CN103667534A - High-accuracy quantitative detection method and kit for HIV-1 nucleic acid - Google Patents
High-accuracy quantitative detection method and kit for HIV-1 nucleic acid Download PDFInfo
- Publication number
- CN103667534A CN103667534A CN201310681720.4A CN201310681720A CN103667534A CN 103667534 A CN103667534 A CN 103667534A CN 201310681720 A CN201310681720 A CN 201310681720A CN 103667534 A CN103667534 A CN 103667534A
- Authority
- CN
- China
- Prior art keywords
- hiv
- nucleic acid
- kit
- aids
- immune deficiency
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a high-accuracy quantitative detection kit for HIV-1 nucleic acid. The kit is applied to the field of biomedical clinical diagnosis. The gene amplification locus of the kit is positioned in the 5'LTR conserved region of an HIV genome; the kit comprises a nucleic acid extraction kit based on a magnetic bead method and an HIV nucleic acid amplification kit, wherein the nucleic acid extraction kit based on the magnetic bead method comprises a lysed combined liquid, a rinsing liquid A, a rinsing liquid B, a rinsing liquid C, eluant and a magnetic bead liquid; the HIV nucleic acid amplification kit comprises an RT-PCR reaction liquid, an enzyme mixed liquid, an HIV-interior standard, an HIV quantitative reference product 1-4, a negative quality control product, a critical positive quality control product and a strong positive quality control product. The kit provided by the invention is simple and quick to operate, low in cost, high in detection sensitivity, good in repeatability, high in primer and probe gene type coverage rate, high in conservative property and strong in specificity, an efficient internal standard system is introduced, and the problems of mutual inhibition and interference due to the simultaneous amplification of a target gene and the internal standard are solved.
Description
Technical field
The present invention relates to method and test kit thereof that a kind of acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantification in biomedical clinical diagnostic field detects.
Background technology
Human immunodeficiency virus (Human immunodeficiency virus, HIV) is the pathogenic micro-organism that causes a kind of chronic lethal disease acquired immune deficiency syndrome (AIDS) (Acquired immune defiiency syndrome, AIDS).Because acquired immune deficiency syndrome (AIDS) has infectivity and high lethality, therefore become one of principal disease of emphasis prevention and control in world wide.From first case acquired immune deficiency syndrome (AIDS) case, since 1981 first report acquired immune deficiency syndrome (AIDS) cases, up to the present, acquired immune deficiency syndrome (AIDS) has caused and has surpassed 2,005 million peoples' death.Chinese since 1985 find acquired immune deficiency syndrome (AIDS) case first, the popular tendency of climbing fast that is of acquired immune deficiency syndrome (AIDS).In recent years, the infection of China's AIDS and number of the infected also increase comparatively fast.China's AIDS present situation, the data that show according to mechanism to China of United Nations, China's AIDS virus infection person approximately 840,000 people, add 240,000 people that passed away at present, sum should be in 1,000,000 people left and right.According to World Health Organization's prediction, although although the ratio that current China's AIDS virus carrier accounts for total population is very low, infects total number of persons and occupy the 2nd in Asia, in the whole world, occupy the 14th.In view of China is that world population radix is maximum, the country that population is the most intensive, will become a public health disaster once acquired immune deficiency syndrome (AIDS) is extensive popular.
The diagnosis of HIV at present conventional diagnostic means comprises viral diagnosis and serodiagnosis, the viral diagnosis technology common method that HIV infects is for being total to culture method, use the separated mononuclearcell of normal people's peripheral blood, after adding PHA and stimulating and cultivate, add patient's mononuclearcell to carry out the diagnosis of acquired immune deficiency syndrome (AIDS).During serology detects, euzymelinked immunosorbent assay (ELISA) is a Main Means of current diagnosis acquired immune deficiency syndrome (AIDS).HIV ELISA reagent is at present generally for every field such as clinical, emergency treatment, blood screenings.But enzyme-linked immunoassay method is as a kind of detection method of indirect hysteresis, the target that he detects is antibody rather than the pathogenic agent itself producing in human body.Therefore,, although enzyme-linked immunoassay method is through improvement and the evolution of several generations, at aspects such as sensitivity, specificity, tolerance range and stability, there is huge raising.Nucleic acid molecule detection technique demonstrates powerful advantage in laboratory medicine and clinical study in recent years, the advantage such as that the enzyme-linked immunologic diagnosis technology of comparing has is highly sensitive, high specificity, diagnosis are quick.HIV RNA in serum is the exact indicator of virus replication and acquired immune deficiency syndrome (AIDS) process, so the detection of HIV RNA in serum has become " gold standard " method of diagnosis of aids.In recent years, by fluorescence quantifying PCR method direct-detection HIV RNA, become a kind of general acquired immune deficiency syndrome (AIDS) medical detecting method, greatly improved the detection accuracy of acquired immune deficiency syndrome (AIDS), be conducive to the early diagnosis of disease, " window phase " can have been shortened greatly.In aids prevention process, the diagnosis of AIDS high-risk population is the key link of " anti-Chinese mugwort ", and diagnostic nucleic acid reagent has been brought into play vital role in making a definite diagnosis AIDS virus carrier's process, at present, has become the gold standard reagent that acquired immune deficiency syndrome (AIDS) is made a definite diagnosis.It has been one of conventional sense project by national authentication clinical PCR laboratory that acquired immune deficiency syndrome (AIDS) nucleic acid quantification detects at present.AIDS patient, make a definite diagnosis, medication and curative effect anticipation, and there is directive significance in rehabilitation process.Meanwhile, the accurate interpretation of hiv virus carrying capacity, also for patient provides state of an illness control information accurately.
HIV is Retroviridae lentiviridae, and HIV has very high genetic mutation rate, and height region of variability is in env gene, and aberration rate is 20%-30%.Although gag and the less variation of pol gene, also exist certain probability variation, is respectively the about 5%-22% of gag1 gene, pol gene is 15%.So, for HIV detection of nucleic acids reagent, the conservative property of amplimer used and genotype covering power, and whether the sensitivity of detection different genotype sample is consistent, is one of important indicator of evaluating these type of diagnostic reagent product performance always.Also be that the current HIV diagnostic reagent of puzzlement is to one of technology barriers of international development.
In recent years, than traditional viral nucleic acid extractive technique, on market, emerge in large numbers some centrifugal column method viral nucleic acid extractive techniques simply and easily, due to the matching used high throughput automated centrifugation apparatus high cost of the centrifugal column in extractive technique, be difficult to penetration and promotion.Therefore, researching and developing method that a kind of acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantification detects and test kit thereof is new problem anxious to be resolved at present.
Summary of the invention
The method and the test kit thereof that the object of the present invention is to provide a kind of acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantification to detect, the problems such as the genotype that this invention fundamentally solves existing HIV-1 nucleic acid quantification round pcr existence covers entirely, loss is high, sensitivity is low, poor accuracy, the primer of its design and TaqMan fluorescent probe are positioned at genomic 5 ' the LTR region of HIV, this primer and probe have genotype wide coverage, detection sensitivity is high, the advantages such as high specificity, good stability.Apply paramagnetic particle method simultaneously and carry out RNA extraction, method is simple, nucleic acid purity is high, extract sample and can be serum or blood plasma, sample size is large, in adopting, mark and anti-pollution system improve detection tolerance range, adopt resistance to DNase and RNase pseudovirus as working standard and quality control product, improve the stability of test kit.
The object of the present invention is achieved like this: a kind of acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantitative determination reagent kit, and the gene amplification site of described test kit is positioned at genomic 5 ' the LTR conservative region of HIV; Test kit comprises paramagnetic particle method nucleic acid extraction kit and HIV nucleic acid amplification test kit, and wherein paramagnetic particle method nucleic acid extraction kit comprises that cracking is in conjunction with liquid, rinsing liquid A, rinsing liquid B, rinsing liquid C, elutriant, magnetic bead liquid; HIV nucleic acid amplification test kit comprises mark, the quantitative reference material 1-4 of HIV, negative quality control product, critical positive quality control product, strong positive quality control product in RT-PCR reaction solution, enzyme mixation, HIV-; In described paramagnetic particle method nucleic acid extraction kit, cracking consists of and contains sodium lauryl sulphate 0.5-2.5% in conjunction with liquid, Triton X-1000.5-2.0ml/100ml, guanidinium isothiocyanate 2-6.0mol/L, 1-10mM/L EDTA(PH7.5); In described paramagnetic particle method nucleic acid extraction kit, rinsing liquid A consists of and contains Triton X-1000.5-2.0ml/100ml, lithium chloride 0.5-1mol/L; In described paramagnetic particle method nucleic acid extraction kit, rinsing liquid B consists of and contains Triton X-1000.5-2.0ml/100ml, Repone K 0.1-0.3mol/L, 60-80% ethanol; In described paramagnetic particle method nucleic acid extraction kit, rinsing liquid C consists of and contains Triton X-1000.5-2.0ml/100ml, sodium-chlor 0.1-0.3mol/L, 60-80% ethanol; In described paramagnetic particle method nucleic acid extraction kit, eluent components is for containing 10mmol/L Tris.HCl(PH8.3), 0.01-0.05%Prolin300; In described paramagnetic particle method nucleic acid extraction kit, magnetic bead liquid consists of the super suitable nanometer magnetic bead of silicon oxide that diameter is 1 μ m, and concentration is 10-40mg/ml; In described HIV nucleic acid amplification test kit, RT-PCR reaction solution comprises for detection of target gene and interior target probe, for amplified target gene and interior target upstream primer and downstream primer, RT-PCR damping fluid; Probe sequence for detection of target gene in HIV nucleic acid amplification test kit is: 5'-ATCTGAGCCTGGGAGCTCTCTGGCTAGCT-'3(SEQ ID NO:1), 5' end is labeled as FAM fluorescence generation group, and 3' end is labeled as BHQ1 fluorescent quenching group; The probe sequence detecting for interior mark is: 5'-CAGACTCCACATCGACCCTACCCGACTGC-'3(SEQ ID NO:2), 5' end is labeled as HEX fluorescence generation group, and 3' end is labeled as BHQ1 fluorescent quenching group; Upstream primer sequence for amplified target gene is: 5'-CCTGTACTGGGTCTCTCTGGTTAG-'3(SEQ ID NO:3); Downstream primer sequence for amplified target gene is: 5'-TCACACAACAGACGGGCACACAC-'3(SEQ ID NO:4); Upstream primer sequence for amplification interior label is: 5'-TTCGATCTCCGTCGAACCTTG-'3(SEQ ID NO:5); Downstream primer sequence for amplification interior label is: 5'-TTCTCAGGACTCCAGTCGCTG-'3(SEQ ID NO:6); Probe working concentration for detection of target gene in described HIV nucleic acid amplification test kit is 5-20pmol, and preferably target gene probe working concentration is 8pmol; For detection of interior target probe working concentration, be 5-20pmol, preferably interior mark probe working concentration is 8pmol; Upstream and downstream primer working concentration for detection of target gene is 10-30pmol, and preferably target gene upstream and downstream primer working concentration is 20pmol; For detection of interior target upstream and downstream primer working concentration, be 5-20pmol, putting on downstream primer working concentration in is preferably 8pmol; In described HIV nucleic acid amplification test kit, RT-PCR damping fluid consists of 50mmol/L Tris-HCl(PH8.3), 10mmol/L (NH4)
2sO
4, 75mmol/LKCl, 2.5mmol/LMgSO
4, 0.15mmol/L dNTPs; In described HIV nucleic acid amplification test kit, enzyme mixation comprises reversed transcriptive enzyme (M-MLV enzyme), warm start Taq enzyme, uridylic glycosylase (UNG), RNase inhibitor, T4 phage GP32 albumen; Wherein M-MLV enzyme dosage is 50-200U/ person-portion, and warm start Taq enzyme dosage is that the consumption of 3-8U/ person-portion, uridylic glycosylase is that 0.05-0.2U/ person-portion, RNase inhibitor consumption are that 5-10U/ person-portion, T4 phage GP32 albumen consumption are 1-5 μ g/ person-portion; In described test kit, mark is by sequence 5'-TTCGATCTCCGTCGAACCTTGCACTCTGCATCCTGGACTCATGCTGACTGCAG ACTCCACATCGACCCTACCCGACTGCTCTACTGCACTCCTGCGTCATCACGCGACT GGAGTCCTGAGAA-'3(SEQ ID NO:7 in HIV-) be inserted into pUC18T carrier and the recombinant chou that forms; In HIV, mark plasmid working concentration is 100-500copies/ time, and preferably working concentration is 100copies/ time; In described test kit, negative quality control product is the negative people of deactivation source blood plasma, the quantitative reference material 1-4 of HIV, and critical positive quality control product and strong positive quality control product form by containing the dilution of HIV RNA fragment pseudovirion, and dilution matrix is the negative people of deactivation source blood plasma; Concentration is respectively 1.0 * 10
7, 1.0 * 10
6, 1.0 * 10
5, 1.0 * 10
4, 1.0 * 10
3, 1.0 * 10
6iU/ml; Described test kit need to carry out RT-PCR reaction, and the optimal reaction temperature of its amplification and time are: 55 ℃ of reverse transcription 20min, 1 circulation; 95 ℃ of 5min, 1 circulation; Last 94 ℃ of 10s, 60 ℃ of 30s, 42 circle collection fluorescent signals; It is serum and plasma that described test kit detects sample type; The detection sensitivity of test kit is 100IU/ml, and detection linearity range is 500-1 * 10
9iU/ml; Described fluorescence quantitative RT-RCR testing process has been used two enzyme one-step law technologies of M-MLV+Taq enzyme to carry out reverse transcription and amplification.
Main points of the present invention are a kind of human immunodeficiency virus (HIV-1) nucleic acid quantitative determination reagent kit.Its ultimate principle is: first adopt nanometer magnetic bead method to extract HIV RNA in serum, plasma sample and, as amplification template, then apply TaqMan fluorescent probe technique and complete this template real-time fluorescence quantitative RT-PCR testing process.Whether mark system in simultaneously having introduced efficiently in amplification system, normally monitor in sample to be tested whether have PCR inhibition by detecting interior mark, avoids PCR false negative.Wherein, by applying professional bioinformatics software, analyze and compared more than 1000 HIV genome sequence, designed TaqMan fluorescent probe and primer and interior target probe and the primer of high conservative property, specificity and high efficiency.Described target gene and interior mark probe be flag F AM and HEX fluorescence report group respectively; Described real-time fluorescence quantitative PCR product is 70-130 base pair scope.Meanwhile, fluorescence quantitative RT-RCR testing process has been used two enzyme one-step law technologies, has avoided the easy pollution of two-step approach, complex operation, numerous defects such as sensitivity is low.”
In test kit employing advantages of good adsorption effect of the present invention, the paramagnetic particle method extraction serum that is easy to purifying, plasma sample, hiv virus nucleic acid is as template, and application TaqMan fluorescent probe technique completes this template fluorescence quantitative PCR detection process.Whether mark in having added efficiently in reaction system, normally monitor in sample to be tested whether have PCR inhibition by detecting interior mark simultaneously, avoids the false-negative existence of PCR.”
The invention has the advantages that:
1, primer and probe genotype fraction of coverage is high, conservative property is high, high specificity.Show that after tested the present invention can cover 9 genotype of HIV-1, substantially suitable with international advanced acquired immune deficiency syndrome (AIDS) diagnostic nucleic acid reagent performance.
2, detection sensitivity is high, reproducible.The present invention uses the paramagnetic particle method nucleic acid extraction technology of independent development, can from sample, obtain high purity hiv virus (HIV-1) nucleic acid, eliminates the interference of extract to PCR reaction, has strengthened detection sample size, has improved detection sensitivity and stability.
3, mark system in having introduced efficiently, has solved that target gene and interior mark increase simultaneously and the problems such as the mutual inhibition that causes and interference can be monitored the whole process of whole pcr amplification efficiently, avoids occurring false negative result.
4, introduce RNA pseudovirus preparation technology, increased the security of HIV detection of nucleic acids reagent, and stable working standard and positive quality control product can be provided.Meanwhile, working standard and positive quality control product are synchronizeed and are participated in nucleic acid extraction process with sample, can be good at the extraction state of Reality simulation virus.
5, the present invention is easy and simple to handle, quick, with low cost, and is easy to be developed as automated detection system, to a large amount of samples are carried out to high-throughput screening.The sample detecting comprises people source or zoogenous blood, seminal fluid, saliva.Be applicable to the detection of conventional blood sample, be also applicable to automatization and high throughput testing.This diagnostic reagent can judge the state of an illness, prognosis and the infectivity of transmissible disease, the effect of prediction antiviral therapy, the curative effect of monitoring and evaluation antiviral, improve the screening quality of blood and blood products and be applied to epidemiology survey field, for the monitoring of clinical disease substance carrying capacity and the screening for the treatment of plan and medicine provide important references.
The method that a kind of acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantification detects and test kit thereof are compared with prior art, have easy and simple to handle quick, with low cost, detection sensitivity is high, reproducible, primer and probe genotype fraction of coverage is high, conservative property is high, mark system in high specificity, introducing efficiently, solve that target gene and interior mark increase simultaneously and the advantages such as the mutual inhibition that causes and interference problem will be widely used in biomedical clinical diagnostic field.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, the present invention is described in detail.
Fig. 1 is the national sensitivity reference material serum dish detected result figure of inspection during the present invention detects.
Fig. 2 is the national yin and yang attribute reference material serum dish detected result figure of inspection during the present invention detects.
Fig. 3 is the detected result figure that the present invention detects international HIV genotype serum dish.
Fig. 4 is mark detected result figure in the present invention.
Embodiment
Following examples will contribute to understanding of the present invention, but these embodiment are only for the present invention is illustrated, and the present invention is not limited to these contents.
Embodiment mono-
The fluorescence quantitative PCR detection example of HIV RNA
(1) reagent is prepared
The preparation of a.RT-PCR reaction solution
RT-PCR damping fluid consists of 50mmol/L Tris-HCl(PH8.3), 10mmol/L (NH4)
2sO
4, 75mmol/LKCl, 2.5mmol/L MgSO
4, 0.15mmol/L dNTPs.The upstream primer of amplified target gene and downstream primer, working concentration is 20pmol, and the probe working concentration that target gene detects is 8pmol, and interior target upstream primer and downstream primer working concentration are 8pmol, and interior mark probe working concentration is 8pmol.
B. in proportion the cracking that (cracking is in conjunction with liquid 400 μ l/ person-portions+interior mark 0.1 μ l/ person-portion) gets respective amount, in conjunction with liquid and interior mark, is fully mixed into cracking in conjunction with liquid-mix, instantaneous centrifugal rear standby.
C. according to the amount of sample to be tested, negative control, positive control, the critical positive and working standard 1-4, (RT-PCR reaction solution 28.5 μ l/ person-portion+enzyme mixation 1.5 μ l/ person-portions), are fully mixed into PCR-mix in proportion, instantaneous centrifugal rear standby.Enzyme mixation forms and comprises reversed transcriptive enzyme (M-MLV enzyme) 120U, warm start Taq enzyme 3U, uridylic glycosylase (UNG) 0.1U, RNase inhibitor 5U, T4 phage GP32 albumen 1 μ g.
(2) sample extracts
A. get appropriate 1.5ml centrifuge tube, difference mark negative control, positive control, critical positive control, working standard 1-4 and sample to be tested, in every pipe, add 400 μ l cracking in conjunction with liquid, lysate consists of and contains sodium lauryl sulphate 0.5-2.5%, Triton X-1000.5-2.0ml/100ml, guanidinium isothiocyanate 2-6.0mol/L, 1-10mM EDTA(PH7.5);
B. every pipe adds 200 μ l samples to be tested or negative control, positive control, critical positive control, working standard 1-4; Every pipe adds 10 μ l magnetic bead suspensions (magnetic bead liquid diameter is the super suitable nanometer magnetic bead of the silicon oxide of 1 μ m, and concentration is 20mg/ml), and concussion mixed after 10 seconds, and standing 10 minutes of room temperature is instantaneous centrifugal;
C. centrifuge tube is placed on magnetic frame and adsorbs approximately 2 minutes, discard supernatant liquor, instantaneous centrifugal, blot raffinate;
D. add 600 μ l rinsing liquid A, rinsing liquid A consists of and contains Triton X-1000.5-2.0ml/100ml, lithium chloride 0.5-1mol/L, 60-80% ethanol.With pipettor, repeatedly inhale and make a call to after 10 times, instantaneous centrifugal.On magnetic frame, adsorb 2 minutes, discard supernatant liquor, then instantaneous centrifugal, centrifuge tube is placed on magnetic frame again and is adsorbed approximately 2 minutes, blot raffinate;
E. add 600 μ l rinsing liquid B, described rinsing liquid B consists of and contains Triton X-1000.5-2.0ml/100ml, Repone K 0.1-0.3mol/L, 60-80% ethanol; With pipettor, repeatedly inhale and make a call to after 10 times, instantaneous centrifugal.On magnetic frame, adsorb 2 minutes, discard supernatant liquor, then instantaneous centrifugal, centrifuge tube is placed on magnetic frame again and is adsorbed approximately 2 minutes, blot raffinate;
F. add 600 μ l rinsing liquid C, described rinsing liquid C consists of and contains Triton X-1000.5-2.0ml/100ml, sodium-chlor 0.1-0.3mol/L, 60-80% ethanol.With pipettor, repeatedly inhale and make a call to after 10 times, instantaneous centrifugal.On magnetic frame, adsorb 2 minutes, discard supernatant liquor, then instantaneous centrifugal, centrifuge tube is placed on magnetic frame again and is adsorbed approximately 2 minutes, blot raffinate;
G. add 40 μ l elutriants, described elutriant is for containing 10mmol/L Tris.HCl(PH8.3), 0.01-0.05%Prolin300.Concussion mixed for 10 seconds, and then 65 ℃ of temperature are bathed 2 minutes; Centrifuge tube is placed on magnetic frame and is adsorbed 2 minutes, sucking-off supernatant liquor.
(3) application of sample and detection
In the reaction tubes that contains RT-PCR reaction solution, add respectively each 20 μ l of sample, negative control, positive control, critical positive control and working standard of extraction, cover tightly pipe lid, be placed on PCR instrument and detect.Amplification program is as follows:
Take ABI7500 as example, arrange as table 1:
Table 1PCR amplification program
Sense channel is selected: fluorescent signal is collected and is set as F1(FAM) and F2(VIC) passage, then the concentration of four working standards is set.
(4) result is judged
A. reaction finishes rear preservation detection data file;
B. analysis condition setting: click Analysis button and enter assay surface, manual setting Baseline;
C. detect 500IU/ml≤HIV RNA≤1 * 10 in sample
9iU/ml, result is effective, can directly report the positive and respective copies amount;
D. detect HIV RNA > 1 * 10 in sample
9iU/ml, can directly be reported as > 1 * 10
9iU/ml, also available normal people HIV RNA negative serum is done corresponding dilution by 10 times of gradients, makes its copy number 1 * 10
5～1 * 10
7within the scope of IU/ml, redeterminate, measurement result should be proofreaied and correct by extension rate again;
When the copy number that e. detects HIV RNA in sample is 100～500IU/ml, meanwhile, interior mark test positive and Ct≤35, be reported as HIV RNA positive, and HIV RNA concentration quantitative value is only for reference.
F. detect the copy number < 100IU/ml of HIV RNA in sample, meanwhile, interior mark test positive and Ct≤35, be reported as gray area, and HIV RNA concentration detects lower limit lower than test kit.
If g. detection by quantitative result does not show, meanwhile, interior mark test positive and Ct≤35, be reported as HIVRNA feminine gender.
(5) quality control
Coefficient R >=0.980 of typical curve.The HIV RNA copy number of positive control should be 5 * 10
5～5 * 10
6iU/ml, critical positive control copy number should be 500～5 * 10
3iU/ml, the Ct value of negative control should not show, simultaneously interior target Ct≤35, test is considered as effectively.
(1) national sensitivity reference material test
The sensitivity reference material serum dish (B1-B5) of take in the quantitative reference material of the middle inspection HIV of institute nucleic acid country is sample to be tested, adopts the inventive method to detect, and detected result is shown in Fig. 1 and table 2.Detected result shows, the present invention meets the quality standard of reference material specification sheets for the serum dish pattern detection result of B1-B3, the present invention simultaneously also can effectively detect for B4 and the B5 of low copy, shows that detection sensitivity of the present invention meets national code requirement.
The national sensitivity reference material detected result of inspection in table 2
| Sensitivity reference material | Target level of product quality (IU/ml) | Actual detected value | Evaluation of result |
| B1 | 8.71E+04—4.88E+05 | ? | Meet |
| B2 | 2.25E+03—1.51E+05 | ? | Meet |
| B3 | 2.42E+02—1.57E+04 | ? | Meet |
(2) national yin and yang attribute reference material test
The yin and yang attribute reference material serum dish (N1-N8, P1-P8) of take in the quantitative reference material of the middle inspection HIV of institute nucleic acid country is sample to be tested, adopts the inventive method to detect, and detected result is shown in Fig. 2.Detected result shows, the present invention is all feminine gender for the detected result of negative reference material serum dish N1-N8, all positive for the detected result of positive reference material serum dish P1-P8, meets the quality standard of reference material specification sheets.Show that reagent detection specificity of the present invention meets national code requirement.
(3) national genotype serum looping test
With international NIBSC HIV-1 genotype serum dish, comprise A, B, C, D, AE, F, G, totally 9 genotype such as AG-GH and O etc., as sample to be tested, adopt the inventive method to detect, and detected result is shown in Fig. 3.Detected result shows, the present invention is for A, B, and C, D, AE, F, G, 9 genotype such as AG-GH and O can both effectively detect.Show that genotype fraction of coverage of the present invention at least can contain 9 genotype.
(4) mark distrubed test in
Take middle inspection sensitivity reference material serum dish (B1-B6) and positive reference material serum dish (P1-P8) be sample to be tested, in test sample book, add in HIV and mark, in each sample in mark to add concentration be 100copies.Test result shows, in these 14 pattern detection processes, interior mark detection signal is stable, and interior mark positive rate is 100%.And interior mark does not bring negative impact to B5 serum dish (concentration the is about 100IU/ml) pattern detection of lower concentration.(concentration is about 1x10 to the B1 serum dish of high density simultaneously
6iU/ml) sample is not internally marked to increase yet and is exerted an influence, and result is as Fig. 4.Test result shows, uses interior mark of the present invention to play efficient supervisory function bit to pcr amplification false negative.
To sum up, the present invention compares with current domestic and international conventional post formulation, no matter is in genotype fraction of coverage, in sensitivity, or has very large advantage in the easy degree of operation.The present invention is applicable to clinical blood diagnosis and detection, and the curative effect of monitoring and evaluation medicine, also can be used for blood station, center blood screening and epidemiology survey.
Claims (12)
1. acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantitative determination reagent kit, is characterized in that: the gene amplification site of described test kit is positioned at genomic 5 ' the LTR conservative region of HIV.
2. an acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantitative determination reagent kit, it is characterized in that: test kit comprises paramagnetic particle method nucleic acid extraction kit and HIV nucleic acid amplification test kit, wherein paramagnetic particle method nucleic acid extraction kit comprises that cracking is in conjunction with liquid, rinsing liquid A, rinsing liquid B, rinsing liquid C, elutriant, magnetic bead liquid; HIV nucleic acid amplification test kit comprises mark, the quantitative reference material 1-4 of HIV, negative quality control product, critical positive quality control product, strong positive quality control product in RT-PCR reaction solution, enzyme mixation, HIV-.
3. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, it is characterized in that: in described paramagnetic particle method nucleic acid extraction kit, cracking consists of and contains sodium lauryl sulphate 0.5-2.5% in conjunction with liquid, Triton X-1000.5-2.0ml/100ml, guanidinium isothiocyanate 2-6.0mol/L, 1-10mM/L EDTA(PH7.5); In described paramagnetic particle method nucleic acid extraction kit, rinsing liquid A consists of and contains Triton X-1000.5-2.0ml/100ml, lithium chloride 0.5-1mol/L; In described paramagnetic particle method nucleic acid extraction kit, rinsing liquid B consists of and contains Triton X-1000.5-2.0ml/100ml, Repone K 0.1-0.3mol/L, 60-80% ethanol; In described paramagnetic particle method nucleic acid extraction kit, rinsing liquid C consists of and contains Triton X-1000.5-2.0ml/100ml, sodium-chlor 0.1-0.3mol/L, 60-80% ethanol; In described paramagnetic particle method nucleic acid extraction kit, eluent components is for containing 10mmol/L Tris.HCl(PH8.3), 0.01-0.05%Prolin300; In described paramagnetic particle method nucleic acid extraction kit, magnetic bead liquid consists of the super suitable nanometer magnetic bead of silicon oxide that diameter is 1 μ m, and concentration is 10-40mg/ml.
4. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, is characterized in that: in described HIV nucleic acid amplification test kit, RT-PCR reaction solution comprises for detection of target gene and interior target probe, for amplified target gene and interior target upstream primer and downstream primer, RT-PCR damping fluid; Probe sequence for detection of target gene in HIV nucleic acid amplification test kit is: 5'-ATCTGAGCCTGGGAGCTCTCTGGCTAGCT-'3(SEQ ID NO:1), 5' end is labeled as FAM fluorescence generation group, and 3' end is labeled as BHQ1 fluorescent quenching group; The probe sequence detecting for interior mark is: 5'-CAGACTCCACATCGACCCTACCCGACTGC-'3(SEQ ID NO:2), 5' end is labeled as HEX fluorescence generation group, and 3' end is labeled as BHQ1 fluorescent quenching group; Upstream primer sequence for amplified target gene is: 5'-CCTGTACTGGGTCTCTCTGGTTAG-'3(SEQ ID NO:3); Downstream primer sequence for amplified target gene is: 5'-TCACACAACAGACGGGCACACAC-'3(SEQ ID NO:4); Upstream primer sequence for amplification interior label is: 5'-TTCGATCTCCGTCGAACCTTG-'3(SEQ ID NO:5); Downstream primer sequence for amplification interior label is: 5'-TTCTCAGGACTCCAGTCGCTG-'3(SEQ ID NO:6).
5. a kind of acquired immune deficiency syndrome (AIDS) (HIV-1) high precision nucleic acid quantitative determination reagent kit as described in claim 2 or 4, it is characterized in that: the probe working concentration for detection of target gene in described HIV nucleic acid amplification test kit is 5-20pmol, preferably target gene probe working concentration is 8pmol; For detection of interior target probe working concentration, be 5-20pmol, preferably interior mark probe working concentration is 8pmol; Upstream and downstream primer working concentration for detection of target gene is 10-30pmol, and preferably target gene upstream and downstream primer working concentration is 20pmol; For detection of interior target upstream and downstream primer working concentration, be 5-20pmol, putting on downstream primer working concentration in is preferably 8pmol.
6. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, is characterized in that: in described HIV nucleic acid amplification test kit, RT-PCR damping fluid consists of 50mmol/LTris-HCl(PH8.3), 10mmol/L (NH4)
2sO
4, 75mmol/LKCl, 2.5mmol/LMgSO
4, 0.15mmol/L dNTPs.
7. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, is characterized in that: in described HIV nucleic acid amplification test kit, enzyme mixation comprises reversed transcriptive enzyme (M-MLV enzyme), warm start Taq enzyme, uridylic glycosylase (UNG), RNase inhibitor, T4 phage GP32 albumen; Wherein M-MLV enzyme dosage is 50-200U/ person-portion, and warm start Taq enzyme dosage is that the consumption of 3-8U/ person-portion, uridylic glycosylase is that 0.05-0.2U/ person-portion, RNase inhibitor consumption are that 5-10U/ person-portion, T4 phage GP32 albumen consumption are 1-5 μ g/ person-portion.
8. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, is characterized in that: in described test kit, in HIV-, mark is by sequence 5'-TTCGATCTCCGTCGAACCTTGCACTCTGCATCCTGGACTCATGCTGACTGCAG ACTCCACATCGACCCTACCCGACTGCTCTACTGCACTCCTGCGTCATCACGCGACT GGAGTCCTGAGAA-'3(SEQ ID NO:7) be inserted into pUC18T carrier and the recombinant chou that forms; In HIV, mark plasmid working concentration is 100-500copies/ time, and preferably working concentration is 100copies/ time.
9. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, it is characterized in that: in described test kit, negative quality control product is the negative people of deactivation source blood plasma, the quantitative reference material 1-4 of HIV, critical positive quality control product and strong positive quality control product form by containing the dilution of HIV RNA fragment pseudovirion, and dilution matrix is the negative people of deactivation source blood plasma; Concentration is respectively 1.0 * 10
7, 1.0 * 10
6, 1.0 * 10
5, 1.0 * 10
4, 1.0 * 10
3, 1.0 * 10
6iU/ml.
10. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kit, it is characterized in that: described test kit need to carry out RT-PCR reaction, the optimal reaction temperature of its amplification and time are: 55 ℃ of reverse transcription 20min, 1 circulation; 95 ℃ of 5min, 1 circulation; Last 94 ℃ of 10s, 60 ℃ of 30s, 42 circle collection fluorescent signals.
11. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kits, is characterized in that: it is serum and plasma that described test kit detects sample type; The detection sensitivity of test kit is 100IU/ml, and detection linearity range is 500-1 * 10
9iU/ml.
12. a kind of acquired immune deficiency syndrome (AIDS) as claimed in claim 2 (HIV-1) high precision nucleic acid quantitative determination reagent kits, is characterized in that: described fluorescence quantitative RT-RCR testing process has been used two enzyme one-step law technologies of M-MLV+Taq enzyme to carry out reverse transcription and amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310681720.4A CN103667534B (en) | 2013-12-12 | 2013-12-12 | High-accuracy quantitative detection method and kit for HIV-1 nucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310681720.4A CN103667534B (en) | 2013-12-12 | 2013-12-12 | High-accuracy quantitative detection method and kit for HIV-1 nucleic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667534A true CN103667534A (en) | 2014-03-26 |
| CN103667534B CN103667534B (en) | 2015-03-25 |
Family
ID=50306304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310681720.4A Active CN103667534B (en) | 2013-12-12 | 2013-12-12 | High-accuracy quantitative detection method and kit for HIV-1 nucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667534B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN107326102A (en) * | 2017-08-01 | 2017-11-07 | 广西中医药大学附属瑞康医院（广西中西医结合医院） | A kind of AIDS kit |
| CN107523648A (en) * | 2017-07-26 | 2017-12-29 | 李桂秋 | A kind of human immunodeficiency virus nucleic acid quantitative determination reagent kit |
| CN108998570A (en) * | 2018-08-14 | 2018-12-14 | 首都医科大学附属北京佑安医院 | HIV-1 total DNA quantitative detection primer pair, probe and the detection kit of more hypotypes can be covered |
| CN112159866A (en) * | 2020-04-03 | 2021-01-01 | 苏州艾可瑞斯生物科技有限公司 | Preparation method of HIV-1 nucleic acid detection quality control product based on influenza virus vector |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009128960A2 (en) * | 2008-01-14 | 2009-10-22 | Ultrapid Nanodiagnostics, Inc. | Rapid test including genetic sequence probe |
| CN103074446A (en) * | 2013-01-10 | 2013-05-01 | 湖南圣湘生物科技有限公司 | Human immunodeficiency virus (HIV) nucleic acid detection kit |
| CN103276091A (en) * | 2013-06-05 | 2013-09-04 | 杭州市儿童医院 | Kit for detecting proviral DNA (Deoxyribonucleic Acid) of HIV (Human Immunodeficiency Virus) |
-
2013
- 2013-12-12 CN CN201310681720.4A patent/CN103667534B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009128960A2 (en) * | 2008-01-14 | 2009-10-22 | Ultrapid Nanodiagnostics, Inc. | Rapid test including genetic sequence probe |
| WO2009128960A3 (en) * | 2008-01-14 | 2010-03-11 | Ultrapid Nanodiagnostics, Inc. | Rapid test including genetic sequence probe |
| CN103074446A (en) * | 2013-01-10 | 2013-05-01 | 湖南圣湘生物科技有限公司 | Human immunodeficiency virus (HIV) nucleic acid detection kit |
| CN103276091A (en) * | 2013-06-05 | 2013-09-04 | 杭州市儿童医院 | Kit for detecting proviral DNA (Deoxyribonucleic Acid) of HIV (Human Immunodeficiency Virus) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN107523648A (en) * | 2017-07-26 | 2017-12-29 | 李桂秋 | A kind of human immunodeficiency virus nucleic acid quantitative determination reagent kit |
| CN107326102A (en) * | 2017-08-01 | 2017-11-07 | 广西中医药大学附属瑞康医院（广西中西医结合医院） | A kind of AIDS kit |
| CN108998570A (en) * | 2018-08-14 | 2018-12-14 | 首都医科大学附属北京佑安医院 | HIV-1 total DNA quantitative detection primer pair, probe and the detection kit of more hypotypes can be covered |
| CN108998570B (en) * | 2018-08-14 | 2021-11-02 | 首都医科大学附属北京佑安医院 | HIV-1 total DNA quantitative detection primer pair, probe and detection kit capable of covering multiple subtypes |
| CN112159866A (en) * | 2020-04-03 | 2021-01-01 | 苏州艾可瑞斯生物科技有限公司 | Preparation method of HIV-1 nucleic acid detection quality control product based on influenza virus vector |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667534B (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103642942B (en) | A kind of hepatitis C virus (HCV) high precision nucleic acid quantitative determination reagent kit | |
| La Marca et al. | Testing for SARS-CoV-2 (COVID-19): a systematic review and clinical guide to molecular and serological in-vitro diagnostic assays | |
| CN103642941B (en) | A kind of hepatitis B virus (HBV) nucleic acid quantitative determination reagent kit | |
| Diao et al. | Accuracy of a nucleocapsid protein antigen rapid test in the diagnosis of SARS-CoV-2 infection | |
| Shen et al. | A rapid and sensitive recombinase aided amplification assay to detect hepatitis B virus without DNA extraction | |
| Zhou et al. | Advancements in detection of SARS-CoV-2 infection for confronting COVID-19 pandemics | |
| Sampson et al. | A four-biomarker blood signature discriminates systemic inflammation due to viral infection versus other etiologies | |
| Rockett et al. | Detection of novel polyomaviruses, TSPyV, HPyV6, HPyV7, HPyV9 and MWPyV in feces, urine, blood, respiratory swabs and cerebrospinal fluid | |
| CN103667534B (en) | High-accuracy quantitative detection method and kit for HIV-1 nucleic acid | |
| CN103898239B (en) | A kind of with pipe detection HTLV-I and the proviral primer of HTLV-II and method | |
| Butler et al. | High prevalence of hepatitis delta virus in Cameroon | |
| Yang et al. | Pandemic H1N1 and seasonal H3N2 influenza infection in the human population show different distributions of viral loads, which substantially affect the performance of rapid influenza tests | |
| Lei et al. | Different methods of COVID-19 detection | |
| Coller et al. | Chronic human Pegivirus 2 without Hepatitis C virus co-infection | |
| Raymond et al. | Performance comparison of next-generation sequencing platforms for determining HIV-1 coreceptor use | |
| Besombes et al. | Performances of NeuMoDx™, a random-access system for hepatitis B virus DNA and hepatitis C virus RNA quantification | |
| Kapoor et al. | Validation of the VirCapSeq-VERT system for differential diagnosis, detection, and surveillance of viral infections | |
| Chang et al. | Field evaluation of Abbott Real Time HIV-1 Qualitative test for early infant diagnosis using dried blood spots samples in comparison to Roche COBAS Ampliprep/COBAS TaqMan HIV-1 Qual test in Kenya | |
| CN104846116A (en) | PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method | |
| CN112011605B (en) | Use of microbial flora in disease diagnosis | |
| Poljak | Simplification of hepatitis C testing: a time to act | |
| Kalita et al. | Effectiveness of Different Gene-Target Strategies for SARS-CoV-2 Screening by RT-PCR and Other Modalities: A Scoping Review | |
| Bhattacherjee et al. | COVID‐19 Diagnostics: Current Approach, Challenges, and Technology Adaptation | |
| Hazazi et al. | Hepatitis C Virus Genotyping in Saudi Population | |
| Yang et al. | Development and validation of a simple and rapid method for hepatitis C virus genotyping based on one‑step RT‑qPCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |