13kV/cm,, the electric shock burst length is 5ms, and in the electric shock cup, add the SOC substratum that 37 ℃ of temperature are bathed rapidly, 37 ℃ of 120 rev/mins of shaking tables were cultivated 1 hour, obtain recombinant host cell, namely express the pseudomonas putida bacterial strain of natural cholesterol esterase.
D) heat-resisting sudden change Sterol esterase screening
With step C) the pseudomonas putida bacterial strain of the expression natural cholesterol esterase that obtains is inoculated in respectively in a plurality of 3ml LB substratum, and 37 ℃ of 200rpm are cultured to OD
600=1.0, the IPTG of adding final concentration 1mM induces 4h for 30 ℃.Behind ultrasonic disruption cell (broken power 200w, broken time 4min), respectively at 60 ℃, 65 ℃, 70 ℃ lower heating in water bath 30min.
Be formulated as follows and survey the reagent of living:
Described A liquid is mixed with 1: 3 volume ratio with described B liquid, and every hole 120 μ l place 96 orifice plates, and then every hole adds the ultrasonic cell-break liquid of the above-mentioned heating of 4 μ l, and 37 ℃ of temperature are bathed 5min, and the hole that reddens is the hole with enzymic activity.In 60 ℃ of enzyme liquid that heated, 3 holes that respond and redden are arranged, in 65 ℃ of enzyme liquid that heated, 1 hole that responds and redden is arranged, the hole that in 70 ℃ of enzyme liquid that heated, does not have reaction to redden.The order-checking check is described behind 65 ℃ of heating ultrasonic cell-break liquid, the corresponding clone of institute in the hole that responds, the nucleotide sequence (shown in SEQ ID No.:2) of the heat-resisting sudden change Sterol esterase that obtains encoding and express as described in the pseudomonas putida bacterial strain of heat-resisting sudden change Sterol esterase.
E) cultivation of heat-resisting recombinant host cell
With above-mentioned steps D) the corresponding pseudomonas putida with the nucleotide sequence of the heat-resisting sudden change Sterol esterase of coding that obtains is cloned in and is cultured to growth logarithmic phase (10 in the LB substratum under 30 ℃
6Cells/ml), then take gained seed liquor (pseudomonas putida of LB substratum and propagation) and the amplification culture medium volume ratio ratio as 1: 100, be inoculated in the following amplification culture medium of 3L composition (% represents weight percent): 0.05% potassium primary phosphate, 0.5% Sodium phosphate dibasic, 0.1% ammonium chloride, 0.05% sal epsom, 2% yeast powder, 0.5% peptone, 0.03% glucose, 5% glycerine, 0.5% lactose, 1% oleic acid and 0.5% Yelkin TTS.Regulate pH to 6.8.
Described 3L amplification culture medium is joined in the 5L fermentor tank, 121 ℃ of sterilizations 15 minutes.In the gained substratum, add the above-mentioned pseudomonas putida (10 that 60mL grows to logarithmic phase
6Cells/ml).The cell density that is cultured under 37 ℃ in the fermented liquid sampling reaches 10
8The cells/ml fermentation is complete.
F) separating-purifying of protein product
With step e) fermented liquid centrifugal 10min under 10000rpm of obtaining, collect the recombinant host cell precipitation.Supernatant discarded, the pH that the gained recombinant host cell is resuspended in isopyknic 20mmol/L is in 8.0 the Bis-Tris damping fluid.With the resuspended cell of high-pressure homogenization crusher machine, with smudge cells liquid heating 30min under 55 ℃, remove most of heat labile foreign protein, centrifugal 15min under 10000rpm first, collect the supernatant crude enzyme liquid, abandon or adopt the thermo-labile foreign protein precipitation of cell debris precipitation and sex change.
After above-mentioned gained crude enzyme liquid was 0.22 μ m membrane filtration with the aperture, gained filtrate was carried out ion exchange chromatography at An Keta purifying person (AKTA Purifier) the diethylaminoethyl cellulose post (DEAE CL-6B post) of AM General electronics corporation (GE company).Wherein, sample-loading buffer is that the pH of 20mmol/L is 8.0 Bis-Tris damping fluid.Behind the sample-loading buffer that flows through two column volumes, use elution buffer, it is that the pH that contains the 20mmol/L of 1mol/L NaCl is 6.0 Bis-Tris damping fluid.After 8% elution buffer is washed post, obtain target protein with 25% elution buffer wash-out and begin to collect albumen, collect the unimodal end of albumen (wherein referring to that in 8% described in the elution process and 25% described elution buffer accounts for the percent by volume of elution buffer and sample-loading buffer sum) that real-time monitors.
After gained solution was the membrane filtration of 0.22 μ m with the aperture, gained filtrate was used sephadex G-25 chromatography column (Sephadex G-25) desalination again.The pH that described desalination damping fluid is 0.1mol/L is 7.0 potassium phosphate buffer.Using loading on the good chromatography column of desalination damping fluid balance, wherein the flow velocity of sample solution (being that above-mentioned pH with 0.1mol/L is the protein solution that 6.0 Bis-Tris damping fluid redissolves) is 5ml/min, then uses the desalination damping fluid with 2 column volumes of flow velocity wash-out of 15ml/min.Totally 500 milliliters of liquid under the collection wash-out.
Collected liquid in general refrigerator-10 ℃ lower freezing 2 hours, and then-40 ℃ of cryogenic refrigerator pre-freezes 8 hours, in the ALPHA 1-4LSC of German Ke Ruisite (CHRIST) type freeze drier, with the condition freeze-drying of vacuum tightness 0.04mbar, safe pressure 0.100mbar and condenser temperature-60 ℃ 10 hours.Then waiting temperature of charge and Freeze Drying Equipment baffle temperature poor is zero, and observes 15 seconds internal pressures and indicate when constant, finishes freeze-drying.The amount of freeze-drying gained protein is 10 grams.Lyophilized protein under freezing conditions seals preservation.
Adopt " protein electrophorese experimental technique " (Guo Yaojun, the 132-145 page or leaf, Science Press, 1999) method of SDS-PAGE electrophoresis of the record molecular weight that determines the protein of the present embodiment is 64KD, and according to " biological chemistry " (Wang Jingyan etc., Higher Education Publishing House, 2002, see 168 pages) measuring method (minute peptide section measure) of the prlmary structure of protein of record, the protein that records the present embodiment has 226 amino-acid residues (referring to the aminoacid sequence shown in the SEQ ID NO:1), with consistent by the nucleotide sequence coded protein result shown in the SEQ ID NO:2.
Measure in accordance with the following methods the activity of Sterol esterase:
Be formulated as follows and survey the reagent of living:
Add successively 0.3ml A liquid, 0.9mlB liquid and 0.04ml enzyme liquid to be measured.Measure wavelength 505nm at 37 ℃ of lower reaction 5min.Measure the velocity of variation of 4-5min internal absorbance.Calculate enzyme activity according to following formula:
Vt: reaction solution cumulative volume (1.24ml) e:13.78 (molar absorptivity)
Vs: the volume of enzyme liquid to be measured (0.04ml) d: cuvette optical path (1cm)
D: extension rate Δ A/min:ABS/min
Linearity range is 300～600U/L.
Enzyme concn in enzyme activity (U/mg)=enzyme activity (U/L)/solution
Wherein, the weight unit of heat-resisting Sterol esterase lyophilized powder is mg, and the unit of enzyme concn is mg/L in the solution.
Wherein, enzyme work is defined as: 1 enzyme unit alive equals to generate in 1 minute the enzyme amount of 1 mmole hydrogen peroxide (1/2 mmole quinone dyestuff) under following reaction conditions.
The albumen that more than measures the present embodiment not only has the activity (60-70KU/L) of Sterol esterase, and the Km value with cholesterol linoleate is 1.9 * 10
-5Mol/L, (the Km value of the cholesterol linoleate under 37 ℃ is at most 2.1 * 10 to be enough to satisfy the requirement to Sterol esterase of the test kit measure clinically total cholesterol density of serum in the sample to be measured
-5Mol/L).
To sum up, the present inventor has obtained a kind of new Sterol esterase, it derives from streptomyces venezuelae (Streptomyces venezuelae ATCC 10712), and molecular weight is 52.7KD, iso-electric point: 5.26, have the nucleotide sequence shown in the aminoacid sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2.And Sterol esterase pH stable range of the present invention is that 5-10 and thermostability are at 65 ℃ of lower 30min non-inactivations.Wherein, those skilled in the art are by reading the present embodiment, can know for example SEQ ID NO:2 of nucleotide sequence of the present invention, and can obtain described nucleotide sequence by chemical synthesis process, therefore can be after obtaining having the nucleic acid of this nucleotide sequence, need not to implement the present embodiment A) and D) step, but after obtaining the nucleotide sequence shown in the SEQ ID NO:2 of synthetic, directly implement the present embodiment step B), C), E) and F) repeat the present embodiment; Perhaps obtaining step D) directly implement the present embodiment step e behind the pseudomonas putida bacterial strain of described heat-resisting sudden change Sterol esterase) and F) repeat the present embodiment.
Comparative Examples 1
This Comparative Examples is the Sterol esterase that the pseudomonas source that company (TOYOBO) produces is spun by Japan, and its molecular weight is 300KD, is 5.4 * 10 to the Km of cholesterol linoleate
-5Mol/L, optimum pH 7.0-9.0,40 ℃ of optimum temperutures.
Comparative Examples 2
This Comparative Examples is the pseudomonas putida bacterial strain of the expression natural cholesterol esterase that obtains of embodiment 1 step C, and it has the nucleotide sequence shown in the aminoacid sequence shown in the SEQ ID NO:3 and the SEQ ID NO:4.Its molecular weight is 52KD, is 2.1 * 10 to the Km of cholesterol linoleate
-5Mol/L, optimum pH 6.0-8.0,40 ℃ of optimum temperutures.
Test implementation example 1
The method test Preparation Example 1 of mentioning according to Preparation Example 1 and the cholesteryl ester enzymic activity of Comparative Examples 1-2, test result sees the following form 1
Table 1
| Sterol esterase | Preparation Example 1 | Comparative Examples 1 | Comparative Examples 2 |
| Enzyme (KU/mg lyophilized powder) alive | 60 | 100 | 15 |
By above result as can be known, its enzyme activity of the Sterol esterase of embodiment 1 is compared with 2 on the same order of magnitude with Comparative Examples 1, can satisfy the requirement to Sterol esterase of the test kit of measuring clinically potassium concentration in the sample to be measured fully.
Test implementation example 2
Test as follows the pH stability of the Sterol esterase of Preparation Example 1 and Comparative Examples 1-2:
The Sterol esterase of 0.5KU under 25 ℃, is dissolved in respectively pH value and is in 3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5,9.0 and 9.5 the 100mmol/L trolamine damping fluid, left standstill 20 hours.Except the step difference of " enzyme dry powder pH is that 7.6 trolamine damping fluid is diluted to 1000U/L ", measure enzyme according to the method for test implementation example 1 and live.The ratio percentage ratio of living with the maximum institute enzyme of surveying work by the survey enzyme is that relative reactivity is ordinate zou, and pH is the X-coordinate curve plotting.The test result of Preparation Example 1 and Comparative Examples 1-2 is seen Fig. 4.
As can be seen from the figure, the pH stability of Preparation Example 1 significantly is better than Comparative Examples 1-2, the kind analogy prior art that so comprises the sample to be tested that the test kit of Sterol esterase of the present invention can be measured is more, the transportation of test kit, the condition of preservation are reduced, the accurate meticulous requirement of operation to the personnel that use test kit reduces, and is conducive to popularizing with the test kit of Sterol esterase.
Test implementation example 3
Test as follows the cholesteryl ester Thermostability of Preparation Example 1 and Comparative Examples 1-2:
It is in 7.5 the 20mmol/L potassium phosphate buffer, respectively 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃ lower maintenances 15 minutes that the Sterol esterase dry powder of 1KU is dissolved in the pH value.Measuring enzyme according to the method for test implementation example 1 lives.The ratio percentage ratio of living with the maximum institute enzyme of surveying work by the survey enzyme is that relative reactivity is ordinate zou, and temperature is the X-coordinate curve plotting.The test result of Preparation Example 1 and Comparative Examples 1-2 is seen Fig. 3.
As can be seen from the figure, the thermostability of Preparation Example 1 is significantly greater than Comparative Examples 1-2.At 60 ℃ of relative reactivities of all having under the condition more than 90% in 10 minutes of heating, apparently higher than the relative reactivity of the Sterol esterase of under the same conditions Comparative Examples 1-2.
Preparation Example 2-5
Formulated reagent according to table 2:
Table 2
Preparation Example 5 and 6 reagent are mixed with respectively liquid form and get final product.The respectively under the following conditions lyophilize of Preparation Example 7 and 8 reagent: in general refrigerator-10 ℃ lower freezing 2 hours, and then-40 ℃ of cryogenic refrigerator pre-freezes 8 hours, in the ALPHA 1-4LSC of German Ke Ruisite (CHRIST) type freeze drier, with the condition freeze-drying of vacuum tightness 0.04mbar, safe pressure 0.100mbar and condenser temperature-60 ℃ 10 hours.Then waiting temperature of charge and Freeze Drying Equipment baffle temperature poor is zero, and observes 15 seconds internal pressures and indicate when constant, finishes freeze-drying.The reagent dry powder that freeze-drying obtains can redissolve into the volume of primary liquid form before use with distilled water.The reagent dry powder that freeze-drying obtains, longer than the time that the reagent of liquid form is preserved, packing instructions are lower, and volume is less, and it is easier to transport.
Comparative Examples 2
Become the test kit of liquid form according to the formulated identical with Preparation Example 5.
Test implementation example 6
This test implementation example has been measured two samples to be measured: one is the total cholesterol aqueous standard product of 5.20mmol/L; Another is 30 years old women's being in a good state of health serum sample to be measured, extracts its 10ml blood, leaves standstill to the hemocyte precipitated and separated, gets upper serum 5ml and is used for the test kit of Preparation Example 2-5 and Comparative Examples 3 is tested.
Respectively the R1 among the Preparation Example 2-5 is got 300 μ l, add sample 3 μ l, mixed solution is incubated 300 seconds under 37 ℃ of conditions, record absorbancy numerical value A under the 505nm condition.Test result sees Table 3.
Table 3
As can be seen from Table 3, the test kit test result of Preparation Example 2-5 than Comparative Examples 2 more near actual value; And the test kit test result standard deviation of Preparation Example 2-5 is significantly less than Comparative Examples 2, illustrates that test kit performance of the present invention is more stable, and it is more accurate to measure.
Claims (10)
1. a Sterol esterase is characterized in that, the aminoacid sequence of described Sterol esterase is
Aminoacid sequence shown in the SEQ ID NO:1.
2. the nucleotide sequence of the Sterol esterase of encoding is characterized in that, described nucleotides sequence is classified the nucleotide sequence of coding Sterol esterase claimed in claim 1 as.
3. nucleotide sequence according to claim 2, wherein, described nucleotides sequence is classified as
Nucleotide sequence shown in the SEQ ID NO:2.
4. a recombinant vectors is characterized in that, described recombinant vectors is comprised of the goal gene of empty carrier and this empty carrier of insertion, and described goal gene is the nucleotide sequence of claim 2 or 3 described coding Sterol esterases.
5. recombinant vectors according to claim 4 is characterized in that, described empty carrier is selected from the group that is comprised of pUC19, pGEM and pBluescript.
6. recombinant vectors according to claim 5 is characterized in that, described empty carrier is the pUC19 that has inserted the pseudomonas replicon gene among the plasmid pCN51.
7. a recombinant host cell is characterized in that, described recombinant host cell contains claim 4 or 5 described recombinant vectorss.
8. recombinant host cell according to claim 7 is characterized in that, described host cell is e. coli jm109 or pseudomonas putida.
9. an Accessory Right requires the method for purifying Sterol esterase in the 7 or 8 described recombinant host cells, it is characterized in that, described method adopts the broken liquid with reconstitution cell to heat 15-40 minute at 45-65 ℃, then at the centrifugal 10-20min of 8000-15000rpm, to remove heat labile foreign protein.
10. a test kit that detects serum total cholesterol is characterized in that, described test kit comprises
Sterol esterase claimed in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102530390A CN102321595B (en) | 2011-08-31 | 2011-08-31 | Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102530390A CN102321595B (en) | 2011-08-31 | 2011-08-31 | Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102321595A CN102321595A (en) | 2012-01-18 |
| CN102321595B true CN102321595B (en) | 2013-01-09 |
Family
ID=45449431
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011102530390A Active CN102321595B (en) | 2011-08-31 | 2011-08-31 | Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102321595B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977419B (en) * | 2018-08-08 | 2021-12-31 | 福建师范大学 | Thermostable cholesterol esterase mutant OPE-S109P/S271P and preparation method thereof |
| CN109022393B (en) * | 2018-08-08 | 2022-01-04 | 福建师范大学 | Thermostable cholesterol esterase mutant OPE-D136P and preparation method thereof |
| CN109022392B (en) * | 2018-08-08 | 2022-01-04 | 福建师范大学 | Thermostable cholesterol esterase mutant OPE-A355E/T383E and process for preparing the same |
| CN109456953A (en) * | 2018-11-13 | 2019-03-12 | 青岛海洋生物医药研究院股份有限公司 | A kind of cholesterol esterase and its application |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH07203959A (en) * | 1994-01-19 | 1995-08-08 | Kyowa Hakko Kogyo Co Ltd | Stable cholesterol-esterase and production thereof |
| JP3399685B2 (en) * | 1995-03-07 | 2003-04-21 | 東洋紡績株式会社 | Modified enzyme having cholesterol oxidase activity |
| WO2008040740A1 (en) * | 2006-10-03 | 2008-04-10 | Novozymes A/S | Lipolytic enzyme variants |
-
2011
- 2011-08-31 CN CN2011102530390A patent/CN102321595B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102321595A (en) | 2012-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Howard et al. | Specificity of the autolysin of Streptococcus (Diplococcus) pneumoniae | |
| Moore et al. | A proteinase from human erythrocyte membranes | |
| Wadström et al. | Bacteriolytic enzymes from Staphylococcus aureus. Purification of an endo-β-N-acetylglucosaminidase | |
| CN102321595B (en) | Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit | |
| CN103436514B (en) | Heat-resistant lyase TSPpgh and polynucleotide coding same | |
| Scopes | Crystalline 3-phosphoglycerate kinase from skeletal muscle | |
| CN110295159A (en) | A kind of enzyme mutant | |
| CN101698834B (en) | 3 alpha-hydroxysteroid dehydrogenase and nucleotide sequence, recombinant vector, recombinant host cell and kit thereof | |
| CN101412993A (en) | Solid fermentation method of natto kinase | |
| MEYER et al. | Rapid procedure for the approximate determination of the deoxyribonucleic acid base composition of micrococci, staphylococci, and other bacteria | |
| Rogers | The function of leucine aminopeptidase in exsheathing fluid | |
| Peterkofsky et al. | Transfer ribonucleic acid deficient in N6-(Δ2-isopentenyl) adenosine due to mevalonic acid limitation | |
| Wannamaker | Electrophoretic studies of the extracellular products of group A streptococci | |
| CN101698837B (en) | Pyruvate kinase and nucleotide sequence, recombinant vector, recombinant host cell and kit thereof | |
| OSMUNDSVAG et al. | Cellulases from Sporocytophaga myxococcoides: Purification and properties | |
| Aitken et al. | Amino and carboxy terminal sequences of the DNA-binding protein HU from the Cyanobacterium Synechocystis PCC 6701 (ATCC 27170) | |
| CN101659943B (en) | Pyruvic oxidase, and nucleotide sequence, recombinant vector, recombinant host cell and kit thereof | |
| AU2019329357A1 (en) | Mutant strain of trichoderma reesei and method for producing protein using same | |
| CN102391999B (en) | Homocysteine methyltransferase, nucleotide sequence thereof, recombinant vector, recombinant host cells, manufacturing method and kit | |
| CN101638640B (en) | Glucose-6-phosphoric acid dehydrogenase and nucleotide sequence, recombinant vector, recombinant host cell and kit thereof | |
| CN101319203B (en) | Preparation method for phosphatidylserine synthetase | |
| Hendrix et al. | Isolation of a Bacillus stearothermophilus mutant exhibiting increased thermostability in its restriction endonuclease | |
| CN101402954A (en) | Method for expressing recombinant pig lactoferrin N leaf with pichia thermophilic methanol yeast | |
| Bush | Enzymatic lysis of the pseudomurein-containing methanogen Methanobacterium formicicum | |
| CN103710363A (en) | Laccase gene Lac6 and expression protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |