CN104846116A - PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method - Google Patents
PCR primer groups and probe used for detecting human immunodeficiency virus type I, kit containing PCR primer groups and probe, and detection method Download PDFInfo
- Publication number
- CN104846116A CN104846116A CN201510175465.5A CN201510175465A CN104846116A CN 104846116 A CN104846116 A CN 104846116A CN 201510175465 A CN201510175465 A CN 201510175465A CN 104846116 A CN104846116 A CN 104846116A
- Authority
- CN
- China
- Prior art keywords
- seq
- hiv
- dna
- probe
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
- C12Q1/703—Viruses associated with AIDS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- AIDS & HIV (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses PCR primer groups and a probe used for detecting human immunodeficiency virus type I, a kit containing the PCR primer groups and the probe, and a detection method. The kit contains the high sensitivity primer groups and the probe. According to the detection method, multiple circulation is designed, and temperature is increased to a primer annealing temperature, and extremely high sensitivity and specificity are achieved. According to the minimum detection limit, in each time of detection, 2 copies HIV-1 DNA/ millions of cells can be realized, and sensitivity of the detection method is higher than that of other detection methods. A cell quantitative system is introduced into the detection method, so that quantification of HIV-1 DNA and cell number can be realized simultaneously in a same reaction. A quantitative standard substance is added into the kit so as to solve a problem of HIV DNA auantitative traceability in the prior art, wherein the quantitative standard substance is simple to prepare, is stable, and is reliable in traceability. The PCR primer groups, the probe, the kit, and the detection method can be used for HIV infection early detection, HIV infection screening of infants or high risk groups, HIV-1 virus repository detection, antiviral drug therapeutic effect evaluation, disease relapse control, and radical cure standard establishment; operation is simple; cost is low; clinical application prospect is promising; and it is beneficial for popularization and application.
Description
Technical field
The invention belongs to field of virus detection, relate to a kind of detect human immunodeficiency virus type 1 PCR primer group, probe and test kit thereof and detection method.
Background technology
Acquired immune deficiency syndrome (AIDS) and acquired immune deficiency syndrome (AIDS) (acquired immunodeficiency syndrome, AIDS), it is a kind of chronic lethal sexually transmitted disease, by human immunodeficiency virus (human immunodeficiency virus, HIV) cause, be divided into human immunodeficiency virus type 1 (HIV-1) and human immunodeficiency virus 2 type (HIV-2), HIV-1 is that the current whole world comprises the popular main strain of China, and HIV-2 type is only popular in West Africa at present.Human immunologic function's defect is caused after HIV, thus a series of clinical syndrome such as generator opportunistic infections and tumour, case fatality rate almost reaches 100%.According to 2011 annual datas, acquired immune deficiency syndrome (AIDS) has involved the multiple countries and regions of global 200d, and the infected's sum dies from acquired immune deficiency syndrome (AIDS) more than 6,000 ten thousand, 2,000 ten thousand people.Due to this disease latent period long, disguised strong, route of transmission is diversified, case fatality rate is high, at present both without curable medicine also without effective vaccine prevention, bring exceptional hardship to preventing and controlling.
China is in HIV/AIDS at present and is widely current the phase, government takes a series of firm measure, effectively control illegal blood collecting and supplying behavior, blood use safety is ensured to greatest extent, but be not well controlled through injecting drugs with through the impetus of the HIV that spreads through sex intercourse, especially spread through sex intercourse and become main mode of transmission, and occurred that in some areas the s-generation of HIV person propagates (spreading through sex intercourse in mother-to-baby transmission, family), to the effect played undoubtedly and add fuel to the flames that runs rampant of national HIV/AIDS.According to the treatment standard of country's up-to-date promulgation in 2014, wherein need more than 8 one-tenth to carry out immediately and even lifelong HAART (Highly active antiretroviral therapy, HAART), all serious challenge is formed in many-sides such as Gong Wei, clinical, legislation, public security.Expand HIV to detect and antiviral therapy, early examine and early control, reduction is new sends out number and case fatality rate, the strategic objective of the overall prevention and control of acquired immune deficiency syndrome (AIDS) since being China " 12 ".
Mainly there is following problem in HIV detection both at home and abroad at present:
(1) " window phase " (to producing antibody in body and reaching between the level of detecting during this period of time after referring to infect, period has infectivity but antibody test is feminine gender, affects by different detection method and individual difference) and early diagnosis.HIV determines after infecting that the order that the virus marker thing infected occurs successively is: viral nucleic acid (RNA and proviral DNA), viral protein (as p24 antigen), antiviral antibody.At present, the main still antibody serum of domestic and international HIV conventional sense detects (ELISA, WB).This technology built vertical more than 20 years, mature and reliable, but always by the puzzlement of so-called " window phase " problem, " window phase " is general more than 40 days.Detection of nucleic acids aspect, because virus marker thing occurs more early, window phase reach has the incomparable advantage of antibody test technology.But limit by sensitivity, current peripheral blood serum HIV RNA detects, and (the virus load detection kit detection limit gone on the market both at home and abroad is at present between 20 ~ 200 copies/mL) still has about 11 days window phases.
Although HIV-1 is retrovirus, the virion with infectivity is after RNA, HIV enter human body, can enter into CD4+ T cell, the reversed transcriptive enzyme reverse transcription by self is DNA, namely usually said provirus, then be incorporated in the genome of cell, thus infect T cell.The domestic HIV-1 kit for detecting nucleic acid gone on the market diagnoses whether HIV (human immunodeficiency virus) infection by the HIV RNA concentration detected inside blood at present.Infect in early days or carry out in the patient of anti-AIDS treatment, free virus is little, and viral RNA is easily degraded in leaching process, and this kind of test kit is difficult to detect.But still have the HIV virogene of integration in cell, once the immunological competence of people declines or not medication in time, these virions integrated will start to copy, and make PD.
(2) viral storage vault detects.The clinical evaluation of result to HIV antiviral therapy is divided into " thoroughly curing " and " functional healing ".The former requires to realize not carrying out any antiviral therapy for a long time, still can't detect HIV nucleic acid in body; The similar viral elite effector of the latter's effect, still can detect low-level HIV-1 RNA and/or DNA in body, but avoid the infringement of HIV related disorders for a long time.Follow-up research finds, accepts HAART and treats the HIV-1 that in fact always there is another kind of latent form in patient body, i.e. so-called viral storage vault.The Late Cambrian in 1997 such as chun is incorporated into the viral storage vault in static memory CD4+T lymphocyte, and its small portion contains the HIV DNA of integration, can restart to copy-assemble virus under certain stimulates.These latent infection cells are very stable, and therefore viral storage vault has been widely regarded as HAART and cannot removes the major cause of HIV and the biggest obstacle of acquired immune deficiency syndrome (AIDS) healing in patient body.
Viral storage vault main detection technique of being correlated with comprises in recent years: 1. QVOA(Quantitative viral outgrowth assay), have another name called IUPM(Infectious Units Per Million) analyze, within 2005, set up by Siliciano and Siliciano.The method to personnel and equipment requirements higher, expensive, sample requirement amount large (120-180mL blood), waste time and energy, and result accuracy influence factor is numerous, recall rate is on the low side, is not also suitable for biopsy.2. CD4+T lymphocyte count, the CD4/8/3 of employing streaming instrument detects more, but not evidence suggests the change that directly can reflect HIV virus storage vault, waits to solve further with or without certain dependency.3. RNA detects.As above-mentioned, because HAART effectively can control patients blood plasma HIV-1 rna content, even be reduced to the lower bound (20-50 copy/mL) of routine clinical detection below, and RNA detects equipment, personnel and sample extraction requirement higher, therefore it cannot be applied to the detection of viral storage vault.
(3) diagnosis of newborn infant's HIV.Its baby of mother of HIV, due to the existence of maternal antibody, is generally positive with antibody testing method.But in fact only have 20% ~ 60% baby can in the uterus of mother, childbirth and induced labor or by during postpartum breastfeeding from its maternal infection HIV.Neonatal positive can not illustrate it is HIV.Because sustainable about 15 months of parent HIV antibody, in the ordinary course of things, baby does not show any symptom of HIV.Virocyte culture method is not a kind of reliable and practical method to baby; The detection of the special IgM antibody of HIV is also impossible under maternal antibody exists, and the HIV antigen detected in serum under excessive serum antibody exists is also very difficult.The early diagnosis carrying out HIV to these reliable nuclei aoid methods for baby is very important.In addition, infant is very fast by PD after HIV, and early diagnosis, to taking remedy measures in time, delays to stop PD very important.
In sum, traditional HIV detection method, is limited to " window phase ", consuming time, cost and sample and requires the features such as high and detection sensitivity is low, need a kind of HIV DNA detection method developing high sensitivity badly.Rarely seen both at home and abroad at present have HIV DNA detection test kit, and the HIV DNA PCR detection method sensitivity having article to report all copies HIV DNA or more in every 1,000,000 cell detection to 10.
Summary of the invention
In order to solve the problem, the present invention filters out primer sequence and the detection probes of highly sensitive and high specific by lot of experiments, and specific PCR response procedures and condition, construct high responsive HIV-1 DNA PCR detection kit and detection method, lowest detectable limit can reach each reaction can detect 2 copy HIV-1 DNA/ 1,000,000 cells.
The object of the present invention is to provide the PCR primer detecting human immunodeficiency virus type 1.
Another object of the present invention is to provide a kind of PCR detection kit detecting human immunodeficiency virus type 1.
Another object of the present invention is the PCR detection method providing a kind of detection human immunodeficiency virus type 1.
The technical solution used in the present invention is:
Detect the PCR primer group of human immunodeficiency virus type 1, this primer sets is primer sets 1 or primer sets 2 or primer sets 3, wherein,
Primer sets 1 is made up of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6;
Primer sets 2 is made up of SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11;
Primer sets 3 is made up of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13 and SEQ ID NO:14.
Detect the PCR detection probes of human immunodeficiency virus type 1, its sequence is: SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22; Or be the nucleotide complementary sequence of those sequences.
Further, above-mentioned probe sequence 5 ' holds the fluorophor of mark to be a kind of in FAM, HEX, VIC, CY5, TET, and probe sequence 3 ' holds the quenching group of mark to be a kind of in TAMRA, MGB, BHQ.
Detect a PCR detection kit for human immunodeficiency virus type 1, this test kit contains at least one group of primer sets described above.
Further, mentioned reagent box is also containing detection probes; Concrete probe conditions is as follows:
When containing primer sets 1 in test kit, this test kit is just also containing probe SEQ ID NO:15 or its nucleotide complementary sequence;
When containing primer sets 2 in test kit, just also containing at least one probe in the nucleotide complementary sequence of probe SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 or those sequences in this test kit;
When in test kit containing primer sets 3 time, at least one probe in the nucleotide complementary sequence just also containing probe SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or those sequences in this test kit.
Further, mentioned reagent box is also containing cell quantification primer sets and cell quantification probe, and described cell quantification primer sets is made up of SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26; Described probe is for containing SEQ ID NO:27 or being its nucleotide complementary sequence;
The fluorophor that cell quantification probe sequence marks can be selected from FAM, HEX, VIC, CY5, TET, but is different from the fluorophor of above-mentioned testing goal gene probe.
Further, mentioned reagent box also contains: robust positive control product, weak positive reference substance, negative controls, positive qualitative reference product and contain
taqthe enzyme system of enzyme and UNG enzyme.
Further, above-mentioned positive qualitative reference product are 8E5 or Ach2 cell strain genome, for simultaneously to HIV DNA and cell count quantitative.
Detect a PCR detection method for human immunodeficiency virus type 1, it is characterized in that: comprise the following steps:
1) DNA extraction:
Get whole blood sample to be measured, negative quality control product, weak positive quality control product, strong positive quality control product, each 200 μ l of positive qualitative reference product, QIAamp DNA Blood Mini Kit is used to extract test kit, by specification operates, and the DNA of point extraction each group of sample is as template;
2) PCR reaction system:
PCR reaction solution 29.2 μ L;
Enzyme system 0.8 μ L;
DNA profiling 20 μ L;
3) PCR response procedures:
For ABI7500, the first step: 37 DEG C 5 minutes; Second step: 95 DEG C 10 minutes; 3rd step: 95 DEG C 15 seconds, 62 ~ 68 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulations; 4th step: 95 DEG C 15 seconds, 62 ~ 65 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulations; 5th step: 95 DEG C 15 seconds, 60 DEG C 1 minute, 40 circulations; Fluorescence is gathered when 60 DEG C;
4) interpretation of result:
Reaction terminates rear automatic saving result, analyzes respectively the amplification curve of HIV-1 DNA and the curve of corresponding cell amplification; Click Analyze to analyze, make the canonical plotting under Std Curve window reach best, namely Correlation numerical value is between-1.0 ~-0.98, records quantitative result under then arriving Plate window;
In cell, HIV-1 DNA content result calculates:
With in a sample, with the quantitative HIV-1 DNA quantitative values of 2 typical curves divided by cell quantification value, to draw in sample HIV-1 DNA content in each cell.
Further, in above-mentioned whole testing process, need ensure that each sample meets following specification of quality:
1. negative quality control product: HIV-1 DNA cloning curve shows without CT value;
2. weak positive reference material: detected value is between 0.00005 ~ 0.005copies/cell;
3. strong positive reference material: detected value is between 0. 05 ~ 0.5copies/cell;
4. the result of positive qualitative reference product is the positive, Ct value < 30, and 2 typical curve linearly dependent coefficient 0.98≤r≤1;
More than require to need meeting in once testing, otherwise this experiment is invalid, need re-start simultaneously.
The invention has the beneficial effects as follows:
1) height of the present invention responsive HIV-1 DNA PCR detection kit minimum detectability can reach each reaction and can detect 2 copy HIV-1 DNA/ 1,000,000 cells;
2) the responsive HIV-1 DNA PCR detection kit of height of the technology of the present invention exploitation and detection method thereof detection method can simultaneously to HIV-1 DNA and cell count quantitative;
3) the responsive HIV-1 PCR detection kit of the height of the technology of the present invention exploitation and detection method thereof are due to characteristics such as high sensitivities, and its clinical application is extensive, can be used for: 1. HIV-1 infects early detection; 2. newborn infant or the examination of high risk population's HIV; 3. HIV-1 virus storage vault detects; 4. antiviral treatment curative effect evaluation, disease relapse control and thoroughly criterion of cure foundation.
4) in the method for the invention, conventional fluorescent probe PCR is innovated, by adding 3 pairs of PCR primer, adopt multiple circulation, and improve primer annealing temperature, make HIV-1 DNA PCR detection method of the present invention reach high sensitivity and specificity, wherein minimum detectability can reach in each PCR and detect 2 copy/hundred ten thousand cells.Meanwhile, the present invention also adds cell quantification reaction system in PCR reaction, can carry out quantitatively (ordinary method needs to count cell concentration in addition) in same PCR reaction to HIV-1 DNA and cell count simultaneously.Moreover, the inventive method adopts 8E5 or Ach2 cell strain gradient concentration genome as plasmid standards for quantitation, owing to all only incorporating a HIV-1 DNA in each 8E5 or Ach2 cell, therefore by 8E5 or Ach2 genomic RNA number in OD value quantitative assay standard substance, the corresponding HIV-1 DNA copy number of plasmid standards for quantitation can be obtained, solve the quantitative traceability problem of HIV-1 DNA, and preparation method is reliable and stable.
Accompanying drawing explanation
Fig. 1 is reagent typical curve amplification figure of the present invention;
Fig. 2 is the specificity experiments figure of embodiment 4;
Fig. 3 is the sensitivity experiment figure of embodiment 5;
Fig. 4 is the linear quantitative regression curve of embodiment 5.
Embodiment
Below in conjunction with specific embodiment, the present invention is further illustrated, but be not limited thereto
embodiment 1: the PCR primer group detecting human immunodeficiency virus type 1 DNA
The present invention is in earlier stage by design of primers principle and in conjunction with practical situation, design a large amount of PCR primer detecting human immunodeficiency virus type 1 DNA, then primer sequence and the detection probes of highly sensitive and high specific is filtered out by lot of experiments, finally choose the PCR primer group detecting human immunodeficiency virus type 1 DNA best results, comprising 3 groups, its nucleotide sequence is as follows respectively:
Primer sets 1:
SEQ ID NO:1: TCTGGCTAACTAGGGAACCCACTGCT ；
SEQ ID NO:2：TGCGCGCTTCAAGCCGAGTCCTGCGT；
SEQ ID NO:3：AGGGAACCCACTGCTTAAGCCTCAATAAAGCT；
SEQ ID NO:4：AGCAAGCCGAGTCCTGCGTCGAGA ；
SEQ ID NO:5：AGCCTCAATAAAGCTTGCCT ；
SEQ ID NO:6：CCGCCACTGCTAGAGATTTTCCA；
The detection probes of corresponding primer sets 1 is: SEQ ID NO:15:TCTGGTAACTAGAGATCCCT or the nucleotide complementary sequence for this sequence.
Primer sets 2:
SEQ ID NO:2：TGCGCGCTTCAAGCCGAGTCCTGCGT；
SEQ ID NO:7：GGTTAGACCAGATCTGAGCCTGGGAGCT ；
SEQ ID NO:8：GGAACCCACTGCTTAAGCCTCAATAAAGCTTGC；
SEQ ID NO:9：TGTTCGGGCGCCACTGCTAGAGA；
SEQ ID NO:10：AAGCCTCAATAAAGCTTGCCTTGA ；
SEQ ID NO:11：AGGGTCTGAGGGATCTCTAGTTACCAGAG；
The detection probes of corresponding primer sets 2 is selected from least one in following probe sequence:
SEQ ID NO:16：TTCAAGTAGTGTGTGCCC ；
SEQ ID NO:17：AGTAGTGTGTGCCCGTCT；
SEQ ID NO:18：TAGTGTGTGCCCGTCTGT；
Or be the nucleotide complementary sequence of those sequences;
Primer sets 3:
SEQ ID NO:4：AGCAAGCCGAGTCCTGCGTCGAGA；
SEQ ID NO:6：CCGCCACTGCTAGAGATTTTCCA；
SEQ ID NO:10：AAGCCTCAATAAAGCTTGCCTTGA；
SEQ ID NO:12：ACCAGATCTGAGCCTGGGAGCT ；
SEQ ID NO:13：GCTAACTAGGGAACCCACTGCT；
SEQ ID NO:14：TTCGGGCGCCACTGCTA；
The detection probes of corresponding primer sets 3 is selected from least one in following probe sequence:
SEQ ID NO:19：TGTTGTGTGTGACTCTGGTAACTAGAGA ；
SEQ ID NO:20：TGTTGTGTGTGACTCTGGTAACTA；
SEQ ID NO:21：TGTGTGTGACTCTGGTAACTAGAGA；
SEQ ID NO:22：TGTTGTGTGTGACTCTGGTAACTAG；
Or be the nucleotide complementary sequence of those sequences.
embodiment 2: the PCR detection kit detecting human immunodeficiency virus type 1
The PCR detection kit detecting human immunodeficiency virus type 1 comprises following composition:
1) containing at least one group of primer sets described in embodiment 1;
2) containing detection probes:
When containing primer sets 1 in test kit, this test kit is just also containing probe SEQ ID NO:15 or its nucleotide complementary sequence;
When containing primer sets 2 in test kit, just also containing at least one probe in the nucleotide complementary sequence of probe SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 or those sequences in this test kit;
When in test kit containing primer sets 3 time, at least one probe in the nucleotide complementary sequence just also containing probe SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or those sequences in this test kit.
Probe sequence 5 ' hold mark fluorophor be in FAM, HEX, VIC, CY5, TET any one, probe sequence 3 ' hold mark quenching group be in TAMRA, MGB, BHQ any one.
3) cell quantification primer sets and cell quantification probe, its sequence is respectively:
Cell quantification primer sets sequence is:
SEQ ID NO:23：CGGGGTCACCCACACTGTGCCCATCTACG；
SEQ ID NO:24：GGTCACCCACACTGTGCCCATCTACG；
SEQ ID NO:25：CCACACTGTGCCCATCTACGA；
SEQ ID NO:26：GCGCTCGGTGAGGATCTT C；
Cell quantification probe sequence is:
SEQ ID NO:27:ATGCCCTCCCCCATGCCATCCT or be its nucleotide complementary sequence;
The fluorophor that cell quantification probe sequence marks can be selected from FAM, HEX, VIC, CY5, TET, but is different from 2) described in the mark fluorescent group of probe.
4) PCR reaction solution: containing 15 ~ 25mM Tris-HCl (pH8.0), 15 ~ 25mM KCl, 2.5 ~ 5mM (NH
4) SO
4, 2 ~ 5mM MgCl
2, 0.5 ~ 2mM dNTP/UTP Mix, 200 ~ 600Nm HIV-1 DNA primer group, 100 ~ 300nM HIV-1 DNA probe, 200 ~ 600nM cell quantification primer sets, 100 ~ 300nM cell quantification probe.
5) also containing enzyme system (
taqenzyme mixes with UNG enzyme), strong positive quality control product, weak positive quality control product, negative controls and positive qualitative reference product.Wherein, negative quality control product is physiological saline; Strong positive quality control product and weak positive quality control product for containing HIV-1 gene order and containing cell quantification amplification gene sequence plasmid, and in strong positive quality control product and weak positive quality control product the concentration of HIV-1 gene respectively between 0.05 ~ 0.5 copies/cell and 0.0005 ~ 0.005 copies/cell.
embodiment 3: the detection method detecting human immunodeficiency virus type 1 PCR detection kit
The detection kit utilizing embodiment 2 to set up, detects detected sample, and step is as follows:
1) DNA extraction:
Get whole blood sample to be measured, negative quality control product, weak positive quality control product, strong positive quality control product, each 200 μ l of positive qualitative reference product, QIAamp DNA Blood Mini Kit is used to extract test kit, middle whole blood sample extraction step operation to specifications, elution volume is 100uL, and the DNA respectively in extraction acquisition each group of sample is as follow-up pcr template;
2) PCR reaction system:
PCR reaction solution 29.2 μ L;
Enzyme system 0.8 μ L;
DNA profiling 20 μ L;
3) PCR response procedures:
For ABI7500, the first step: 37 DEG C 5 minutes; Second step: 95 DEG C 10 minutes; 3rd step: 95 DEG C 15 seconds, 62 ~ 68 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulations; 4th step: 95 DEG C 15 seconds, 62 ~ 65 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulations; 5th step: 95 DEG C 15 seconds, 60 DEG C 1 minute, 40 circulations; Fluorescence is gathered when 60 DEG C;
4) interpretation of result:
Reaction terminates rear automatic saving result, analyzes respectively the amplification curve of HIV-1 DNA and the curve of corresponding cell amplification.According to the Value value of the Start value of image adjustment Baseline, End value and Threshold after analyzing, (user can according to practical situation from Row sum-equal matrix, Start value can at 1-10, Stop value can at 5-20, adjust the amplification curve of negative quality control product straight or lower than threshold line), click Analyze to analyze, make the canonical plotting under Std Curve window reach best, namely Correlation numerical value is between-1.0 ~-0.98.Then quantitative result is recorded under arriving Plate window.
In cell, HIV-1 DNA content result calculates:
With in a sample, with the quantitative HIV-1 DNA quantitative values (unit: copies/ μ L) of 2 typical curves divided by cell quantification result (unit: cells/ μ L), to draw in sample HIV-1 DNA content (unit: copies/cell) in each cell.
5) quality control
In whole testing process, need ensure that each sample meets following specification of quality:
1. negative quality control product: HIV-1 DNA cloning curve shows without CT value;
2. weak positive reference material: detected value is between 0.00005 ~ 0.005copies/cell;
3. strong positive reference material: detected value is between 0. 05 ~ 0.5copies/cell;
4. the result of positive qualitative reference product (FAM passage and VIC passage) is the positive, Ct value < 30, and 2 typical curve linearly dependent coefficient 0.98≤r≤1.
Typical curve amplification as shown in Figure 1.Redness is the amplification of HIV-1 DNA quantitation curves; Green is the amplification of cell quantification typical curve.
embodiment 4: specificity experiments
124 routine HIV-1 ' negative ' specimens or healthy population sample are detected, ' negative ' specimens comprises the nucleic acid extracted for HBV, herpes simplex types 1 virus, herpes simplex types 2 viral, varicella zoster virus, Epstein-Barr virus, cytomegalovirus, 6 herpes simplex virus types, hepatitis A virus, hepatitis C virus, yellow fever virus, human T-leukemia virus 1 type and 2 types, Coxsackie B virus 3 and intestinal bacteria and detects, result is shown as feminine gender (100%) (as shown in Figure 2, redness is HIV-1 DNA cloning, is feminine gender; Green is cell quantification amplification).Above result proves that the inventive method has good specificity.
embodiment 5: sensitivity and linearity range experiment
(1) the PCR detection kit sensitivity analysis of human immunodeficiency virus type 1 DNA
HIV negative cells being diluted 8E5 cell (incorporating 1 copy HIV-1 DNA in genome) is every 1 × 10 to concentration
6containing 10 8E5 cells (being equivalent to detect 2 copy HIV-1 DNA during each PCR reacts) in individual cell, the test kit of embodiment 3 and detection method is adopted to detect HIV-1 DNA.As shown in Figure 3, by repeatedly duplicate detection, minimum detectability of the present invention (detecting 2 copy HIV-1 DNA/ 1,000,000 cells in each PCR reaction) recall rate can reach 96% to detected result.
(2) linearity range of the PCR detection kit of human immunodeficiency virus type 1 DNA
HIV negative cells being diluted 8E5 cell (incorporating 1 copy HIV-1 DNA in genome) is containing 1 × 10 in every 1,000,000 cells to concentration
6, 1 × 10
5, 1 × 10
4, 1 × 10
3, 1 × 10
2with 10 8E5 cells, adopt the test kit of embodiment 3 and detection method to detect HIV-1 DNA, get its detected value and average carries out result calculating and judgement.Carry out data through operability inspection and multinomial regression analysis, and after precision test, determine in sensing range, this reagent result is linear.Net result show linear coverage be the linear regression curves figure of 0.00001 ~ 1 copies/cell, HIV-1 quantitation curves as shown in Figure 4, R
2=0.995.
(3) the comparing of detection method and conventional fluorescent PCR
Utilize embodiment 5(2) described dilution process, 200,100,20,10,5 and 2 8E5 cells are contained respectively by 8E5 cell dilution to every 1,000,000 cells, by detection method described in embodiment 3, after nucleic acid extraction, carry out detection method and the detection of conventional fluorescent PCR method respectively.The positive rate that result conventional fluorescent PCR method detects is respectively: 100%, 95%, 50%, 25%, 10% and 0%; The inventive method Positive rate is respectively: 100%, 100%, 100%, 95%, 60%, 20%.
embodiment 6: clinical samples detects
in detection method faggotry crowd, HIV Screening tests and Western Blot method contrast (accuracy)
HIV Western Blot detection method is at present by as HIV diagnosis method.By cooperating with CDC AIDS prevention and control center, Shenzhen, detect 191 routine faggotry's whole blood samples by HIV-1 DNA detection kit of the present invention and Western Blot detection method, result is as table 1 simultaneously:
The inventive method and WB detection method consistence 99.0% as seen from Table 1.Its 2 routine samples be not inconsistent (the present invention detects and is the positive, and WB detects and is feminine gender), are confirmed that it is the HIV-1 positive through CD4+/CD8+ cell counts.This Comparative result further demonstrate that the present invention is in the sensitivity of detection method and accuracy.
<110> Guangzhou Supbio Bio-Technology Co., Ltd.
<120> detects the PCR primer group of human immunodeficiency virus type 1, probe and test kit thereof and detection method
<130>
<160> 27
<170> PatentIn version 3.5
<210> 1
<211> 26
<212> DNA
The artificial primer of <213>
<400> 1
tctggctaac tagggaaccc actgct 26
<210> 2
<211> 26
<212> DNA
The artificial primer of <213>
<400> 2
tgcgcgcttc aagccgagtc ctgcgt 26
<210> 3
<211> 32
<212> DNA
The artificial primer of <213>
<400> 3
agggaaccca ctgcttaagc ctcaataaag ct 32
<210> 4
<211> 24
<212> DNA
The artificial primer of <213>
<400> 4
agcaagccga gtcctgcgtc gaga 24
<210> 5
<211> 20
<212> DNA
The artificial primer of <213>
<400> 5
agcctcaata aagcttgcct 20
<210> 6
<211> 23
<212> DNA
The artificial primer of <213>
<400> 6
ccgccactgc tagagatttt cca 23
<210> 7
<211> 28
<212> DNA
The artificial primer of <213>
<400> 7
ggttagacca gatctgagcc tgggagct 28
<210> 8
<211> 33
<212> DNA
The artificial primer of <213>
<400> 8
ggaacccact gcttaagcct caataaagct tgc 33
<210> 9
<211> 23
<212> DNA
The artificial primer of <213>
<400> 9
tgttcgggcg ccactgctag aga 23
<210> 10
<211> 24
<212> DNA
The artificial primer of <213>
<400> 10
aagcctcaat aaagcttgcc ttga 24
<210> 11
<211> 29
<212> DNA
The artificial primer of <213>
<400> 11
agggtctgag ggatctctag ttaccagag 29
<210> 12
<211> 22
<212> DNA
The artificial primer of <213>
<400> 12
accagatctg agcctgggag ct 22
<210> 13
<211> 22
<212> DNA
The artificial primer of <213>
<400> 13
gctaactagg gaacccactg ct 22
<210> 14
<211> 17
<212> DNA
The artificial primer of <213>
<400> 14
ttcgggcgcc actgcta 17
<210> 15
<211> 20
<212> DNA
<213> if probes
<400> 15
tctggtaact agagatccct 20
<210> 16
<211> 18
<212> DNA
<213> if probes
<400> 16
ttcaagtagt gtgtgccc 18
<210> 17
<211> 18
<212> DNA
<213> if probes
<400> 17
agtagtgtgt gcccgtct 18
<210> 18
<211> 18
<212> DNA
<213> if probes
<400> 18
tagtgtgtgc ccgtctgt 18
<210> 19
<211> 28
<212> DNA
<213> if probes
<400> 19
tgttgtgtgt gactctggta actagaga 28
<210> 20
<211> 24
<212> DNA
<213> if probes
<400> 20
tgttgtgtgt gactctggta acta 24
<210> 21
<211> 25
<212> DNA
<213> if probes
<400> 21
tgtgtgtgac tctggtaact agaga 25
<210> 22
<211> 25
<212> DNA
<213> if probes
<400> 22
tgttgtgtgt gactctggta actag 25
<210> 23
<211> 29
<212> DNA
The artificial primer of <213>
<400> 23
cggggtcacc cacactgtgc ccatctacg 29
<210> 24
<211> 26
<212> DNA
The artificial primer of <213>
<400> 24
ggtcacccac actgtgccca tctacg 26
<210> 25
<211> 21
<212> DNA
The artificial primer of <213>
<400> 25
ccacactgtg cccatctacg a 21
<210> 26
<211> 19
<212> DNA
The artificial primer of <213>
<400> 26
gcgctcggtg aggatcttc 19
<210> 27
<211> 22
<212> DNA
<213> if probes
<400> 27
atgccctccc ccatgccatc ct 22
Claims (10)
1. detect the PCR primer group of human immunodeficiency virus type 1, this primer sets is primer sets 1 or primer sets 2 or primer sets 3, wherein,
Primer sets 1 is made up of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6;
Primer sets 2 is made up of SEQ ID NO:2, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11;
Primer sets 3 is made up of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:13 and SEQ ID NO:14.
2. detect the PCR detection probes of human immunodeficiency virus type 1, its sequence is: SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22; Or be the nucleotide complementary sequence of those sequences.
3. the PCR detection probes of detection human immunodeficiency virus type 1 according to claim 2, it is characterized in that: probe sequence 5 ' holds the fluorophor of mark to be a kind of in FAM, HEX, VIC, CY5, TET, probe sequence 3 ' holds the quenching group of mark to be a kind of in TAMRA, MGB, BHQ.
4. detect a PCR detection kit for human immunodeficiency virus type 1, it is characterized in that: this test kit contains the primer sets described at least one group of claim 1.
5. a kind of PCR detection kit detecting human immunodeficiency virus type 1 according to claim 4, is characterized in that: this test kit is also containing detection probes; Concrete probe conditions is as follows:
When containing primer sets 1 in test kit, this test kit is just also containing probe SEQ ID NO:15 or its nucleotide complementary sequence;
When containing primer sets 2 in test kit, just also containing at least one probe in the nucleotide complementary sequence of probe SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 or those sequences in this test kit;
When in test kit containing primer sets 3 time, at least one probe in the nucleotide complementary sequence just also containing probe SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 or those sequences in this test kit.
6. a kind of PCR detection kit detecting human immunodeficiency virus type 1 according to claim 4, it is characterized in that: this test kit is also containing cell quantification primer sets and cell quantification probe, and described cell quantification primer sets is made up of SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26; Described probe is for containing SEQ ID NO:27 or being its nucleotide complementary sequence;
The fluorophor that cell quantification probe sequence marks can be selected from FAM, HEX, VIC, CY5, TET, but is different from the fluorophor of probe described in claim 3.
7. a kind of PCR detection kit detecting human immunodeficiency virus type 1 according to claim 4, is characterized in that: this test kit also contains: robust positive control product, weak positive reference substance, negative controls, positive qualitative reference product and contain
taqthe enzyme system of enzyme and UNG enzyme.
8. a kind of PCR detection kit detecting human immunodeficiency virus type 1 according to claim 7, is characterized in that: described positive qualitative reference product are 8E5 or Ach2 cell strain genome, for simultaneously to HIV DNA and cell count quantitative.
9. detect a PCR detection method for human immunodeficiency virus type 1, it is characterized in that: comprise the following steps:
1) DNA extraction:
Get whole blood sample to be measured, negative quality control product, weak positive quality control product, strong positive quality control product, each 200 μ l of positive qualitative reference product, QIAamp DNA Blood Mini Kit is used to extract test kit, by specification operates, and the DNA of point extraction each group of sample is as template;
2) PCR reaction system:
PCR reaction solution 29.2 μ L;
Enzyme system 0.8 μ L;
DNA profiling 20 μ L;
3) PCR response procedures:
For ABI7500, the first step: 37 DEG C 5 minutes; Second step: 95 DEG C 10 minutes; 3rd step: 95 DEG C 15 seconds, 62 ~ 68 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulations; 4th step: 95 DEG C 15 seconds, 62 ~ 65 DEG C 15 seconds, 72 DEG C 20 seconds, 5 ~ 8 circulations; 5th step: 95 DEG C 15 seconds, 60 DEG C 1 minute, 40 circulations; Fluorescence is gathered when 60 DEG C;
4) interpretation of result:
Reaction terminates rear automatic saving result, analyzes respectively the amplification curve of HIV-1 DNA and the curve of corresponding cell amplification; Click Analyze to analyze, make the canonical plotting under Std Curve window reach best, namely Correlation numerical value is between-1.0 ~-0.98, records quantitative result under then arriving Plate window;
In cell, HIV-1 DNA content result calculates:
With in a sample, with the quantitative HIV-1 DNA quantitative values of 2 typical curves divided by cell quantification value, to draw in sample HIV-1 DNA content in each cell.
10. detection method according to claim 9, is characterized in that: in whole testing process, need ensure that each sample meets following specification of quality:
1. negative quality control product: HIV-1 DNA cloning curve shows without CT value;
2. weak positive reference material: detected value is between 0.00005 ~ 0.005copies/cell;
3. strong positive reference material: detected value is between 0. 05 ~ 0.5copies/cell;
4. the result of positive qualitative reference product is the positive, Ct value < 30, and 2 typical curve linearly dependent coefficient 0.98≤r≤1;
More than require to need meeting in once testing, otherwise this experiment is invalid, need re-start simultaneously.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510175465.5A CN104846116B (en) | 2015-04-14 | 2015-04-14 | Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510175465.5A CN104846116B (en) | 2015-04-14 | 2015-04-14 | Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104846116A true CN104846116A (en) | 2015-08-19 |
| CN104846116B CN104846116B (en) | 2018-01-16 |
Family
ID=53846097
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510175465.5A Active CN104846116B (en) | 2015-04-14 | 2015-04-14 | Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104846116B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN107119148A (en) * | 2017-05-09 | 2017-09-01 | 广州海力特生物科技有限公司 | Detect the LTR DNA of HIV 12 PCR primer group, probe and its kit and detection method |
| CN108676916A (en) * | 2018-05-31 | 2018-10-19 | 广州海力特生物科技有限公司 | A kind of HIV usRNA and cell number dual quantitative real-time fluorescent PCR reagent case and its detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074446A (en) * | 2013-01-10 | 2013-05-01 | 湖南圣湘生物科技有限公司 | Human immunodeficiency virus (HIV) nucleic acid detection kit |
-
2015
- 2015-04-14 CN CN201510175465.5A patent/CN104846116B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074446A (en) * | 2013-01-10 | 2013-05-01 | 湖南圣湘生物科技有限公司 | Human immunodeficiency virus (HIV) nucleic acid detection kit |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN107119148A (en) * | 2017-05-09 | 2017-09-01 | 广州海力特生物科技有限公司 | Detect the LTR DNA of HIV 12 PCR primer group, probe and its kit and detection method |
| CN108676916A (en) * | 2018-05-31 | 2018-10-19 | 广州海力特生物科技有限公司 | A kind of HIV usRNA and cell number dual quantitative real-time fluorescent PCR reagent case and its detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104846116B (en) | 2018-01-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101487062A (en) | Reagent kit for synchronously detecting hepatitis, AIDS virus and syphilis helicoid nucleic acid | |
| Springer et al. | How evolution of mutations conferring drug resistance affects viral dynamics and clinical outcomes of cytomegalovirus-infected hematopoietic cell transplant recipients | |
| Li et al. | Clinical manifestations and laboratory assessment in an enterovirus 71 outbreak in southern Taiwan | |
| CN105385787A (en) | Multiplex PCR detection kit for 12 encephalitis virus nucleic acids and application thereof | |
| CN107326100A (en) | Aftosa and the double real-time fluorescence quantitative PCR detection kit of Sai Nika paddy virus | |
| WO2018035860A1 (en) | Multiplex taqman probe qpcr assay kit and method for simultaneous assay and quantitative analysis of four blood-borne viruses | |
| Tavakoli et al. | Detection and typing of enteroviruses from CSF specimens from patients diagnosed with meningitis/encephalitis | |
| Van Doornum et al. | Development and implementation of real‐time nucleic acid amplification for the detection of enterovirus infections in comparison to rapid culture of various clinical specimens | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN104846116B (en) | Detect PCR primer group, probe and its kit and detection method of human immunodeficiency virus type 1 | |
| CN104911277B (en) | A kind of kit and its detection method for detecting human immunodeficiency virus type 1 in dry blood cake sample | |
| CN109439777A (en) | Microspironema pallidum (TP)-PCR fluorescence detection reagent kit | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN115873993A (en) | Kit for detecting 9 genotypes of hepatitis B virus and application thereof | |
| CN103667534B (en) | High-accuracy quantitative detection method and kit for HIV-1 nucleic acid | |
| CN108753768B (en) | Nucleic acid for detecting enterovirus and application thereof | |
| CN105039599A (en) | Primers, probes and kit for typing qualitative detection of hepatitis B virus (HBV) | |
| CN101967524B (en) | Kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR | |
| CN107119148A (en) | Detect the LTR DNA of HIV 12 PCR primer group, probe and its kit and detection method | |
| CN102108420A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN104372111B (en) | FMDV is universal and Asia 1 type bifluorescence quantitative detecting method | |
| CN105648037B (en) | Application of recombinant lentivirus in HIV (human immunodeficiency virus) phenotypic drug resistance detection | |
| CN103602755A (en) | Kit for detecting 20 subtypes of human papillomaviruses by electrochemical gene sensor method | |
| CN110317892A (en) | Rapid detection method and kit of the different genera coccidia to drug susceptibility | |
| Hazazi et al. | Hepatitis C Virus Genotyping in Saudi Population |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |