CN103695440A - Rice tissue-specific brittle culm control gene TSBC1 and application thereof - Google Patents

Abstract

The invention discloses a protein coded by a rice tissue-specific brittle culm control gene TSBC1, wherein the protein has an amino acid sequence shown by Seq ID No.2. The invention also discloses a gene coding the protein, wherein the gene has a nucleotide sequence shown by Seq ID No.1. The invention also discloses a plasmid containing the gene, a plant expression vector and a host cell. The invention also discloses a method for cultivating plant brittle culm, which comprises the steps of converting the plant cells by use of the plant expression vector and cultivating the converted plant cells into a plant. In the invention, a new gene TSBC1 cloned from a rice tissue-specific brittle culm mutant is adopted to code the MYB transcription factors of a DNA binding domain with two SANT structures, and the brittle culm character of the plant is controlled mainly by regulating the anabolism of the components of the rice cell wall.

Description

Rice tissue-specific stem brittle control gene TSBC1 and its application

technical field

The invention relates to the rice tissue-specific brittle stalk control gene TSBC1 and its application, which is mainly used in plant genetic engineering.

Background technique

Stem support is an important agronomic trait for plants, especially crops. The support force of the stalk is directly related to the cell wall thickness of the relevant cells in the stalk tissue. The plant cell wall is a strong fiber network structure, which is composed of different polysaccharides, aromatic substances and proteins in a highly orderly manner. Its structure plays an important role in maintaining the cell shape and maintaining the mechanical support of the plant's upright growth ^[1] . Biosynthesis of plant cell walls is a very complex metabolic process involving synthetic pathways of cellulose, lignin and some non-cellulose components. Therefore, the synthesis, distribution and deposition of main components such as cellulose and lignin in the cell wall are the main factors affecting the support force of plant stems. The study of different cell wall mutants is an effective way to reveal the physiological, biochemical and molecular biological mechanisms of cell wall biosynthesis related to stem supporting force.

Cytological and biochemical studies of barley culm mutants (brittle culm) found that the brittle culm of these mutants is characterized by thinned cell walls, reduced cellulose content, and especially the distribution of cellulose synthase complexes on the plasma membrane. It is proved that this trait is related to the synthesis of cellulose ^[2] . A detailed study of Arabidopsis abnormal xylem mutants (irregular xylem) irxl and irx3 found that the mature stem stiffness of these mutants was significantly reduced, and some of them could not even keep the stem upright, and the xylem development was also abnormal. Map-based cloning isolated the corresponding genes of the mutants and showed that they encoded the catalytic subunit of cellulose synthase, which proved that the support force of plant stems was related to the synthesis of cellulose ^[3,4] . In rice species, some brittle stems Gene research. The rice BC1 gene encodes a cobra-like protein mainly expressed in sclerenchyma cells and vascular bundles, which reduces cell wall thickness and cellulose content and increases lignin content ^[5] . BC10 regulates cell wall fibers Bc12 controls the mechanical strength of rice plants and affects the growth and development of plants ^[6] . Bc12 is involved in the cell cycle progression of rice, the accumulation of cellulose microfibrils and the composition of cell wall components ^[7] . Bc14 encodes the rice nucleotide sugar transporter O _s NST1, which is a transporter located in the Golgi apparatus, provides a glucose substrate for the formation of matrix polysaccharides, and then regulates the biosynthesis of cellulose ^[8] . The results showed that in addition to the genes directly involved in the synthesis of cellulose and lignin, the genes that regulate the orderly distribution and deposition of cellulose and lignin and the thickness of the cell wall also have an impact on the supporting force of the plant.

Contents of the invention

The technical problem to be solved by the present invention is to provide rice tissue-specific brittle stalk control gene TSBC1.

The present invention is achieved through the following technical solutions.

A rice tissue-specific brittle stalk control gene TSBC1, the protein encoded by the gene TSBC1 has the amino acid sequence shown in the sequence table.

Furthermore, the above amino acid sequence also includes amino acid sequences or derivatives generated by adding, substituting, inserting or deleting one or more amino acids or homologous sequences of other species.

Further, the above-mentioned gene TSBC1 has the nucleotide sequence shown in the sequence listing.

Furthermore, the above-mentioned nucleotide sequences also include mutants, alleles or derivatives generated by adding, substituting, inserting or deleting one or more nucleotides.

The present invention also provides plasmids containing the above genes.

The present invention also provides a plant expression vector containing the above-mentioned gene.

The present invention also provides a host cell containing the gene sequence.

As an improvement of the host cell of the present invention: the cell is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

The invention also provides a method for cultivating brittle stalks of plants, comprising transforming plant cells with the above-mentioned plant expression vector, and then cultivating the transformed plant cells into plants.

As an improvement of the cultivation method of the present invention: the transformation adopts the Agrobacterium-mediated method or the particle gun method.

Specifically: the new gene TSBC1 cloned from the rice tissue-specific brittle stalk mutant provided by the present invention has the DNA sequence shown in Figure 4 and Seq ID No: 1. It also includes mutant alleles produced by substituting a nucleotide, and also contains gene sequences that have the same function and can achieve the purpose of the present invention.

In the present invention, the protein shown in Seq ID No: 2 belongs to the transcription factor protein family of the MYB-DNA binding domain of the SANT class, wherein one or several amino acid substitutions, insertions or deletions of amino acids are obtained as functional analogs. TSBC1 has 66% homology with Arabidopsis AtMYB103 protein; AtMYB103 protein encodes a transcription factor named SND1 family, also has MYB-DNA binding domain, and regulates the synthesis of S lignin monomers.

The vector provided by the present invention contains the gene or partial gene fragment of the sequence shown in Figure 4 and Seq ID No: 1, as shown in Figure 7, the vector can express the polypeptide or homologous analogue encoded by the above nucleotide sequence .

The method for cultivating brittle plant stalks provided by the invention is a method for high-efficiency plant genetic transformation using TSBC1; specifically, it is a method for transforming plant cells with a plant expression vector to affect the mechanical strength of crop stalks.

A preferred embodiment of the present invention comprises the following steps:

1. Isolation and genetic analysis of rice tissue-specific brittle stalk mutant tsbc1:

The rice tissue-specific brittle stalk mutant used in the present invention was irradiated with heavy ions ¹² C ⁶⁺ (energy: 80Mev/u; dose: 80Gy) and then passed through mass screening. The phenotype stable brittle stalk mutant tsbc1 was obtained. Compared with the wild type, the mutant showed obvious brittle stems, while the leaves and ear branches were normal, the plant height was slightly reduced, and the ear shape became curved, as shown in Figure 1. A large number of hybridization experiments have proved that what we have obtained is a recessive mutant that conforms to the law of inheritance controlled by a single gene.

2. Map-based cloning of the TSBC1 gene controlling rice tissue-specific brittle stems:

(1) In order to isolate the TSBC1 gene, the present invention first established a large polymorphic positioning population, the F2 population formed by crossing the mutant tsbc1 (japonica rice) with Nanjing 11 varieties (indica rice), and then cloned it by map TSBC1 locus was initially located on the short arm of chromosome 8 between SSR markers RM8018 and RM5068 using molecular markers such as SSR, as shown in Figure 2.

(2) Fine mapping and physical location of TSBC1 gene:

Based on the sequenced genome sequence of the TSBC1 locus region, new markers were developed for fine mapping, and finally the TSBC1 gene was located within the 102 kb range between the SSR markers RM5647 and RM22392 (Fig. 2A). Candidate genes were deduced by analyzing the open reading frame (ORF) of this segment, that is, the sequence analysis of the candidate genes in this range was performed. After sequencing, only the sequence of the TSBC1 candidate gene was found to be different between the wild type and the tsbc1 mutant, while The other 14 sequences had no difference between wild type and tsbc1 mutant.

(3) Identification and functional analysis of TSBC1 gene:

The TSBC1 gene was constructed into a conventional plant expression vector and transformed into the brittle stalk mutant tsbc1 of rice. The results showed that the present invention obtained a transgenic rice that restored the normal phenotype of the tsbc1 mutant (Fig. 7B); it proved that the present invention correctly cloned TSBC1 gene (Fig. 3).

Beneficial effects of the present invention:

In rice, the loss of TSBC1 gene function results in a decrease in the cellulose content of the stalk, an increase in the hemicellulose content, a thinning of the sclerenchyma cells, and a decrease in the mechanical support to form a brittle stalk. Further experiments showed that this gene encodes a Myb transcription factor with two SANT-DNA binding domains, which mainly affects the mechanical strength of plant stems by regulating the composition changes of cell walls. The gene has important theoretical value in revealing the molecular mechanism of cell wall secondary metabolism and understanding the formation mechanism of plant machinery. Mechanical strength is an important agronomic trait of crops and plays an important role in variety improvement and straw utilization. The use of transgenic technology can improve the mechanical strength of plants, and cultivate new varieties with high yield and high quality that are brittle but not collapsed. It has broad application prospects for solving the problem of straw incineration, realizing straw returning to the field, and protecting the environment.

Description of drawings

Figure 1 is the phenotype diagram of rice wild type Xiushui 110 (WT) and the brittle stem mutant tsbc1;

Figure 2 is the location map (A), gene prediction (B) and gene structure (C) of TSBC1 on rice chromosome 8;

Figure 3 is the DNA sequence of the TSBC1 gene;

Fig. 4 is the cDNA sequence of TSBC1 gene;

Figure 5 is the amino acid sequence encoded by the TSBC1 gene;

Figure 6 is the vector backbone (A) and the plasmid map of the complementary vector construction (B);

Figure 7 shows the blank vector transgenic plant (A) and the transgenic plant restoring the wild type phenotype (B).

Detailed ways

The present invention will be described in further detail below according to the drawings and embodiments.

Example 1: Cloning of rice tissue-specific brittle stem control gene TSBC1

1. Preliminary location of TSBC1 gene:

Rice (Oryza sativa L.) tissue-specific brittle culm mutant tissue-specific brittleculm1 (tsbc1), the stalk is brittle and easy to break, and the leaves and other tissues are not brittle or weakly brittle; the wild-type material is a japonica variety " Xiushui 110". The homozygous tsbc1 mutant was crossed with the indica variety Nanjing No. 11, and the F1 generation was selfed to obtain the F2 population, and 84 individual plants with brittle stalk phenotype were selected as the positioning population. At the jointing stage, about 1 gram of young leaves were taken from each plant to extract the total DNA.

A rapid extraction method for rice trace DNA is used to extract gene DNA for gene location from rice leaves. About 200mg of rice leaves were taken, frozen in liquid nitrogen, ground into powder in a small mortar with a diameter of 5cm, transferred to a 1.5ml centrifuge tube to extract DNA, and the obtained DNA precipitate was dissolved in 200μl ultrapure water. Use 2 μl of DNA sample per SSR reaction.

In the preliminary mapping stage of the TSBC1 gene, SSR analysis was performed on a small population consisting of 84 F2 individuals. According to the published molecular genetic maps of japonica and indica rice, polymorphic SSR primers with a distance of about 20 cM on 12 rice chromosomes were selected. Carry out linkage analysis, perform PCR amplification according to known reaction conditions, separate by 4% agarose gel electrophoresis and ethidium bromide (EB) staining, detect the polymorphism of PCR products, the results show that the short arm end of chromosome 8 Molecular markers RM408 and RM310 on the gene have obvious linkage relationship with the mutant gene, the exchange rates are 12.5% and 3.6% respectively, molecular marker genotype analysis shows that TSBC1 gene is located between the two. The polymorphic molecular markers were further explored between the two markers, and the TSBC1 gene was located in the genomic interval of about 990kb between the SSR markers RM8018 and RM5068. (See Table 1 for primer sequences)

2. Fine mapping of TSBC1 gene:

A new polymorphic SSR marker was further excavated between the two preliminary markers RM8018 and RM5068 (see Table 1 for primer sequences). By expanding the mapping population, 2307 F2 fragile individuals were selected to form a fine mapping population, and genotype analysis Finally, the TSBC1 gene was fine-mapped within the 102Kb interval between SSR markers RM5647 and RM22392 (Fig. 2A).

Table 1. SSR markers used for TSBC11 gene localization

3. Cloning of TSBC1 gene, acquisition of full-length cDNA and prediction of the structure and function of the encoded protein

According to the annotations on the Rice Genome Annotation Project (http://rice.plantbiology.msu.edu/) website, it was found that there are 15 possible open reading frames (ORFs) in the finely mapped 102kb genomic interval (Figure 2B), which were sequenced one by one Comparing the difference between the mutant and the wild type, it was found that one of the ORFs (Os08g0151300) had a deletion of 13 bases (Figure 2C); the deletion occurred at the junction of the first intron and the second exon of the gene , so that the second intron cannot be cut out, and the DNAStar software analysis of this mutation will cause a frame shift and premature termination of translation, while other genes in this range have not been found to have any changes after sequencing, so We initially determined that the gene is TSBC1 gene. The genome sequence of the candidate region and the cDNA data in KOME (http://cdna01.dna.affrc.go.jp/cDNA) were subjected to Blastn analysis, and the full-length cDNA of the gene was found in the rice full-length cDNA library. The size of the full-length expression sequence is 1080bp (Fig. 4), encoding 359 amino acids (Fig. 5). The amino acid sequence was analyzed by BlastP in the GenBank database, and it was found that it has a high homology with the Myb transcription family in plants. It is a transcription factor with two SANT-DNA binding domains, which may regulate genes related to cell wall synthesis Control the formation of brittle culm traits.

4. Identification and functional analysis of TSBC1 gene:

The pCAMBIA2300 plasmid was used to construct a complementary vector (Figure 6), and the transgenic research of functional complementarity was carried out by transgenic technology. The results showed that the transgenic plants with the blank vector showed the characteristics of tsbc1 mutants (Figure 7A), while the phenotype of the plants transferred into the TSBC1 gene recovered to Wild phenotype, stalk (Fig. 7B), proves that the present invention has correctly cloned the TSBC1 gene, clarified the DNA sequence (Fig. 3) and cDNA sequence (Fig. 4) of the TSBC1 gene, and amino acid sequence analysis shows that the TSBC1 gene code has two SANT - MYB-like transcription factors of the DNA binding domain (Fig. 5). The nucleotide sequence of the cDNA sequence shown in Figure 4 is Seq ID NO:3.

Example 2:

Plant Transformation:

In order to verify that Os08g0151300 is the TSBC1 gene, we constructed the genetic complementation vector pOsTSBC1OsTSBC1 (Fig. 6B) by transforming the vector pCAMBIA2300-35S-OCS (Fig. 6A). The 2510 bp sequence before the start codon ATG of the gene Os08g0151300 was selected as its own promoter, and the cDNA sequence was used as the coding sequence; the automatic promoter primer PP with EcoRI and KpnⅠ restriction sites was designed (F: CGGAATTCTCGTACAGAGGGCGATGAGATG; R: GGGGTACCGCATGCACTCTAGATATCACTG) and Primer CP (F: GGGGTACCATGGGGGCATCACTCTTGCTGCA; R: CGGGATCCTTAATCATGGTCATTTGGTCCC) with the coding sequence of restriction site KpnⅠ and BamHⅠ, the amplified product of the vector pCAMBIA2300-35S-OCS and primer PP was digested with two endonucleases EcoRI and KpnⅠ , and then ligated into the intermediate vector pCAMBIA2300-OsTSBC1-OCS with the gene Os08g0151300’s own promoter by T4 ligase; then use KpnⅠ and BamHI two endonucleases to cut the vector intermediate vector pCAMBIA2300-OsTSBC1-OCS and amplify the primer CP The product was ligated into the final vector pOsTSBC1OsTSBC1 by T4 ligase. The plasmid was transferred into the Agrobacterium tumefaciens strain EHA105 (purchased from CAMIA, Australia) by electric shock and transformed into mutant tsbc1. The process was as follows:

1. Immature rice embryo culture. Dehull the immature embryos of the tsbc1 mutant, sterilize the surface with 70% ethanol for 3 minutes, soak in 10% sodium hypochlorite solution for 20 minutes, rinse with sterile water 3-4 times, and sow on NB medium to induce callus, 20 The callus grown from the scutellum of the mature embryo was subcultured on the NB medium in about 10 days, and then subcultured every 2 weeks, and the embryogenic callus with light yellow color and compactness was selected every time it was subcultured.

2. Agrobacterium culture. Agrobacterium strains stored at -70°C were inoculated on YEP medium containing 50mg/L kanamycin and 25mg/L rifampicin, 26-28°C, 150rpm dark culture for 16-18 hours to activate the strains, YEP solid culture Scrape a plate on the base, culture in the dark at 26-28°C for 1 day, pick a single colony in YEP liquid medium, culture in suspension at 26-28°C, 150rpm for 16 hours, pour into a 250ml centrifuge tube and centrifuge at 4000rpm to collect Agrobacterium cells , and use the liquid medium to suspend the cells to OD ₆₀₀ of 0.8-1.0 for the transformation of various rice materials.

3. Co-cultivation of rice material and Agrobacterium. Before the rice callus can be used for transformation, it needs to be cultured on a fresh subculture medium for 4 days before being infected with the Agrobacterium bacterium liquid. When transforming, first transfer the callus that has been pre-cultured for 4 days to a 100ml sterile conical flask, and then pour an appropriate amount of Agrobacterium suspension into (ensure that there is enough bacterial liquid to submerge the material) the above-mentioned cone containing rice materials. Shaped bottle, placed at room temperature for 20 minutes, and shaking from time to time, then the rice material was taken out, excess bacterial solution was absorbed on sterile filter paper, and then transferred to NB-AS solid medium (adding 100 μM NB medium of acetosyringone AS) (NB basic+10mg/L glucose+2mg/L2,4-dichlorophenoxyacetic acid (2,4-D)+500mg/L proline+500mg/L glutamine+300mg/L caseinhydrolysate+l00mg/ L Inositol+100uM AS+3g/L Phytagel, pH 5.8), after 2-3 days of co-cultivation in the dark at 26°C, the transformed rice material was taken out from the solid co-cultivation medium, and transferred to a medium containing 50mg /L hygromycin selection medium for selection culture.

Screening of resistant callus and regeneration of plants. After the first round of selection for 2 weeks, transfer to the second round of selection medium to continue screening for 2 weeks, then select the vigorously growing resistant callus and transfer to the pre-differentiation medium (MS basic+16g/L sobitol+1g/L caseinhydrolysate+l00mg/L Inositol+5mg/L ABA+2mg/L6-KT+0.5mg/LNAA+250mg/L cefotaxime+30-50mg/L hygrromycin+3g/L Phytagel, pH5.8); or directly transfer to differentiation Medium (MS basic+16g/L sobitol+1g/L caseinhydrolysate l00mg/L Inositol+5mg/L ABA+2mg/L6-KT+0.5mg/L NAA+250mg/L cefotaxime+30-50mg/L hygrromycin+3g /L Phytagel, pH5.8) (16 hours of light/day), the regenerated seedlings took root on 1/2MS medium, and then moved into the greenhouse. The transgenic lines obtained from the complementary transformation vector pOsTSBC1OsTSBC1 completely recovered the wild-type phenotype ( FIG. 7B ), which proved that the gene could regulate the mechanical strength of rice stalks.

The above-mentioned embodiments are only to illustrate the technical concept and characteristics of the present invention, and the purpose is to enable those skilled in the art to understand and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes or modifications made according to the spirit of the present invention shall fall within the protection scope of the present invention.

Claims (10)

1. the crisp stalk controlling gene of a rice tissue specificity TSBC1, is characterized in that, the coded protein of described gene TSBC1 has the aminoacid sequence as shown in sequence table.

2. the crisp stalk controlling gene of rice tissue specificity according to claim 1 TSBC1, it is characterized in that, described aminoacid sequence also add, replace, insert or delete the homologous sequence of one or more amino acid or other species and the aminoacid sequence or the derivative that generate.

3. the crisp stalk controlling gene of rice tissue specificity according to claim 1 TSBC1, is characterized in that, described gene TSBC1, has the nucleotide sequence as shown in sequence table.

4. the crisp stalk controlling gene of rice tissue specificity according to claim 3 TSBC1, is characterized in that, described nucleotide sequence also adds, replaces, and inserts or lack one or more Nucleotide and the mutant, allelotrope or the derivative that generate.

5. a plasmid relevant to gene TSBC1 described in claim 1-4 Arbitrary Term, is characterized in that, described plasmid has described gene TSBC1.

6. a plant expression vector relevant to gene TSBC1 described in claim 1-4 Arbitrary Term, is characterized in that, described plant expression vector has described gene TSBC1.

7. a host cell relevant to gene TSBC1 described in claim 1-4 Arbitrary Term, is characterized in that, described host cell has described gene TSBC1.

8. host cell according to claim 7, is characterized in that, described host cell is any one in Bacillus coli cells, agrobatcerium cell or vegetable cell.

9. a method of cultivating fragility plant, is characterized in that, will have the plant expression vector transformed plant cells of described gene TSBC1, then the vegetable cell of conversion is cultivated into plant.

10. the method for cultivation fragility plant according to claim 9, is characterized in that, comprises step:

(1) by japonica rice variety Japonica " elegant water 110 " through heavy ion ¹²c ⁶⁺at energy: 80Mev/u; After the radiation treatment of dosage: 80Gy, the more stable crisp stalk mutant tsbc1 of the phenotype obtaining by a large amount of screenings;

(2) described crisp stalk mutant tsbc1 and Nanjing 11 kinds (long-grained nonglutinous rice) are hybridized and the F2 colony of formation, pass through map based cloning, and utilize SSR equimolecular mark to carry out Primary Location to TSBC1 site, by its Primary Location on the 8th the short arm of a chromosome, and between SSR mark RM8018 and RM5068;

(3) by the genome sequence of the TSBC1 site areas that checked order, develop new mark and carry out Fine Mapping, the TSBC1 assignment of genes gene mapping is within the 102kb scope between SSR mark RM5647 and RM22392 the most at last;

(4) TSBC1 is gene constructed to conventional plant expression vector and be transformed in paddy rice fragile straw mutant tsbc1.

Images