CN101698834B - 3 alpha-hydroxysteroid dehydrogenase, nucleotide sequence thereof, recombinant vector thereof, recombinant host cells thereof and kit - Google Patents
3 alpha-hydroxysteroid dehydrogenase, nucleotide sequence thereof, recombinant vector thereof, recombinant host cells thereof and kit Download PDFInfo
- Publication number
- CN101698834B CN101698834B CN2009100906886A CN200910090688A CN101698834B CN 101698834 B CN101698834 B CN 101698834B CN 2009100906886 A CN2009100906886 A CN 2009100906886A CN 200910090688 A CN200910090688 A CN 200910090688A CN 101698834 B CN101698834 B CN 101698834B
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- hydroxysteroid dehydrogenase
- 3alpha
- ala
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses 3 alpha-hydroxysteroid dehydrogenase, which has an amino acid sequence shown in SEQ ID No.1. The invention also discloses the amino acid sequence for coding the 3 alpha-hydroxysteroid dehydrogenase, a recombinant vector having the amino acid sequence, recombinant host cells having the recombinant vector and a kit having at least one of the 3 alpha-hydroxysteroid dehydrogenase, the amino acid sequence, the recombinant vector and the recombinant host cells. The 3 alpha-hydroxysteroid dehydrogenase has a high optimal temperature and heat resistance.
Description
Technical field
The present invention relates to a kind of enzyme; The encode nucleotide sequence of this enzyme; The recombinant vectors that comprises said nucleotide sequence comprises the recombinant host cell of said recombinant vectors, and comprises at least a test kit in above-mentioned enzyme, nucleotide sequence, recombinant vectors and the recombinant host cell.More specifically; The present invention relates to a kind of 3alpha-Hydroxysteroid dehydrogenase; The encode nucleotide sequence of this 3alpha-Hydroxysteroid dehydrogenase; The recombinant vectors that comprises said nucleotide sequence comprises the recombinant host cell of said recombinant vectors, and comprises at least a test kit in above-mentioned 3alpha-Hydroxysteroid dehydrogenase, nucleotide sequence, recombinant vectors and the recombinant host cell.
Background technology
(3 α-Hydroxysteroid Dehydrogenase, 3 α-HSD EC1.1.1.50) can act on multiple substrate to 3alpha-Hydroxysteroid dehydrogenase, the redox of 3 hydroxyl/ketone groups of reversibility ground catalysis C19-27 steroid.Bile acide is one of effect substrate of 3 α-HSD, measures TOTAL BILE ACID (total bile acids, TBA) concentration in the human serum with 3 α-HSD as toolenzyme clinically.Thereby can be prepared into the corresponding reagent box that comprises 3alpha-Hydroxysteroid dehydrogenase, for example detect the test kit of bile acide concentration in the serum.
Bile acide and 3 α-HSD and oxidized form β-Thionicotinamide adenine dinucleotide (Thio-NAD+) reacts, and generates 3-ketone bile acide and reduced form β-Thionicotinamide adenine dinucleotide (Thio-NADH).3-ketone bile acide is under 3 α-HSD and NADH effect, and reduction generates bile acide and NAD+.For example, concrete reaction principle can be shown in following formula one:
(formula one)
Can know by above reaction formula; Bile acide concentration is directly proportional in the generating rate of Thio-NADH and the tested sample; Therefore can utilize spectrophotometer; Variation through the absorbancy that causes at 405nm wavelength monitoring Thio-NADH calculates the bile acide concentration in tested sample body fluid such as (for example) serum.In addition, can also utilize spectrophotometer,, calculate the enzymic activity of 3 α-HSD through variation in 340nm wavelength monitoring NADH absorbancy.
The existing test kit of having developed bile acide concentration in the mensuration serum that meets above principle, the for example detection kit of the SBA concentration of Asahi Kasei Corporation (Asahikasei) production.
But the used 3alpha-Hydroxysteroid dehydrogenase of present test kit exists poor heat resistance (referring to Fig. 3); Transportation, preservation and the use of test kit are had relatively high expectations to envrionment temperature, have influence on the validity and the accuracy of kit measurement easily owing to the sex change of 3alpha-Hydroxysteroid dehydrogenase.
Summary of the invention
An object of the present invention is to overcome the shortcoming of existing 3alpha-Hydroxysteroid dehydrogenase poor heat resistance, a kind of 3alpha-Hydroxysteroid dehydrogenase of good heat resistance is provided.
Second purpose of the present invention provides the nucleotide sequence of the said 3alpha-Hydroxysteroid dehydrogenase of coding.
The 3rd purpose of the present invention provides the recombinant vectors that comprises said nucleotide sequence.
The 4th purpose of the present invention provides the recombinant host cell that comprises said recombinant vectors.
The 5th purpose of the present invention provides at least a test kit that comprises in above-mentioned 3alpha-Hydroxysteroid dehydrogenase, nucleotide sequence, recombinant vectors and the recombinant host cell.
3alpha-Hydroxysteroid dehydrogenase extensively is present in the multiple organism, but the nature difference of the 3alpha-Hydroxysteroid dehydrogenase in organism not of the same race (such as various bacteria etc.) source is very big.Contriver of the present invention has paid creative work in large quantities; Utilization is transferred goal gene to multiple organism design primer and is combined the method for site-directed mutagenesis technique; Final through from pseudomonas putida (Pseudomonas putidaATCC12633), transferring the 3alpha-Hydroxysteroid dehydrogenase encoding sox and it is carried out rite-directed mutagenesis at random, obtain the 3alpha-Hydroxysteroid dehydrogenase that the present invention has the aminoacid sequence shown in the SEQ ID NO:1.And contriver of the present invention is surprised to find that, gained 3alpha-Hydroxysteroid dehydrogenase good heat resistance, thus reduced by the transportation of the test kit of its preparation, the temperature condition of preservation.Wherein said pseudomonas putida is available from the biological article of USS collecting center, and it is numbered ATCC12633.
The invention provides a kind of 3alpha-Hydroxysteroid dehydrogenase, wherein, the aminoacid sequence of said 3alpha-Hydroxysteroid dehydrogenase is the aminoacid sequence shown in the SEQ ID NO:1.
The present invention also provides the nucleotide sequence of the 3alpha-Hydroxysteroid dehydrogenase according to the invention of encoding.
The present invention also provides the recombinant vectors that comprises nucleotide sequence according to the invention.
The present invention also provides the recombinant host cell that comprises recombinant vectors according to the invention.
The present invention also provides at least a test kit that comprises in 3alpha-Hydroxysteroid dehydrogenase of the present invention, nucleotide sequence, recombinant vectors and the recombinant host cell.
3alpha-Hydroxysteroid dehydrogenase provided by the invention has the advantage of good heat resistance.Can know that referring to Fig. 1 3alpha-Hydroxysteroid dehydrogenase of the present invention is at 60 ℃ of relative reactivities that all have more than 80%, apparently higher than the relative reactivity (only having 30%) of the 3alpha-Hydroxysteroid dehydrogenase of under the same conditions Comparative Examples 1 (referring to Fig. 3).
Description of drawings
Fig. 1 prepares the 3alpha-Hydroxysteroid dehydrogenase temperature stability graphic representation of embodiment 1;
Fig. 2 prepares the 3alpha-Hydroxysteroid dehydrogenase optimum temperuture activity curve figure of embodiment 1;
The 3alpha-Hydroxysteroid dehydrogenase temperature stability graphic representation of Fig. 3 Comparative Examples 1;
The 3alpha-Hydroxysteroid dehydrogenase optimum temperuture activity curve figure of Fig. 4 Comparative Examples 1.
Embodiment
The invention provides a kind of 3alpha-Hydroxysteroid dehydrogenase, wherein, the aminoacid sequence of said 3alpha-Hydroxysteroid dehydrogenase is the aminoacid sequence shown in the SEQ ID NO:1.
3alpha-Hydroxysteroid dehydrogenase provided by the invention can also be modified, and obtains deutero-protein." deutero-protein " according to the invention refers to have the difference on the modified forms that does not influence sequence with the 3alpha-Hydroxysteroid dehydrogenase with above-mentioned aminoacid sequence.Promptly said " deutero-protein " also comprises the analogue (like D type amino acid) with the amino acid whose residue of natural L type, and has non-natural analogue that exist or synthetic amino acid (like beta-amino acids, gamma-amino acid etc.).
(the not changing primary structure usually) form of modification comprises: the interior or external proteic chemically derived form of body, and like acetylize or carboxylated.Modify and also to comprise glycosylation, like those in proteic synthetic and processing or further carry out glycosylation modified and albumen that produce in the procedure of processing.This modification can be carried out glycosylated enzyme (like mammiferous glycosylase or deglycosylating enzyme) and accomplishes through albumen is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (like Tyrosine O-phosphate, Serine O-phosphate, phosphothreonine).Thereby also comprise and modified the albumen that has improved its anti-proteolyze performance or optimized solubility property.
The present invention also provides the nucleotide sequence of the 3alpha-Hydroxysteroid dehydrogenase according to the invention of encoding.
Known in this field, in 20 kinds of different amino acid of constitutive protein matter, except that Met (ATG) or Trp (TGG) are respectively single password coding; Other 18 seed amino acids are respectively by 2-6 codon coding (Sambrook etc., molecular cloning, press of cold spring harbor laboratory; New York, the U.S., second edition; 1989, see 950 pages of appendix D).Promptly because the degeneracy of genetic codon; Determine more than one mostly of an amino acid whose codon; The displacement of the 3rd Nucleotide often can not change amino acid whose composition in the triplet codon, and the nucleotide sequence of the gene of the same protein of therefore encoding can be different.Those skilled in the art are according to known password sublist; From aminoacid sequence disclosed by the invention; And the active constant aminoacid sequence of the 3alpha-Hydroxysteroid dehydrogenase that obtains by said aminoacid sequence; Can derive their nucleotide sequence of gene of to encode fully, obtain said nucleotide sequence through biological method (like PCR method, mutation method) or chemical synthesis process, so this partial nucleotide sequence should comprise within the scope of the present invention all.On the contrary, utilize the disclosed dna sequence dna of this paper, also can be by means commonly known in the art; For example method (molecular cloning, press of cold spring harbor laboratory, the New York of Sambrook etc.; The U.S., second edition, 1989) carry out; Through revising nucleotide sequence provided by the invention, obtain and the active consistent aminoacid sequence of 3alpha-Hydroxysteroid dehydrogenase according to the invention.
Under the preferable case, nucleotides sequence according to the invention is classified as
(1) nucleotide sequence shown in the SEQ ID NO:2; Perhaps
(2) nucleotide sequence shown in the SEQ ID NO:2 is carried out that one or several Nucleotide replaces and the nucleotide sequence of the codon same sense mutation that obtains.
Said nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:2 or the SEQ ID NO:3 more preferably.Said nucleotide sequence most preferably is the nucleotide sequence shown in the SEQ ID NO:3.Nucleotide sequence shown in the SEQ ID NO:3 that contriver of the present invention finally confirms through a large amount of experiments, owing to possibly more meet the for example codon preference of colibacillary genetic engineering bacterium, thereby more help genetic engineering bacterium expressing protein product.
Nucleotide sequence provided by the invention can use the method for pcr amplification method, recombination method or synthetic to obtain usually.For example, those skilled in the art can be easy to obtain template and primer according to nucleotide sequence provided by the present invention and recombinant bacterial strain, utilize PCR to increase and obtain relevant sequence.When sequence is longer, can carry out twice or pcr amplification repeatedly, then the gained fragment pressed the proper order splicing.In case obtained relevant nucleotide sequence, just can use the relevant aminoacid sequence of the large batch of acquisition of recombination method.Usually the gained nucleotide sequence is cloned into carrier, again in the transgene engineering bacteria, the host cell of the method through routine after the propagation separates and obtains relevant nucleotide sequence then.In addition, also the method for available known artificial chemosynthesis is synthesized relevant nucleotide sequence.
The present invention also provides the recombinant vectors that comprises nucleotide sequence according to the invention.Known in this field, said recombinant vectors generally comprises empty carrier and the goal gene that inserts this empty carrier, and said goal gene is the nucleotide sequence of 3alpha-Hydroxysteroid dehydrogenase of the present invention.
In the present invention; The various carriers of oneself knowledge of this area can be selected for use in said " empty carrier " (or title " carrier "); Like commercially available various plasmids, clay, phage and retrovirus etc., the preferred pET28b of the present invention (+) plasmid, pET30a, pMAL-c2x, pMD18-T or pUC19.Said empty carrier can comprise multiple certification mark commonly used (for example reporter gene such as fluorescent mark, antibiotic marker) and restriction enzyme site.Construction of recombinant vector can adopt the various endonucleases of the MCS of empty carrier own (as for pUC18; Available Sal I, BamH I, EcoR I etc.; For pET28a, available Ndel, XhoI, Nhel, EcoR I, BamH, HindIII etc. can use EcoR I, Nde I, BamH, HindIII etc. for pET28b) carry out enzyme and cut the acquisition linear plasmid; Be connected with the gene fragment that adopts the cutting of identical nucleic acid restriction endonuclease, obtain recombinant plasmid.Preferred said recombinant vectors is pET28b-3 α-HSD (C61S) or pET30a-3 α-HSD (C61S) or pMAL-c2x-3 α-HSD (C61S) (seeing preparation embodiment 1-4).The present invention preferably adopts NdeI and XhoI double digestion pET28b and connected PCR product fragment, and linked enzyme connects, and makes up recombinant vectors pET28b-3 α-HSD of the present invention (C61S).
The present invention also provides the recombinant host cell that comprises recombinant vectors according to the invention.
Can said recombinant vectors be transformed, transduce perhaps transfection in host cell through the conventional method in this area, transform like Calcium Chloride Method chemical conversion, high-voltage electric shock, preferred electric shock transforms; Said host cell can be prokaryotic cell prokaryocyte or eukaryotic cell; Be preferably intestinal bacteria, Bacillus subtilus, yeast (like pichia spp) or various animal and plant cells; More preferably said host cell is this area genetic engineering bacterium commonly used, like intestinal bacteria, subtilis or pichia spp.Most preferably said host cell is e. coli jm109, e. coli bl21 (DE3), intestinal bacteria Rosetta (DE3) or bacillus coli DH 5 alpha.
Can use this area method commonly used from recombinant host cell, to separate and the purifying 3alpha-Hydroxysteroid dehydrogenase.For example, spinning substratum and recombinant host cell, cell debris, affinitive layer purification 3alpha-Hydroxysteroid dehydrogenase are removed in high-pressure homogenization smudge cells, centrifuging.For the product of the 3alpha-Hydroxysteroid dehydrogenase of separation and purification gained, can use this area method commonly used to carry out purity and identify.For example, Xylene Brilliant Cyanine G method, nitrogen determination, biuret method, lowry method, ultraviolet absorption method, affinity chromatography, enzymic activity, antigen-antibody method, electrophoretic analysis (for example sodium dodecyl sulfate-polyacrylamide gel electrophoresis), sedimetry, diffusion analysis, permanent solubility method, protein spectrum etc.
The present invention also provides at least a test kit that comprises in 3alpha-Hydroxysteroid dehydrogenase of the present invention, nucleotide sequence, recombinant vectors and the recombinant host cell.Under the preferable case, test kit of the present invention comprises 3alpha-Hydroxysteroid dehydrogenase, and do not comprise nucleotide sequence, recombinant vectors and recombinant host cell.Test kit more preferably of the present invention comprises the dry powder of 3alpha-Hydroxysteroid dehydrogenase, and does not comprise nucleotide sequence, recombinant vectors and recombinant host cell.The dry powder that can prepare 3alpha-Hydroxysteroid dehydrogenase with this area method commonly used, as long as this method can access the dry powder of 3alpha-Hydroxysteroid dehydrogenase, and the activity of not destroying the dry powder of 3alpha-Hydroxysteroid dehydrogenase gets final product.For example use the vacuum decompression thickener to obtain spissated enzyme liquid, use the dry spissated enzyme liquid of freeze drier then; Perhaps use equipment such as vacuum decompression moisture eliminator.Because 3alpha-Hydroxysteroid dehydrogenase good heat resistance of the present invention can also use spray-dired technology to obtain the dry powder of this enzyme.Be converted into liquid form in the buffer solution system (for example trolamine damping fluid, phosphate buffered saline buffer, preferred pH is 7.6-8) that the dry powder of 3alpha-Hydroxysteroid dehydrogenase in use can be through being dissolved in pH7.5-10.
Test kit of the present invention can also comprise that this area is usually used in the composition of the test kit of detection bile acide concentration.Corresponding to the 3alpha-Hydroxysteroid dehydrogenase in the test kit of the present invention can be liquid form and/or solid dry powder form, and other compositions in the test kit of the present invention also can be liquid form and/or solid dry powder form.For example, when test kit of the present invention is liquid form, generally can contain reagent one (R1) and reagent two (R2); Wherein, said reagent one can comprise the 0.2-5g/L oxidized form β-Thionicotinamide adenine dinucleotide (Thio-NAD) in 50-200mmol/L2-(N-morpholino) the ethyl sulfonic acid damping fluid (MES damping fluid) that is dissolved in pH 3.5-4.5; Said reagent two can contain reduced form β-Thionicotinamide adenine dinucleotide (Thio-NADH) of the 2-10g/L in 50-200mmol/L 3-(the hexahydroaniline)-2-hydroxyl-1-propanesulfonic acid damping fluid (CAPSO damping fluid) that is dissolved in pH 9.0-11.0, the NaN of 0.1-10mmol/L
33alpha-Hydroxysteroid dehydrogenase with 2-20KU/L.Under the preferable case, said reagent one can comprise the 1-1.5g/L oxidized form β-Thionicotinamide adenine dinucleotide in 55-75mmol/L 2-(N-morpholino) the ethyl sulfonic acid damping fluid that is dissolved in pH 4; Said reagent two can contain reduced form β-Thionicotinamide adenine dinucleotide of the 4-7g/L in 55-75mmol/L 3-(the hexahydroaniline)-2-hydroxyl-1-propanesulfonic acid damping fluid that is dissolved in pH 9.0, the NaN of 0.5-1.0mmol/L
33alpha-Hydroxysteroid dehydrogenase with 5-10KU/L.
Above-described reagent one can pass through Freeze Drying Technique respectively with reagent two, in conjunction with reduced pressure distillation technique, reverse osmosis technology and ultra-filtration technique etc., is prepared into reagent one dry powder (wherein comprising G6PDH dry powder of the present invention) and reagent two dry powder.Said dry powder can redissolve to original volume of said reagent with the solvent that is selected from deionized water, zero(ppm) water and distilled water before detecting sample to be measured.Therefore test kit of the present invention can comprise the reagent one and reagent two of liquid form; The reagent two that perhaps can comprise reagent one dry powder and liquid form; The reagent one and reagent two dry powder that perhaps can comprise liquid form perhaps can comprise reagent one dry powder and reagent two dry powder of solid form.
During bile acide in detecting sample to be measured, be that 1: 100 to 1: 10 sample to be measured (or bile acide calibration solution) mixes with reagent one with volume ratio earlier, 37 ℃ be incubated 300 seconds down after, adding reagent two in mixture.Said bile acide calibration solution can be the bile aqueous acid.37 ℃ of insulations in the time of 60 seconds down, through spectrophotometer record absorbancy numerical value A1, absorbancy numerical value A2 is write down in after measuring A1 the 180th second under 405nm with the mixed solution of gained reagent one, reagent two and sample to be measured (or bile acide calibration solution).According to the concentration of calculating bile acides with following formula two:
Wherein, Δ A=A2-A1, i.e. Δ A
Sample=A2
Sample-A1
Sample, Δ A
Calibration=A2
Calibration-A1
Calibration
Usually adopting two kinds of calibration solutions is that zero(ppm) water and bile acide concentration are the high value calibration liquid of 40-50 μ mol/L.Said high value calibration liquid preferably can be the bile acide solution of 44 μ mol/L.The Schwellenwert of said high value calibration liquid must not be lower than 30 μ mol/L mxm.s must not be higher than 60 μ mol/L.When using test kit of the present invention, the general accessible measurement of concetration of bile acide accurately scope is 0-200 μ mol/L, preferred 5-150 μ mol/L.Test kit of the present invention can comprise the specification sheets that records above-mentioned various component method of use and consumption.Therefore, said reference liquid also can not be provided in the test kit, is prepared according to prior art according to the record of test kit specification sheets before use by the user to get final product.
Test kit of the present invention can comprise the specification sheets that records above-mentioned various component method of use and consumption.Therefore, said solution also can be prepared according to prior art according to the record of test kit specification sheets before use by the user and get final product.
The sample to be measured that is suitable for using test kit according to the invention can be animal body (comprising human body) serum and with kin other body fluid of serum.
Further specify the present invention below in conjunction with embodiment, the used reagent of the present invention, substratum are the commercial goods unless stated otherwise.
Preparation embodiment 1
(1) parent's 3alpha-Hydroxysteroid dehydrogenase gene is synthetic
With pseudomonas putida (Pseudomonas putida ATCC12633) with 1 * 10
5The inoculum size of cells/ml uses liquid LB substratum to cultivate 16 hours 26 ℃ of speed oscillations with 160rpm, reaches 1 * 10 to the cell concn of pseudomonas putida
9Cells/ml.Said LB substratum comprises the peptone of 10g/L, the yeast powder of 5g/L and the NaCl of 10g/L, and surplus is a water, and pH is 7.0, and through sterilizing 20 minutes down at 121 ℃.
Get 1.5 milliliters of above-mentioned gained cultures, at room temperature, abandon supernatant with the centrifugal 5min of 8000rpm.Gained deposition is suspended in the TE damping fluid of 1ml pH8.0 in (TE is the Tris-EDTA damping fluid) again.The N,O-Diacetylmuramidase that adds 6 μ l 50mg/ml, 37 ℃ act on 2 hours down, add the NaCl 50 μ l of 2mol/L, the 110 μ l of 10%SDS and the Proteinase K 3 μ l of 20mg/ml again, act on 15min down at 50 ℃ then.Then gained bacterium liquid is all forwarded in the centrifuge tube that specification is 10ml, in each centrifuge tube, add isopyknic phenol: chloroform: primary isoamyl alcohol (volume ratio 25: 24: 1) mixed solution, place 5min behind the mixing.At the centrifugal 10min of 12000rpm, draw supernatant.Resuspended more than the repetition, add that phenol chloroform isoamyl alcohol, mixing leave standstill, centrifugal and twice of the process of collecting supernatant.The supernatant that merges three collections, the Virahol of 0.6 times of volume of adding in the supernatant of this merging, mixing, room temperature is placed 10min.Centrifugal 10min under 12000rpm, deposition with 75% washing with alcohol, airing after, obtain the pseudomonas putida genomic dna, be dissolved in 50 μ lddH
2Among the O.
To obtain the genomic dna 1 μ g of pseudomonas putida and the plasmid pUC19 of 0.5 μ g cut 1 hour at 37 ℃ of following enzymes with Ava I respectively simultaneously with above-mentioned steps, place 10min with deactivation Ava I enzyme 65 ℃ of water-baths then.Both are connected 12 hours with the T4 ligase enzyme down at 37 ℃; The pcr amplification gene product that obtains is separated with 1% agarose gel electrophoresis; And reclaim the recombinant plasmid that load has foreign gene with QIA rapid extraction gel reagents box (fast and smart company (QIAGEN), Germany).From the e. coli jm109 of gained recombinant plasmid transformed competence colibacillus, filter out then and have the active clone of the 3alpha-Hydroxysteroid dehydrogenase of producing.Concrete operations are following:
Picking is 37 ℃ of single bacterium colonies of cultivating 16 hours e. coli jm109 on the LB solid medium, in liquid LB substratum, cultivate 16 hours at 37 ℃, the shaking table of 150rpm again.Get 1ml gained liquid culture and transfer in 100ml fresh liquid LB substratum, the rotating speed thermal agitation with 250-300rpm on 37 ℃ of shaking tables was cultivated 2.5 hours.Draw the cultured bacterium liquid of 1.5ml to the 1.5ml centrifuge tube, in cooled on ice after 10 minutes, under 4 ℃, 3000g centrifugal 5 minutes.Supernatant discarded adds the CaCl of 100 μ l at the 0.1mol/L of precooling on ice
2Solution is inhaled moving beating gently up and down with liquid-transfering gun and is spared, and re-suspended cell was placed 20 minutes at ice.Under 4 ℃, 3000g centrifugal 5 minutes then, supernatant discarded added the CaCl of 100 μ l at the 0.1mol/L of precooling on ice
2Solution is inhaled moving beating gently up and down with liquid-transfering gun and is spared, and re-suspended cell obtains competent host cell.
Get the above-mentioned competent e. coli jm109 of 200 μ l and place the 1.5ml centrifuge tube, the adding volume is that the pUC19 recombinant plasmid solution (wherein pUC19 recombinant plasmid content is 40ng) of 10 μ l shakes up gently, places on ice 30 minutes.Thermal shock 90 seconds in 42 ℃ of water-baths then placed cooled on ice rapidly 5 minutes then.In centrifuge tube, add 1ml LB liquid nutrient medium (not containing penbritin), 37 ℃ of shaking culture are 1 hour behind the mixing, make bacterium the restore normal growth state and the penbritin antibiotics resistance gene (Ampr) of expression plasmid coding.Getting 100 μ l after above-mentioned bacterium liquid shaken up coats on the LB screening flat board that contains penbritin, 100mg/L androsterone, 10mM Thionicotinamide-NAD, 200U/ml diaphorase and 2g/L chlorination nitro tetrazole; Face up and place half a hour; Treat that bacterium liquid is absorbed the back by substratum fully and is inverted petridish, cultivated 20 hours for 37 ℃.On the screening flat board, colibacillary bacterium colony occurred, promptly the pUC19 recombinant plasmid has been converted in the escherichia coli jm109 competent cell; And there is clone, the e. coli jm109 of the recombinant plasmid that has obtained including the whole gene of 3alpha-Hydroxysteroid dehydrogenase is described with variable color circle.
Picking has the clone of variable color circle, in 37 ℃ of following LB substratum, cultivates after 18 hours, extracts its DNA.Contriver of the present invention has designed forward primer G1:GGAATTCCATATGAGCATCATCGTG, and adding on it has the NdeI restriction enzyme site; Reverse primer G2:CCGCTCGAGTCAGAACTGGGTC, adding on it has Xho I restriction enzyme site.
DNA with said extracted is a template, the parental gene of pcr amplification 3alpha-Hydroxysteroid dehydrogenase.The pcr amplification condition is: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH
4)
2SO
4, 2mM MgSO
4, 0.1%Triton X-100,50 μ M dATP, 50 μ M dGTP, 50 μ M dTTP, 50 μ MdCTP, 400nM primer G1,400nM primer G2,1.5U Pfu archaeal dna polymerase (Promega; USA); 20ng DNA template adds reaction system, transfers to reaction volume with sterilized water and reaches 50 μ L.
The pcr amplification reaction program is: above-mentioned reaction system 95 ℃ of down reactions 5 minutes, is carried out 30 round-robin " 95 ℃ 45 seconds, 55 ℃ 30 seconds and 72 ℃ 1 minute 30 seconds " then, kept 10 minutes down at 72 ℃ at last.The pcr amplification gene product that obtains is separated with 1% agarose gel electrophoresis, and reclaim the dna fragmentation of the single band in the 750-800bp left and right sides with QIA rapid extraction gel reagents box (fast and smart company (QIAGEN), Germany).
Gained DNA is checked order with the full-automatic dna sequencing appearance of 310 types of u.s.a. applied biosystem company; The sequencing result analysis obtains: length is the protein coding gene of 789bp (originate in initiator codon atg and end at terminator codon tga), i.e. nucleotide sequence shown in the SEQ ID NO:5.
The acquisition of (2) 3 α-HSD two mutants (C61S) goal gene
Contriver of the present invention has related to following mutant primer again:
FF：CATATGAGCACCTACGCCATCAG
R61：GCCCTTGCTAGACTTGCTC
F61:CTGAGCAAGTCTAGCAAGGG and
RR：GAGCTATCAGAAGCTGTTGGCGCGC
The parent 3 α-HSD that obtains with (1) is a template, utilizes primer to FF and R61, and pcr amplification goes out fragment FFR61 (192bp).
The parent 3 α-HSD that obtains with (1) is a template, utilizes primer to RR and F61, and pcr amplification goes out fragment F61RR (618bp).
Mixture with above-mentioned FFR61 (192bp) and F61RR (618bp) is a template, utilizes primer to FF and RR, carries out pcr amplification.
Amplification condition is: 20mM Tris-HCl (pH 8.8), 10mM KCl, 10mM (NH
4)
2SO
4, 2mMMgSO
4, 0.1%Triton X-100,50 μ M dATP, 50 μ M dGTP, 50 μ M dTTP, 50 μ M dCTP, 400nM primer G1 and 400nM primer 2 40SR (perhaps 400nM primer 2 40SF and 400nM primer G2), 1.5U Pfu archaeal dna polymerase (Promega; USA), 20ng template fragment, transfer to reaction volume with sterilized water and reach 50 μ L.
The pcr amplification reaction program is: above-mentioned reaction system 95 ℃ of down reactions 5 minutes, is carried out 30 round-robin " 95 ℃ 45 seconds, 55 ℃ 30 seconds and 72 ℃ 45 seconds " then, kept 10 minutes down at 72 ℃ at last.
Separate through 1% agarose gel electrophoresis, and (QIAGEN German) reclaims, and obtains the full-length gene order of two mutants 3 α-HSD (C61S) with QIAquick Extraction Gel Kit.Two mutants 3 α-HSD (C61S) is connected to carrier pMD18-T, gets plasmid pMD18-T-two mutants 3 α-HSD (C61S), transform host e. coli DH5 α, use the LB culture medium culturing.37 ℃ cultivate 18 hours after, extract DNA pMD18-T-parent 3 α-HSD, cut and agarose gel electrophoresis separates the back and obtains the dna fragmentation that increases through enzyme.
The gained dna fragmentation is checked order with the full-automatic dna sequencing appearance of 310 types of u.s.a. applied biosystem company; Sequencing result shows: containing length in the gained dna fragmentation is the protein coding gene of 789bp (originate in initiator codon atg and end at terminator codon taa); Confirm that through dna sequencing the catastrophe point of introducing is errorless, detailed sequence is shown in SEQ ID NO:2.
(3) make up recombinant vectors
Cut the protein coding gene that (2) obtain with restriction enzyme NdeI and XhoI enzyme, enzyme is cut the big fragment of gained through using the T4DNA ligase enzyme, is connected to equally on the empty carrier pET28b (+) that cut with restriction enzyme NdeI and XhoI enzyme.The ligation product reclaims at agarose gel electrophoresis and is purified into the single band ring-type dna fragmentation about 6.0-6.1kb, proves to have obtained recombinant expression vector pET28b-3 α-HSD (C61S).Said recombinant expression vector pET28b-3 α-HSD (C61S) preserves in pH is the tris damping fluid of 7 50mmol/L.
(4) recombinant vectors is to the conversion of host cell and the cultivation of gained recombinant host cell
Picking is 37 ℃ of single bacterium colonies of cultivating 16 hours e. coli bl21 (DE3) on the LB solid medium, in liquid LB substratum, cultivate 16 hours at 37 ℃, the shaking table of 150rpm again.Get 1ml gained liquid culture and transfer in 100ml fresh liquid LB substratum, the rotating speed thermal agitation with 250-300rpm on 37 ℃ of shaking tables was cultivated 2.5 hours.Draw the cultured bacterium liquid of 1.5ml to the 1.5ml centrifuge tube, in cooled on ice after 10 minutes, under 4 ℃, 3000g centrifugal 5 minutes.Supernatant discarded adds the CaCl of 100 μ l at the 0.1mol/L of precooling on ice
2Solution is inhaled moving beating gently up and down with liquid-transfering gun and is spared, and re-suspended cell was placed 20 minutes at ice.Under 4 ℃, 3000g centrifugal 5 minutes then, supernatant discarded added the CaCl of 100 μ l at the 0.1mol/L of precooling on ice
2Solution is inhaled moving beating gently up and down with liquid-transfering gun and is spared, and re-suspended cell obtains competent host cell.
Get the above-mentioned competent e. coli bl21s of 200 μ l (DE3) and place the 1.5ml centrifuge tube, the adding volume is that pET28b-3 α-HSD (C61S) solution (wherein pET28b-3 α-HSD (C61S) content is 40ng) of 10 μ l shakes up gently, places on ice 30 minutes.Thermal shock 90 seconds in 42 ℃ of water-baths then placed cooled on ice rapidly 5 minutes then.In centrifuge tube, add 1ml LB liquid nutrient medium (not containing kantlex), 37 ℃ of shaking culture are 1 hour behind the mixing, make bacterium the restore normal growth state and the kantlex antibiotics resistance gene (Kan Resistant) of expression plasmid coding.Get 100 μ l after above-mentioned bacterium liquid shaken up and coat on the LB screening flat board that contains Kan, face up and place half a hour, treat that bacterium liquid is absorbed the back by substratum fully and is inverted petridish, cultivated 20 hours for 37 ℃.Colibacillary bacterium colony has appearred on the screening flat board; Be that pET28b-3 α-HSD (C61S) has been converted in e. coli bl21 (DE3) competent cell, obtained the recombinant host cell of present embodiment---e. coli bl21 (DE3)-pET28b3 α-HSD (C61S).
Preparation 3L LB substratum joins in the 5L fermentor tank, 121 ℃ of sterilizations 15 minutes, adds kantlex after being cooled to room temperature fully, and making its final concentration is 50 μ g/mL.In the gained substratum, add above-mentioned e. coli bl21 (DE3)-pET28b3 α-HSD (C61S) (10 that 60mL grows to logarithmic phase
6Cells/ml).The cell density that under 37 ℃, is cultured in the fermented liquid sampling reaches 107 cells/ml.Being transferred to the LB substratum that 100mL contains 1mM IPTG (isopropyl-) with 5% inoculum size then induced 4 hours for 37 ℃.
(5) separation of protein product is purified
With fermented liquid centrifugal 15min under 8000rpm that (4) obtain, collect the recombinant host cell deposition.Supernatant discarded is resuspended in the gained recombinant host cell in the Tris-HCl solution that isopyknic pH is 7.5 50mmol/L.With the resuspended cell of high-pressure homogenization crusher machine, centrifugal 15min under 10000rpm collects the supernatant crude enzyme liquid, abandons or adopts the cell debris deposition.
After using the aperture to be 0.22 μ m membrane filtration the above-mentioned gained crude enzyme liquid, gained filtrating is carried out affinity chromatography on An Keta purifying person (AKTA Purifier) the nickel affinity chromatography post of AM General electronics corporation (GE company).Wherein, sample-loading buffer is that the pH of 50mmol/L is 7.5 Tris-HCl damping fluid.Behind the sample-loading buffer that flows through two column volumes, use elution buffer, it is that the pH that contains the 50mmol/L of 0.5mol/L imidazoles is 7.5 Trsi-HCl damping fluid.When imidazole concentration reaches 0.3mol/L, begin to collect albumen, collect the unimodal end of albumen that real-time monitors.
In the protein solution of collecting, add 40% (W/V) ammonium sulfate precipitation, under the rotating speed of 10000rpm centrifugal 10 minutes then.Collect albumen precipitation, and the pH of use 0.1mol/L is 7.5 Trsi-HCl damping fluid redissolution.After gained solution used the aperture to be the membrane filtration of 0.22 μ m, gained filtrating was used 100ml sephadex G-25 chromatography column (Sephadex G-25) desalination again.The pH that said desalination damping fluid is 0.1mol/L is 7.5 Trsi-HCl damping fluid.Appearance on the good chromatography column of desalination damping fluid balance; Wherein the flow velocity of sample solution (pH that is the above-mentioned 0.1mol/L of use is the protein solution that 7.5 Trsi-HCl damping fluid redissolves) is 8ml/min; Applied sample amount 20ml uses desalination damping fluid 5 column volumes of flow velocity wash-out with 10ml/min then.Totally 500 milliliters of liquid under the collection wash-out.
Collected liquid in general refrigerator-10 ℃ freezing 2 hours down; And then-40 ℃ of deep cooling refrigerator pre-freezes 8 hours; In the ALPHA 1-4 of German Ke Ruisite (CHRIST) LSC type freeze drier, with the condition freeze-drying of vacuum tightness 0.04mbar, safe pressure 0.100mbar and condenser temperature-60 ℃ 10 hours.Waiting temperature of charge and Freeze Drying Equipment baffle temperature difference then is zero, and observes 15 seconds internal pressures and indicate when constant, finishes freeze-drying.The proteinic amount of freeze-drying gained is 8.6 grams.Lyophilized protein seals preservation in normal temperature dryer.
Adopt " molecular cloning " (Sambrook etc., press of cold spring harbor laboratory, New York; The U.S.; The third edition, 2002, volume two 1713-1722 appendix 8 Science Presses) the electrophoretic method of SDS-PAGE of the record proteinic molecular weight that determines present embodiment is about 66.2KD.And according to " biological chemistry " (Wang Jingyan etc.; Higher Education Publishing House; 2002; See 168 pages) measuring method (behind the enzymolysis divide peptide section measure) of the prlmary structure of protein of record, the protein that records present embodiment has 262 amino-acid residues (referring to the aminoacid sequence shown in the SEQ ID NO:1), with consistent by the nucleotide sequence coded proteinic result shown in the SEQ ID NO:2.Wherein, the aminoacid sequence shown in aminoacid sequence shown in the SEQ ID NO:1 and SEQID NO:4 difference is: the Cys on the 61st of the SEQ ID NO:4 is replaced by Ser.Wherein, Those skilled in the art are through reading present embodiment; Can know for example SEQ ID NO:2 of nucleotide sequence of the present invention, and can obtain said nucleotide sequence through chemical synthesis process, therefore can be after obtaining having the nucleic acid of this nucleotide sequence; Need not to implement present embodiment (1)-(2) step, begin the repetition present embodiment but directly go on foot from present embodiment (3).
(6) enzyme mensuration alive
Measuring enzyme according to following method lives:
Reagent 1:0.2M Tris-HCl PH 8.0
10mM NAD solution 0.05ml
0.25% (W/V) chlorination nitro tetrazole (NTB) solution 0.05ml
100U/ml diaphorase solution (DI) 0.025ml
2％(W/V)Triton X-100 0.10ml
Zero(ppm) water is settled to 0.5ml
Reagent 2:11.5g/ml androsterone (the 23mg androsterone is dissolved in the 2ml anhydrous methanol).
Enzyme diluent: 10mM Tris-HCl damping fluid (pH 8.0)
Concrete steps: in cuvette, add 0.5ml reagent 1,20 μ l enzyme liquid successively, 37 ℃ of temperature were bathed 5min minute, added reagent then and measured the variation of writing down this process numerical value 5 minutes for 2,37 ℃.Promptly measure the variation of 550nm place absorbancy.
The enzyme definition of living: at 25 ℃, pH 8.9 and when having NAD, PM is changed the required enzyme amount of 1 μ mol androsterone.
Formula is calculated in enzyme work
Δ A: absorbancy changes
16.7:NTBH
2(androsterone) is at 550nm optical extinction coefficient (cm
2/ μ mole)
5: the reaction times (min)
3.045: final volume (ml)
0.02: enzyme liquid amasss (ml)
X: contained enzyme amount (mg/ml) in the enzyme liquid.
Test result sees the following form 1.
To sum up, contriver of the present invention has obtained a kind of new 3alpha-Hydroxysteroid dehydrogenase, and its molecular weight is about 28KD, has the nucleotide sequence shown in aminoacid sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2.
Preparation embodiment 2
According to SEQ ID NO:3 the nucleotide sequence shown in the SEQ ID NO:2 is carried out rite-directed mutagenesis, obtain the same sense mutation nucleotide sequence of the nucleotide sequence shown in the SEQ ID NO:2.Then the nucleotide sequence that obtains is connected on pET28b (+) empty carrier according to the method for preparing embodiment 1, also is transformed in the e. coli bl21 (DE3).Cultivate the gained recombinant host cell under the same conditions, the 3alpha-Hydroxysteroid dehydrogenase rate ratio of present embodiment prepares embodiment 1 and has improved 14.5% as a result.
Preparation embodiment 3
Nucleotide sequence shown in the SEQ ID NO:2 is connected on the pET30a empty carrier according to the method for preparing embodiment 1, is transformed among the intestinal bacteria Rosetta (DE3).Cultivate the gained recombinant host cell under the same conditions, the 3alpha-Hydroxysteroid dehydrogenase that the result obtains, the output of its 3alpha-Hydroxysteroid dehydrogenase remains basically stable with preparation embodiment 1.
Preparation embodiment 4
SEQ ID NO:3 is connected on the pMAL-c2x empty carrier according to the method for preparing embodiment 1, is transformed in " bacillus coli DH 5 alpha ".Cultivate the gained recombinant host cell under the same conditions, the 3alpha-Hydroxysteroid dehydrogenase that the result obtains, the output of its 3alpha-Hydroxysteroid dehydrogenase remains basically stable with preparation embodiment 1.
Comparative Examples 1
This Comparative Examples is the 3alpha-Hydroxysteroid dehydrogenase that Asahi Kasei Corporation produces.
Test implementation example 1
3alpha-Hydroxysteroid dehydrogenase according to method test preparation embodiment 2-4 for preparing embodiment 1 record and Comparative Examples 1 is active:
Table 1
| 3alpha-Hydroxysteroid dehydrogenase | Preparation embodiment 1 | Preparation embodiment 2 | Preparation embodiment 3 | Preparation embodiment 4 | Comparative Examples 1 |
| Enzyme (U/mg) alive | 50 | 55 | 48 | 45 | 30 |
Can know by above result; The 3alpha-Hydroxysteroid dehydrogenase enzyme activity of preparation embodiment 1-4 is compared on the same order of magnitude with Comparative Examples 1, can satisfy the requirement to 3alpha-Hydroxysteroid dehydrogenase of the test kit of measuring bile acide concentration in the sample to be measured clinically fully.
Test implementation example 2
The thermostability for preparing the 3alpha-Hydroxysteroid dehydrogenase of embodiment 1-4 and Comparative Examples 1 according to following method test:
The 300U enzyme lived, and to be dissolved in pH value be in 8.0 the 20mM phosphoric acid buffer for the 3alpha-Hydroxysteroid dehydrogenase dry powder of unit; Under 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, kept 15 minutes respectively, active according to the residual ratio of 3 α-HSD after the activity test method mensuration heat treated of the 3 α-HSD among the preparation preparation embodiment 1 at last.Ratio percentage ratio by remaining enzyme is lived and maximum remaining enzyme is lived is ordinate zou, and temperature is the X-coordinate curve plotting.The heat stability testing result of preparation embodiment 1 (aminoacid sequence that obtains of preparation embodiment 2-4 coding is identical with preparation embodiment 1) is as shown in Figure 1, and 1 heat stability testing result is as shown in Figure 3 for Comparative Examples.Through relatively, prepare the thermostability (not shown) test result of embodiment 2-4 and prepare the basic identical of embodiment 1.
As can be seen from the figure; As can be seen from Figure 1; The 3alpha-Hydroxysteroid dehydrogenase of preparation embodiment 1 is at 60 ℃ of relative reactivities that all have more than 80%, apparently higher than the relative reactivity (only having 30%) of the 3alpha-Hydroxysteroid dehydrogenase of under the same conditions Comparative Examples 1 (referring to Fig. 3).
Test implementation example 3
The optimum temperuture for preparing the 3alpha-Hydroxysteroid dehydrogenase of embodiment 1-4 and Comparative Examples 1 according to following method test:
It is in 8.0 the 20mM phosphoric acid buffer that the 3alpha-Hydroxysteroid dehydrogenase dry powder of 500U is dissolved in pH value; Respectively 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃ held 5 minutes, it is active to measure after the heat treated residual ratio of 3 α-HSD according to the activity test method of the 3 α-HSD among the preparation embodiment 1 at last.Ratio percentage ratio by remaining measurement enzyme is lived and maximum remaining enzyme is lived is ordinate zou, and temperature value is the X-coordinate curve plotting.The optimum temperuture test result of preparation embodiment 1 (aminoacid sequence that obtains of preparation embodiment 2-4 coding is identical with preparation embodiment 1) is as shown in Figure 2, and Comparative Examples 1 optimum temperuture test result is as shown in Figure 4.Through relatively, prepare the thermostability (not shown) test result of embodiment 2-4 and prepare the basic identical of embodiment 1.
As can be seen from the figure, as can be seen from Figure 1, the optimum temperuture of preparation embodiment 1-4 is significantly higher than Comparative Examples 1, and as can be seen from the figure, the optimum temperuture of preparation embodiment 1-4 can keep stable in multiple high-temperature severe environment significantly greater than Comparative Examples 1.And the data of associative list 1 can know, even the enzymic activity of preparation embodiment drops to the about 90% of optimum temperuture in the time of 50 ℃, its vigor still is higher than the synthermal enzymic activity of Comparative Examples 1 down.
Preparation embodiment 5-8
Formulated reagent one and reagent two according to table 2:
Table 2
The reagent one for preparing embodiment 5 and 6 is mixed with liquid form respectively with reagent two and gets final product.The reagent one and reagent two lyophilize under following condition respectively that prepare embodiment 7 and 8 :-10 ℃ were descended freezing 2 hours in general refrigerator; And then-40 ℃ of deep cooling refrigerator pre-freezes 8 hours; In the ALPHA 1-4 of German Ke Ruisite (CHRIST) LSC type freeze drier, with the condition freeze-drying of vacuum tightness 0.04mbar, safe pressure 0.100mbar and condenser temperature-60 ℃ 10 hours.Waiting temperature of charge and Freeze Drying Equipment baffle temperature difference then is zero, and observes 15 seconds internal pressures and indicate when constant, finishes freeze-drying.The reagent dry powder that freeze-drying obtains can redissolve into the volume of primary liquid form before use with zero(ppm) water.The reagent dry powder that freeze-drying obtains, longer than the time that the reagent of liquid form is preserved, packing instructions are lower, and volume is littler, and it is easier to transport.Used 3 α-HSD is respectively the 3 α-HSD that obtains among the preparation embodiment 1-4 among the preparation embodiment 5-8.Preparation embodiment 5-8 has the high value calibration liquid that bile acide concentration is 100mmol/L.
Comparative Examples 2
According to becoming the test kit of liquid form with preparation embodiment 5 identical formulated.Used 3 α-HSD is the 3 α-HSD of Comparative Examples 1 in the Comparative Examples 2.
Test implementation example 4
This test implementation example has been measured two samples to be measured: one is the bile acide aqueous solution (chemical preparation standard substrate solution) of 90 μ mol/L of preparation; Another is 26 years old male sex's being in a good state of health a serum sample to be measured, extracts its 10ml blood, leaves standstill to the hemocyte precipitated and separated, gets upper serum 5ml and is used for the test kit of preparation embodiment 5-8 and Comparative Examples 2 is tested.
The test kit method of use is following:
SBA is measured the record of (TBA) test kit specification sheets: reagent 1 (R1) 270 μ l, reagent 2 (R2) 90 μ l, specimen amount (S) 4 μ l.S+R1 adds R2 37 ℃ of insulations 5 minutes; S+R1+R2 behind the record absorbance A1, writes down absorbance A2 37 ℃ of insulations 60 seconds after 180 seconds.Predominant wavelength 405nm, commplementary wave length 660nm.Wherein, blank sample is a zero(ppm) water, and high value calibration liquid is the bile acide solution of 44 μ mol/L.According to the concentration of formula two calculating bile acides, test result is seen table 3.
Table 3
Can find out by table 3, the test kit test result of preparation embodiment 5-8 than Comparative Examples 2 more near actual value; And the test kit test result standard deviation of preparation embodiment 5-8 is significantly less than Comparative Examples 2, explains that test kit performance of the present invention is more stable, and it is more accurate to measure.
Sequence table
< 110>Beijing Leaderman Biochemistry Co., Ltd
< 120>3-hydroxysteroid dehydrogenase and nucleotide sequence thereof, recombinant vectors, recombinant host cell and test kit
<130>OICN093789
<160>5
<170>PatentIn version 3.4
<210>1
<211>262
<212>PRT
<213>Pseudomonas putida
<400>1
Met Ser Thr Tyr Ala Ile Ser Gly Ser Ala Thr Gly Ile Gly Ala Ala
1 5 10 15
Val Arg Gln Lys Leu Glu Ala Ala Gly His Thr Ile Val Thr Ile Asp
20 25 30
Ile Arg Asp Ala Glu Lys Phe Ile Leu Ala Asp Leu Ser Thr Ala Glu
35 40 45
Gly Arg Ala Gln Ala Ile Ala Arg Val Leu Ser Lys Ser Ser Lys Gly
50 55 60
Leu Asp Gly Ala Val Leu Cys Ala Gly Leu Gly Pro Ser Pro Gln Arg
65 70 75 80
Lys Val Leu Gly Asn Ile Val Ala Val Asn Tyr Phe Gly Val Val Glu
85 90 95
Leu Leu Thr Ala Trp Leu Pro Ala Leu Ala Ala Ala His Gln Pro Ala
100 105 110
Ala Val Val Ile Ser Ser Val Ala Ala Thr Gln Leu Ala Ala Asp Pro
115 120 125
Asn Pro Ile Ile Asn Ala Leu Leu Ala His Asp Glu Ala Ala Lys Ala
130 135 140
Arg Ala Ile Val Glu Leu Ala Gly Pro Gln Gln Ile Ala Tyr Ala Gly
145 150 155 160
Ser Lys Asn Ala Leu Ser Arg Trp Val Arg Lys Arg Ala Val Leu Ala
165 170 175
Ala Trp Gly Gly Ser Gly Val Arg Leu Asn Ala Ile Ala Pro Gly Ala
180 185 190
Ile Met Thr Pro Leu Leu Gln Ala Gln Leu Ser Asp Pro Arg Tyr Gly
195 200 205
Glu Ala Ile Arg Lys Phe Val Pro Pro Met Gly Arg Glu Phe Arg Ala
210 215 220
Glu Pro Ser Glu Leu Ala Ser Val Ile Ala Phe Leu Leu Ser Pro Ala
225 230 235 240
Ala Ser Tyr Val His Gly Ile Phe Val Asp Gly Gly Met Asp Ala Met
245 250 255
Met Arg Ala Asn Ser Phe
260
<210>2
<211>789
<212>DNA
<213>Pseudomonas putida
<400>2
atgagcacct acgccatcag cggcagcgcc accggcatcg gcgccgccgt gcgccagaag 60
ctggaggccg ccggccacac catcgtgacc atcgacatcc gcgacgccga gaagttcatc 120
ctggccgacc tgagcaccgc cgagggccgc gcccaggcca tcgcccgcgt gctgagcaag 180
tctagcaagg gcctggacgg cgccgtgctg tgcgccggcc tgggcccgag cccgcagcgc 240
aaggtgctgg gcaacatcgt ggccgtgaac tacttcggcg tggtggagct gctgaccgcc 300
tggctgccgg ccctggccgc cgcccaccag ccggccgccg tggtgatcag cagcgtggcc 360
gccacccagc tggccgccga cccgaacccg atcatcaacg ccctgctggc ccacgacgag 420
gccgccaagg cccgcgccat cgtggagctg gccggcccgc agcagatcgc ctacgccggc 480
agcaagaacg ccctgagccg ctgggtgcgc aagcgcgccg tgctggccgc ctggggcggc 540
agcggcgtgc gcctgaacgc catcgccccg ggcgccatca tgaccccgct gctgcaggcc 600
cagctgagcg acccgcgcta cggcgaggcc atccgcaagt tcgtgccgcc gatgggccgc 660
gagttccgcg ccgagccgag cgagctggcc agcgtgatcg ccttcctgct gagcccggcc 720
gccagctacg tgcacggcat cttcgtggac ggcggcatgg acgccatgat gcgcgccaac 780
agcttctga 789
<210>3
<211>789
<212>DNA
<213>Pseudomonas putida
<400>3
atgagcacct atgcgattag cggcagcgcg accggcattg gcgcggcggt gcgtcagaaa 60
ctggaagcgg cgggccatac cattgtgacc attgatattc gtgatgcgga aaaatttatt 120
ctggcggatc tgagcaccgc ggaaggccgt gcgcaggcga ttgcgcgtgt gctgagcaaa 180
tctagcaaag gcctggatgg cgcggtgctg tgcgcgggcc tgggcccgag cccgcagcgt 240
aaagtgctgg gcaacattgt ggcggtgaac tattttggcg tggtggaact gctgaccgcg 300
tggctgccgg cgctggcggc ggcgcatcag ccggcggcgg tggtgattag cagcgtggcg 360
gcgacccagc tggcggcgga tccgaacccg attattaacg cgctgctggc gcatgatgaa 420
gcggcgaaag cgcgtgcgat tgtggaactg gcgggcccgc agcagattgc gtatgcgggc 480
agcaaaaacg cgctgagccg ttgggtgcgt aaacgtgcgg tgctggcggc gtggggcggc 540
agcggcgtgc gtctgaacgc gattgcgccg ggcgcgatta tgaccccgct gctgcaggcg 600
cagctgagcg atccgcgtta tggcgaagcg attcgtaaat ttgtgccgcc gatgggccgt 660
gaatttcgtg cggaaccgag cgaactggcg agcgtgattg cgtttctgct gagcccggcg 720
gcgagctatg tgcatggcat ttttgtggat ggcggcatgg atgcgatgat gcgtgcgaac 780
agcttttaa 789
<210>4
<211>262
<212>PRT
<213>Pseudomonas putida
<400>4
Met Ser Thr Tyr Ala Ile Ser Gly Ser Ala Thr Gly Ile Gly Ala Ala
1 5 10 15
Val Arg Gln Lys Leu Glu Ala Ala Gly His Thr Ile Val Thr Ile Asp
20 25 30
Ile Arg Asp Ala Glu Lys Phe Ile Leu Ala Asp Leu Ser Thr Ala Glu
35 40 45
Gly Arg Ala Gln Ala Ile Ala Arg Val Leu Ser Lys Cys Ser Lys Gly
50 55 60
Leu Asp Gly Ala Val Leu Cys Ala Gly Leu Gly Pro Ser Pro Gln Arg
65 70 75 80
Lys Val Leu Gly Asn Ile Val Ala Val Asn Tyr Phe Gly Val Val Glu
85 90 95
Leu Leu Thr Ala Trp Leu Pro Ala Leu Ala Ala Ala His Gln Pro Ala
100 105 110
Ala Val Val Ile Ser Ser Val Ala Ala Thr Gln Leu Ala Ala Asp Pro
115 120 125
Asn Pro Ile Ile Asn Ala Leu Leu Ala His Asp Glu Ala Ala Lys Ala
130 135 140
Arg Ala Ile Val Glu Leu Ala Gly Pro Gln Gln Ile Ala Tyr Ala Gly
145 150 155 160
Ser Lys Asn Ala Leu Ser Arg Trp Val Arg Lys Arg Ala Val Leu Ala
165 170 175
Ala Trp Gly Gly Ser Gly Val Arg Leu Asn Ala Ile Ala Pro Gly Ala
180 185 190
Ile Met Thr Pro Leu Leu Gln Ala Gln Leu Ser Asp Pro Arg Tyr Gly
195 200 205
Glu Ala Ile Arg Lys Phe Val Pro Pro Met Gly Arg Glu Phe Arg Ala
210 215 220
Glu Pro Ser Glu Leu Ala Ser Val Ile Ala Phe Leu Leu Ser Pro Ala
225 230 235 240
Ala Ser Tyr Val His Gly Ile Phe Val Asp Gly Gly Met Asp Ala Met
245 250 255
Met Arg Ala Asn Ser Phe
260
<210>5
<211>789
<212>DNA
<213>Pseudomonas putida
<400>5
atgagcacct acgccatcag cggcagcgcc accggcatcg gcgccgccgt gcgccagaag 60
ctggaggccg ccggccacac catcgtgacc atcgacatcc gcgacgccga gaagttcatc 120
ctggccgacc tgagcaccgc cgagggccgc gcccaggcca tcgcccgcgt gctgagcaag 180
tgcagcaagg gcctggacgg cgccgtgctg tgcgccggcc tgggcccgag cccgcagcgc 240
aaggtgctgg gcaacatcgt ggccgtgaac tacttcggcg tggtggagct gctgaccgcc 300
tggctgccgg ccctggccgc cgcccaccag ccggccgccg tggtgatcag cagcgtggcc 360
gccacccagc tggccgccga cccgaacccg atcatcaacg ccctgctggc ccacgacgag 420
gccgccaagg cccgcgccat cgtggagctg gccggcccgc agcagatcgc ctacgccggc 480
agcaagaacg ccctgagccg ctgggtgcgc aagcgcgccg tgctggccgc ctggggcggc 540
agcggcgtgc gcctgaacgc catcgccccg ggcgccatca tgaccccgct gctgcaggcc 600
cagctgagcg acccgcgcta cggcgaggcc atccgcaagt tcgtgccgcc gatgggccgc 660
gagttccgcg ccgagccgag cgagctggcc agcgtgatcg ccttcctgct gagcccggcc 720
gccagctacg tgcacggcat cttcgtggac ggcggcatgg acgccatgat gcgcgccaac 780
agcttctga 789
Claims (10)
1. a 3alpha-Hydroxysteroid dehydrogenase is characterized in that, the aminoacid sequence of said 3alpha-Hydroxysteroid dehydrogenase is the aminoacid sequence shown in the SEQ ID NO:1.
2. the nucleotide sequence of the 3alpha-Hydroxysteroid dehydrogenase of encoding is characterized in that, said nucleotides sequence is classified the nucleotide sequence of the described 3alpha-Hydroxysteroid dehydrogenase of coding claim 1 as.
3. nucleotide sequence according to claim 2, wherein, said nucleotides sequence is classified as
(1) nucleotide sequence shown in the SEQ ID NO:2; Perhaps
(2) nucleotide sequence shown in the SEQ ID NO:2 is carried out that one or several Nucleotide replaces and the nucleotide sequence of the codon same sense mutation that obtains.
4. nucleotide sequence according to claim 3, wherein, said nucleotides sequence is classified as
(1) nucleotide sequence shown in the SEQ ID NO:2; Perhaps
(2) nucleotide sequence shown in the SEQ ID NO:3.
5. a recombinant vectors is characterized in that, said recombinant vectors is made up of empty carrier and the goal gene that inserts this empty carrier, and said goal gene is the nucleotide sequence of any described coding 3alpha-Hydroxysteroid dehydrogenase among the claim 2-3.
6. recombinant vectors according to claim 5 is characterized in that, said empty carrier is pET28b (+).
7. a recombinant host cell is characterized in that, said recombinant host cell contains claim 5 or 6 described recombinant vectorss.
8. recombinant host cell according to claim 7 is characterized in that, said host cell is e. coli bl21 (DE3), intestinal bacteria Rosetta (DE3) or bacillus coli DH 5 alpha.
9. a test kit that detects bile acide concentration is characterized in that, said test kit comprises at least a in following (a)-(d):
(a) the described 3alpha-Hydroxysteroid dehydrogenase of claim 1;
(b) nucleotide sequence of any described coding 3alpha-Hydroxysteroid dehydrogenase among the claim 2-4;
(c) claim 5 or 6 described recombinant vectorss;
(d) claim 7 or 8 described recombinant host cells.
10. test kit according to claim 9 is characterized in that, said test kit also comprises: be dissolved in the 0.2-5g/L oxidized form β-Thionicotinamide adenine dinucleotide in 50-200mmol/L 2-(N-morpholino) the ethyl sulfonic acid damping fluid of pH 3.5-4.5; And be dissolved in reduced form β-Thionicotinamide adenine dinucleotide of the 2-10g/L in 50-200mmol/L3-(hexahydroaniline)-2-hydroxyl-1-propanesulfonic acid damping fluid of pH 9.0-11.0, the NaN of 0.1-10mmol/L
33alpha-Hydroxysteroid dehydrogenase with 2-20KU/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100906886A CN101698834B (en) | 2009-09-08 | 2009-09-08 | 3 alpha-hydroxysteroid dehydrogenase, nucleotide sequence thereof, recombinant vector thereof, recombinant host cells thereof and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100906886A CN101698834B (en) | 2009-09-08 | 2009-09-08 | 3 alpha-hydroxysteroid dehydrogenase, nucleotide sequence thereof, recombinant vector thereof, recombinant host cells thereof and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101698834A CN101698834A (en) | 2010-04-28 |
| CN101698834B true CN101698834B (en) | 2012-05-23 |
Family
ID=42147299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100906886A Active CN101698834B (en) | 2009-09-08 | 2009-09-08 | 3 alpha-hydroxysteroid dehydrogenase, nucleotide sequence thereof, recombinant vector thereof, recombinant host cells thereof and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101698834B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109082419B (en) * | 2018-09-07 | 2022-03-01 | 深圳上泰生物工程有限公司 | 3 alpha-hydroxysteroid dehydrogenase mutant, coding nucleotide sequence and kit |
| CN111235122B (en) * | 2019-01-29 | 2020-10-30 | 武汉生之源生物科技股份有限公司 | 3 alpha hydroxysteroid dehydrogenase mutant and application thereof in total bile acid detection |
| CN111235275B (en) * | 2020-03-13 | 2020-11-06 | 青岛市中心医院 | Gene marker of lung cancer and application thereof |
| CN113151207B (en) * | 2021-04-21 | 2023-03-31 | 重庆第二师范学院 | NAD (H) -dependent 3 alpha-hydroxysteroid dehydrogenase and gene encoding same |
| CN113151206A (en) * | 2021-04-21 | 2021-07-23 | 重庆第二师范学院 | 3 alpha-hydroxysteroid dehydrogenase, coding gene and application thereof |
| CN113549123A (en) * | 2021-07-07 | 2021-10-26 | 中山百灵生物技术股份有限公司 | Preparation method of mouse deoxycholic acid |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1322130A (en) * | 1998-08-07 | 2001-11-14 | 恩多研究公司 | Inhibitors of type 3 3a -hydrosteroid dehydrogenase |
-
2009
- 2009-09-08 CN CN2009100906886A patent/CN101698834B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1322130A (en) * | 1998-08-07 | 2001-11-14 | 恩多研究公司 | Inhibitors of type 3 3a -hydrosteroid dehydrogenase |
Non-Patent Citations (1)
| Title |
|---|
| 戴艺民等.睾丸酮丛毛单胞菌活化因子基因的质粒载体构建及表达.《农业生物技术学报》.2006,第14卷(第3期),416-422. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101698834A (en) | 2010-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101698834B (en) | 3 alpha-hydroxysteroid dehydrogenase, nucleotide sequence thereof, recombinant vector thereof, recombinant host cells thereof and kit | |
| CN101454449B (en) | Glucose dehydrogenase | |
| CN111676204B (en) | Nicotinamide phosphoribosyl transferase for preparing nicotinamide mononucleotide, coding gene, vector and application | |
| CN101535476A (en) | Modified flavine-adenine-dinucleotide-dependent glucose dehydrogenase | |
| CN110373404B (en) | Enzyme mutant | |
| CN109609474A (en) | A kind of amino acid dehydrogenase mutant and its application in synthesis L-glufosinate-ammonium | |
| CN112301023B (en) | 2709 alkaline protease mutant modified based on molecular dynamics calculation and application thereof | |
| CN110004182A (en) | The preparation method and applications of bulky grain content in a kind of extracellular microbial | |
| Chen et al. | Colletotrichum fructicola STE50 is required for vegetative growth, asexual reproduction, appressorium formation, pathogenicity and the response to external stress | |
| CN102321595B (en) | Cholesterol esterase and its nucleotide sequence, recombinant vector, recombinant host cell, preparation method and kit | |
| CN108070605A (en) | Carbendazim degrading enzyme CbmA and its encoding gene and application | |
| CN101638640B (en) | Glucose-6-phosphoric acid dehydrogenase and nucleotide sequence, recombinant vector, recombinant host cell and kit thereof | |
| CN1958796B (en) | Nucleotide sequence protein gene of coded natrium hydrogen pump, and application | |
| CN101698837B (en) | Pyruvate kinase, nucleotide sequence thereof, recombinant vector, recombinant host cell and kit | |
| Deng et al. | Expression, characterization, and crystallization of the pyrophosphate-dependent phosphofructo-1-kinase of Borrelia burgdorferi | |
| CN115247158B (en) | Glycerol phosphate oxidase mutant and screening method, preparation method and application thereof | |
| CN109554376A (en) | A kind of alkalinity urate oxidase and its application in detection kit and uric acid in reduction food | |
| CN101659943B (en) | Pyruvic oxidase, and nucleotide sequence, recombinant vector, recombinant host cell and kit thereof | |
| CN108531465B (en) | Cyclic dipeptide synthetase and application thereof | |
| JPWO2018052005A1 (en) | Modified sarcosine oxidase, gene and production method thereof | |
| CN102391999B (en) | Homocysteine methyltransferase, nucleotide sequence thereof, recombinant vector, recombinant host cells, manufacturing method and kit | |
| CN109880834B (en) | Bacillus halophilus saline-alkali-resistant gene yigB and identification method thereof | |
| CN102174531B (en) | Biosynthetic gene cluster of Yatakemycin | |
| CN114317511B (en) | Protein, gene, recombinant vector, expression cassette, host and application | |
| CN112852775B (en) | Novel acetyltransferase GliK of deep-sea fungi as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |