CN103667495B - A kind of molecular assay method of bluish dogbane male sterile cytoplasm - Google Patents
A kind of molecular assay method of bluish dogbane male sterile cytoplasm Download PDFInfo
- Publication number
- CN103667495B CN103667495B CN201310710653.4A CN201310710653A CN103667495B CN 103667495 B CN103667495 B CN 103667495B CN 201310710653 A CN201310710653 A CN 201310710653A CN 103667495 B CN103667495 B CN 103667495B
- Authority
- CN
- China
- Prior art keywords
- male sterile
- bluish dogbane
- swimming lane
- primer
- assay method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biological technical field, relate to a kind of molecular assay method of bluish dogbane male sterile cytoplasm, the steps include: to utilize ALP(Amplified? Length? Polymorphism) Auele Specific Primer of molecular marking technique carries out PCR reaction, increase the Mitochondrial DNA of bluish dogbane sample to be measured, can amplify the material be containing bluish dogbane male sterile cytoplasm with cytoplasmic male sterile line with identical specific band.Does is described Auele Specific Primer that nucleotide sequence is as SEQID? primer shown in No.3 and 4.The present invention is also provided for the molecule marker MM509 of bluish dogbane male sterile cytoplasm molecular assay method.The present invention adopts ALP molecular marking technique to carry out molecular level polymorphic detection to bluish dogbane male sterile cytoplasm material.The method qualification speed fast, accuracy rate is high, simple to operate, be highly suitable for qualification and the molecular mark of bluish dogbane cytoplasmic male sterile line.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of molecular assay method of bluish dogbane male sterile cytoplasm.
Background technology
Bluish dogbane, also known as " mestha ", is the annual phloem fiber crop of Malvaceae hibiscus.Because it can not be reserved seed for planting naturally in the Yangtze valley and northern area thereof, a large amount of seed will be called in from South China every year by northern numb district.Bluish dogbane shows powerful hybrid vigour, and its dominant ratio is up to 35% ~ 40%.For a long time, bluish dogbane heterosis utilization is the main goal of attack of domestic and international bluish dogbane breeding.The cultivation of sterile line utilizes heterotic important foundation, and wherein cytoplasmic male sterility (cytoplasmicmalesterility is called for short CMS) is common sterile line type.
In September, 2008, " selection of bluish dogbane Yebai cytoplasmic male sterile line " that Guangxi University Zhou Ruiyang invents obtains national inventing patent (ZL200510019454.4).According to said method selected K03A(to see: Gui Ke to reflect No. [2004] 152, word), good fortune 3A, P3A, 917A, 722A, 763A and L23A(be shown in, and: Gui Ke reflects No. [2007] 177, word) etc. 7 cytoplasmic male sterile lines, bluish dogbane heterosis utilization makes a breakthrough.
But in agriculture production, the pandemic risk of a certain disease is there is, because the cross-fertilize seed of this cytoplasmic male sterile line assembly may become the nurture kind of a certain pathogenic micro-organism physiological strain by the spread of the cross-fertilize seed of single cell matter male sterile line assembly and utilization for a long time.The Basic Ways addressed this problem is the male sterile line selecting various kinds of cell matter source, and promotes the three line hybrid seed in different cytoplasm source aborning.
In order to the male sterile cytoplasm that seed selection is new, the method for the existing male sterility maintainer line of general and existing germ plasm resource test cross is screened, and not only workload is very large, and band bears the character of much blindness.
If a kind of molecule marker of male sterile cytoplasm can be found, then this mark can be utilized to identify existing germ plasm resource, to excavate the male sterile cytoplasm resource made new advances, the male sterile line that makes new advances of seed selection then.Greatly will increase work efficiency thus, and be conducive to the intellectual property protection of existing male sterile line and cross-fertilize seed thereof.
About bluish dogbane male sterile cytoplasm molecular assay method, be not reported both at home and abroad.
Summary of the invention
The object of the invention is to solve the problem lacking bluish dogbane male sterile cytoplasm molecular assay method at present, a kind of molecular assay method of bluish dogbane male sterile cytoplasm is provided.
That the present invention adopts is ALP(AmplifiedLengthPolymorphism, amplification length polymorphism) technology, be for specific site design special primer, carry out pcr amplification, detect the DNA polymorphism obtained, with this technology as molecule marker.
The molecular assay method of a kind of bluish dogbane male sterile cytoplasm provided by the invention, concrete steps are as follows:
Carry out PCR reaction with the Auele Specific Primer of ALP molecular marking technique, the Mitochondrial DNA of the bluish dogbane sample to be measured that increases, the material be containing bluish dogbane male sterile cytoplasm with cytoplasmic male sterile line with identical specific band can be amplified;
Described Auele Specific Primer is atp6BQ primer pair:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQIDNo.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQIDNo.4).
Wherein, the reaction system of described PCR is as follows:
Reaction system distilled water supplies cumulative volume 20 μ l.
Wherein, PCR reaction conditions is: 95 DEG C of denaturation 3min; 94 DEG C of 40s, 58 DEG C of 40s, 72 DEG C of 40s, 35 circulations of increasing, 72 DEG C extend 10min.
The present invention is also provided for the atp6BQ primer pair identifying bluish dogbane male sterile cytoplasm:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQIDNo.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQIDNo.4)
The present invention is also provided for the molecule marker MM509 identifying bluish dogbane male sterile cytoplasm, and it is for going out with the primer amplification such as shown in SEQIDNo.3 and SEQIDNo.4 the specific band that length is 509bp.
An also object of the present invention is to provide the application of the molecular assay method of described bluish dogbane male sterile cytoplasm in the seed selection of bluish dogbane cytoplasmic male sterile line.
Another object of the present invention is to provide with described mark or primer the application in qualification bluish dogbane cytoplasmic male sterile line.
The present invention adopts ALP molecular marking technique to carry out the polymorphic detection of molecular level to the bluish dogbane cytoplasmic male sterile line material containing bluish dogbane male sterile cytoplasm, as can be seen from the result of this research, the result band of two kinds of Marker Identifications is clear, stable, reliable, and therefore method of the present invention is highly suitable for identifying the bluish dogbane cytoplasmic male sterile line material containing bluish dogbane male sterile cytoplasm and carrying out the molecular marking supplementary breeding of new bluish dogbane cytoplasmic male sterile line material.
Accompanying drawing explanation
Fig. 1 is that the ALP of bluish dogbane cytoplasmic male sterile line P3A and maintenance line P3B thereof in the embodiment of the present invention 1 analyzes.Fig. 1 a is atp9 molecule marker MM556, wherein, and M:marker, swimming lane 1:P3A, swimming lane 2:P3B.Fig. 1 b is atp6 molecule marker MM509.Wherein, M:marker, swimming lane 1:P3A, swimming lane 2:P3B.
Fig. 2 is with the result that molecule marker MM556 and molecule marker MM509 detects multiple bluish dogbane sterile line, sterile line filial generation, maintenance line, restorer in the embodiment of the present invention 2.Fig. 2 a is molecule marker MM556 detected result, wherein, swimming lane 1-10 is followed successively by: P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299, swimming lane 11-23 is followed successively by: P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), M:marker.Fig. 2 b is molecule marker MM509 detected result, even number swimming lane be followed successively by P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299; Odd number swimming lane is followed successively by P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), M:marker.
Fig. 3 is with the result that molecule marker MM556 detects 65 kinds of bluish dogbane resource materials in the embodiment of the present invention 3.Wherein, Fig. 3 a swimming lane 1:UG93-2-1, swimming lane 2:UG93-2-2, swimming lane 3:UG93-2-3, swimming lane 4:UG93-2-4, swimming lane 5:UG93-2-6, swimming lane 6:UG93-2-22, swimming lane 7:UG93-2MS-1, swimming lane 8:UG93-2MS-2, swimming lane 9:UG93-2MS-3, swimming lane 10:UG93-2MS-4, Maker:DL2000, Fig. 3 b swimming lane 1:KN250, swimming lane 2:KN250-1, swimming lane 3:ID85, swimming lane 4:C1-7-1, swimming lane 5:C1-7-1-1, swimming lane 6:MSI135, swimming lane 7:H094, swimming lane 8:286, swimming lane 9:Fuhonghang5, swimming lane 10:Y3-3-3, swimming lane 11:CK(P3A), swimming lane 12:CK(P3B), Maker:100bpplusladder, swimming lane 13:96, swimming lane 14:09-154, swimming lane 15:F
1(763B/8R), swimming lane 16:09-124, swimming lane 17:09-124, swimming lane 18:ID85, swimming lane 19:BG52-135, swimming lane 20:85-339, Fig. 3 cMaker:DL2000, swimming lane 1:CK(P3A), swimming lane 2:CK(P3B), swimming lane 3:P09-135-1, swimming lane 4:P09-135-2, swimming lane 5:P09-143-1, swimming lane 6:P09-143-2, swimming lane 7:P09-146-1, swimming lane 8:P09-151-1, swimming lane 9:P09-151-2, swimming lane 10:P09-156-1, swimming lane 11:P09-157-2, swimming lane 12:P09-161-1, swimming lane 13:P09-166-1, swimming lane 14:P09-138-3, swimming lane 15:P09-147, swimming lane 16:P09-154, swimming lane 17:P09-165, swimming lane 18:KN142, Fig. 3 d swimming lane 1:liao34zao, swimming lane 2:liao7435, swimming lane 3:Iranearly-maturing, swimming lane 4:7804, swimming lane 5:ZH01, swimming lane 6:zhengxiaoma1, swimming lane 7:7360A, swimming lane 8:ID296, swimming lane 9:ZF69, swimming lane 10:BG154, swimming lane 11:CK(P3A), swimming lane 12:CK(P3B), swimming lane 13:09-87, swimming lane 14:09-89(KB2-3), swimming lane 15:09-90(C19-10-2), swimming lane 16:09-91(Yue152), swimming lane 17:BG155, swimming lane 18:KN8, swimming lane 19:K325, swimming lane 20:Yueyin751, swimming lane 21:ZB90, swimming lane 22:09-7, swimming lane 23:AS226.
Fig. 4 is the electrophorogram checking molecule marker MM556 detected result in the embodiment of the present invention 3 with molecule marker MM509.Fig. 4 a swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:UG93-2MS-1, swimming lane 4:UG93-2MS-2, swimming lane 5:UG93-2MS-3, swimming lane 6:UG93-2MS-4, swimming lane 7:UG93-2-22, swimming lane 8:UG93-2-1, swimming lane 9:UG93-2-2, swimming lane 10:UG93-2-3, swimming lane 11:UG93-2-4, swimming lane 12:UG93-2-5, swimming lane 13:UG93-2-6, swimming lane 14:UG93-2-7, swimming lane 15:UG93-2-8, swimming lane 16:UG93-2-9, swimming lane 17:UG93-2-11, swimming lane 18:UG93-2-12, swimming lane 19:UG93-2-14, swimming lane 20:UG93-2-16, swimming lane 21:UG93-2-17, swimming lane 22:UG93-2-18, swimming lane 23:UG93-2-19, Maker:DL2000, Fig. 4 b swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:KN142, swimming lane 4:P09-135-1, swimming lane 5:P09-135-2, swimming lane 6:P09-143-1, swimming lane 7:P09-143-2, swimming lane 8:P09-146-1, swimming lane 9:P09-151-1, swimming lane 10:P09-151-2, swimming lane 11:P09-156-1, swimming lane 12:P09-157-2, swimming lane 13:P09-161-1, swimming lane 14:P09-166-1, swimming lane 15:P09-138-3, swimming lane 16:P09-147, swimming lane 17:P09-154, swimming lane 18:P09-165, swimming lane 19:N10-59, swimming lane 20:N10-60, swimming lane 21:N10-61, swimming lane 22:N10-75, swimming lane 23:N10-76, Maker:DL2000, Fig. 4 c swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:KN250, swimming lane 4:KN250-1, swimming lane 5:ID85, swimming lane 6:C1-7-1, swimming lane 7:C1-7-1-1, swimming lane 8:MSI135, swimming lane 9:H094, swimming lane 10:286, swimming lane 11:Fuhonghang5, swimming lane 12:Y3-3-3, swimming lane 13:CK (P3A), swimming lane 14:CK (P3B), swimming lane 15:96, swimming lane 16:09-154, swimming lane 17:F
1(763B/8R), swimming lane 18:09-124, swimming lane 19:09-124, swimming lane 20:ID85, swimming lane 21:BG52-135, swimming lane 22:85-339, swimming lane 23:AS226, Maker:DL2000, Fig. 4 d swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:liao34zao, swimming lane 4:liao7435, swimming lane 5:Iranearly-maturing, swimming lane 6:7804, swimming lane 7:ZH01, swimming lane 8:zhengxiaoma1, swimming lane 9:7360A, swimming lane 10:ID296, swimming lane 11:ZF69, swimming lane 12:BG154, swimming lane 13:CK (P3A), swimming lane 14:CK (P3B), swimming lane 15:09-87, swimming lane 16:09-89 (KB2-3), swimming lane 17:09-90 (C19-10-2), swimming lane 18:09-91 (Yue152), swimming lane 19:BG155, swimming lane 20:KN8, swimming lane 21:K325, swimming lane 22:Yueyin751, swimming lane 23:ZB90, Maker:DL2000.
Embodiment
Below in conjunction with embodiment, the specific embodiment of the present invention is described in further detail.Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
The molecular assay method of embodiment 1 bluish dogbane male sterile cytoplasm
The test materials of the present embodiment is bluish dogbane cytoplasmic male sterile line P3A and maintenance line P3B thereof, and be public kind, specifying information is as follows:
P3A: have another name called rich No. 1 A in Guangdong, see patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
P3B: have another name called rich No. 1 B in Guangdong, the male sterility maintainer line of the cytoplasmic male sterile line P3A of Guangxi University teacher Zhou Ruiyang seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
1, bluish dogbane total DNA extraction and purifying
1. the fresh bluish dogbane young leaflet tablet of 100mg is got in mortar, with the rapid grind into powder of liquid nitrogen.
2. proceeded in the EP pipe of 2ml by appropriate powder, the mass percent adding 1ml preheating is the CTAB extracting solution of 15%, puts upside down mixing, in 65 DEG C of insulation 40-60min, shakes 2-3 time therebetween.
3. take out EP pipe, slightly after cooling, add isopyknic phenol/chloroform/primary isoamyl alcohol (volume ratio 25:24:1), put upside down mixing, 4 DEG C, the centrifugal 10min of 12000r/min.
4. get supernatant, the mass percent adding 1/10 volume is the CTAB/NaCl solution of 10%, 65 DEG C of insulation 5-10min.Add isopyknic chloroform/primary isoamyl alcohol (volume ratio is 24:1), put upside down mixing, 4 DEG C, the centrifugal 10min of 12000r/min.
5. repeating step 4., till two-phase interface does not occur white precipitate.
6. get supernatant, add the precooling dehydrated alcohol of 2 times of volumes, mix gently ,-20 DEG C of hold over night (or-70 DEG C of standing 30min), 4 DEG C, the centrifugal 15min of 12000r/min.
7. abandon supernatant, precipitate 1 time, after drying at room temperature by volume percent 75% washing with alcohol, add the ddH of 600ul
2o(is containing the RNaseA of final concentration 50ug/ml), 37 DEG C of insulation 30-45min.
8. with isopyknic chloroform/primary isoamyl alcohol (volume ratio is 24:1) extracting 2 times, 4 DEG C, the centrifugal 10min of 12000r/min.
9. get supernatant, add the NaAc of 1/10 volume 3mol/L, the precooling dehydrated alcohol of 2 times of volumes, place 30min, 4 DEG C, the centrifugal 10min of 12000r/min for-20 DEG C.
10. abandon supernatant, precipitate 2-3 time by the washing with alcohol of volume percent 75%, after drying at room temperature, be dissolved in the ddH of 20-30ul
2o ,-20 DEG C save backup.
2, based on the molecule marker of atp9 gene molecule marker and atp6 gene
2.1 primer
Based on 3 ' end disappearance, 47 bases of atp9 gene in bluish dogbane cytoplasmic male sterile line P3A, conserved regions design a pair special primer (delivering) at these saltation zone two ends:
atp9BQF:ATGAATGATAAAGCGCGTGACGAGA；
atp9BQR:5'ATGAGTCACAAGGTGAATTGTAAGC。
The molecule marker called after MM556 of the bluish dogbane male sterile cytoplasm developed thus.
30 bases are lacked, conserved regions design a pair special primer at these saltation zone two ends based on atp6 conserved regions in bluish dogbane cytoplasmic male sterile line P3A:
atp6BQF：TATGTTTGTAAATATCACGTCTGCG；
atp6BQR：TTAGCAGCATAAACAAAGATGGATT。
The bluish dogbane male sterile cytoplasm detection molecules mark called after MM509 developed accordingly.
These two molecule markers can special difference bluish dogbane male sterile cytoplasm.
2.2PCR reaction and detection
The 20ul reaction system of two molecule marker PCR detections comprises the DNA profiling of 20-50ng, and the 10 × Buffer of 2ul, the upstream and downstream primer of 0.2mMdNTP, 0.3uM, 1UTaqplus, then uses ddH
2o supplies 20ul.This reaction mixture is 95 DEG C of denaturation 3min first, then 94 DEG C of 40s, 58 DEG C of 40s, 72 DEG C of 40s, 35 circulations of increasing, and last 72 DEG C of ends extend 10min, and the PCR reaction product agarose of 1% detects.
The peculiar mark of 2.3 bluish dogbane male sterile cytoplasms
Find the deletion mutantion of 47bp based on atp9 gene 3 ' end in bluish dogbane cytoplasmic male sterile line P3A, and corresponding maintenance line is normal.Therefore, at the two ends of deletion mutantion design special primer to atp9BQF/atp9BQR, develop an ALP molecule marker based on PCR, this molecule marker amplifies 556bp band in bluish dogbane cytoplasmic male sterile line P3A, therefore called after MM556, and corresponding maintenance line P3B amplifies 603bp band, and (Fig. 1 is a).
Equally, the deletion mutantion of 30bp is found based on atp6 gene C DS district in bluish dogbane cytoplasmic male sterile line P3A, and corresponding maintenance line is normal, therefore, at the two ends of deletion mutantion design special primer to atp6BQ, develop an ALP molecule marker based on PCR, this molecule marker amplifies 509bp band in bluish dogbane cytoplasmic male sterile line P3A, therefore by this molecule marker called after MM509, and corresponding maintenance line P3B amplifies 539bp band (Fig. 1 b).
Embodiment 2 is to the detection of existing bluish dogbane male sterile cytoplasm
Select other bluish dogbane sterile lines with bluish dogbane cytoplasmic male sterile line P3A with same cell matter, the F obtained after sterile line hybridization
1generation, F
2generation, and tool can the bluish dogbane maintenance line of hatching cell matter, restorer be verified, with P3A, P3B for contrast.Concrete test materials is as follows:
(1) bluish dogbane cytoplasmic male sterile line (tool bluish dogbane male sterile cytoplasm)
P3A: have another name called rich No. 1 A in Guangdong, see patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
917A: Gui Ke mirror No. 152nd, word [2004], the cytoplasmic male sterile line of the seed selections such as Guangxi University teacher Zhou Ruiyang, take UG93 as tenuigenin donor, 917 is cell nucleus donor, forms through saturated backcross breeding, decomposite leaf, stem stalk light red.
722A: Gui Ke mirror No. [2004] 152, word, the cytoplasmic male sterile line of the seed selections such as Guangxi University teacher Zhou Ruiyang, take UG93 as tenuigenin donor, 722 is cell nucleus donor, forms through saturated backcross breeding, complete leaf, and stem stalk is green.
763A: Gui Ke mirror No. [2004] 152, word, the cytoplasmic male sterile line of Guangxi University teacher Zhou Ruiyang seed selection take UG93 as tenuigenin donor, and safe red 763 is cell nucleus donor, forms through saturated backcross breeding, and flower is purple, stem stalk light red.
L23A: Gui Ke mirror No. [2007] 177, word, the cytoplasmic male sterile line of Guangxi University teacher Zhou Ruiyang seed selection.
K03A: Gui Ke mirror No. [2004] 152, word, the cytoplasmic male sterile line of Guangxi University teacher Zhou Ruiyang seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C).
(2) F obtained after the hybridization of bluish dogbane cytoplasmic male sterile line
1generation, F
2generation (with parent's sterile line, there is identical male sterile cytoplasm in theory)
F
1(P3A/992): be namely female parent with P3A, have another name called good fortune red 992 with 992() for paternal hybrid, the first-filial generation seed obtained and F
1(P3A/992) seed, plantation obtains F1(P3A/992) plant.
F
2(P3A/992): namely plant F
1(P3A/992) plant, isolation free pollination, gathers in the crops the seed born, and namely plantation obtains F
2(P3A/992) plant.
F
1(917A/992): take namely 917A as female parent, with 992 for paternal hybrid, the first-filial generation seed obtained and F
1(917A/992) seed, plantation obtains F
1(917A/992) plant.
F
1(722A/992): take namely 722A as female parent, with 992 for paternal hybrid, the first-filial generation seed obtained and F
1(722A/992) seed, plantation obtains F
1(722A/992) plant.
(3) bluish dogbane maintenance line, restorer (tool can hatching cell matter)
P3B: have another name called rich No. 1 B in Guangdong, the male sterility maintainer line of the cytoplasmic male sterile line P3A of Guangxi University teacher Zhou Ruiyang seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
917B: have another name called 917, the Kenaf Cultivars of Hemp Inst., China Academy of Agricultural Sciences's seed selection is the recurrent parent (cell nucleus donor parent) of 917A, the corresponding maintenance line of 917A.
722B: have another name called 722, the Kenaf Cultivars of Hemp Inst., China Academy of Agricultural Sciences's seed selection is the recurrent parent (cell nucleus donor parent) of 722A, the corresponding maintenance line of 722A.
763B: have another name called safe red 763, being the recurrent parent (cell nucleus donor parent) of 763A, is the corresponding maintenance line of 763A.
The recurrent parent (cell nucleus donor parent) of L23B:L23A is the corresponding maintenance line of L23A.
K03B: the male sterility maintainer line of the cytoplasmic male sterile line K03A of Guangxi University teacher Zhou Ruiyang seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C).
992: have another name called good fortune red 992, University Of Agriculture and Forestry In Fujian's seed selection, in July, 2007 is identified by the national crudefiber crop cultivar identification council, and cultivar identification is numbered: state tasting fiber crops 2007005.
PA302: conventional Kenaf Cultivars, is shown in " excavation of bluish dogbane Yebai CMS kytoplasm SNP molecular label " (Chinese science and technology paper is online for Buddha's warrior attendant, Zhou Ruiyang).
F302: conventional Kenaf Cultivars, is shown in " excavation of bluish dogbane Yebai CMS kytoplasm SNP molecular label " (Chinese science and technology paper is online for Buddha's warrior attendant, Zhou Ruiyang).
PA299: conventional Kenaf Cultivars, is shown in " excavation of bluish dogbane Yebai CMS kytoplasm SNP molecular label " (Chinese science and technology paper is online for Buddha's warrior attendant, Zhou Ruiyang).
1, based on the detection of molecule marker MM556
Select molecule marker MM556, working method is see embodiment 1, and the primer is to being atp9BQF/atp9BQR.
During electrophoresis, swimming lane 1-10 be followed successively by P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299, swimming lane 11-23 is followed successively by P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), Marker is DL2000.
The results are shown in Figure 2a, the tenuigenin of these Kenaf Cultivars is distinguished as two kinds of different types, namely sterile cytoplasm with can hatching cell matter, wherein all sterile cytoplasms (swimming lane 11-20) and P3A(swimming lane 11) have identical band, and all can hatching cell matter (swimming lane 1-10) and P3B(swimming lane 1) have identical band.But also the kind finding to have male sterile cytoplasm is the hybridization F of sterile line, sterile line
1generation, F
2generation, have can hatching cell matter for maintenance line, restorer.
2, based on the detection of molecule marker MM509
Select molecule marker MM509, working method is see embodiment 1, and the primer is to being atp6BQF/atp6BQR.
During electrophoresis, even number swimming lane be followed successively by P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299; Odd number swimming lane is followed successively by P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), Maker is DL2000.
The results are shown in Figure 2b, the tenuigenin of these Kenaf Cultivars is distinguished as two kinds of different types, namely sterile cytoplasm with can hatching cell matter, wherein all sterile cytoplasms (odd number swimming lane) and P3A(swimming lane 1) have identical band, and all can hatching cell matter (even number swimming lane) and P3B(swimming lane 2) have identical band, but also the kind finding to have male sterile cytoplasm is the hybridization F of sterile line, sterile line
1generation, F
2generation, have can hatching cell matter for maintenance line, restorer.
The detected result of molecule marker MM556 and the detected result of molecule marker MM509 are verified mutually.
The tenuigenin of embodiment 3 pairs of Kenaf Cultivars resources detects
Select 65 parts of bluish dogbane resources (10 parts of bluish dogbane UG93 cytoplasmic male sterile line materials and 55 parts of bluish dogbane resources) as material, specific as follows:
UG93-2-1、UG93-2-2、UG93-2-3、UG93-2-4、UG93-2-6、UG93-2-22、UG93-2MS-1、UG93-2MS-2、UG93-2MS-3、UG93-2MS-4、KN250、KN250-1、ID85、C1-7-1、C1-7-1-1、MSI135、H094、286、Fuhonghang5、Y3-3-3、96、09-154、F
1（763B/8R）、09-124、ID85、BG52-135、85-339、P09-135-1、P09-135-2、P09-143-1、P09-143-2、P09-146-1、P09-151-1、P09-151-2、P09-156-1、P09-157-2、P09-161-1、P09-166-1、P09-138-3、P09-147、P09-154、P09-165、KN142、liao34zao、liao7435、Iranearly-maturing、7804、ZH01、zhengxiaoma1、7360A、ID296、ZF69、BG154、09-87、09-89（KB2-3）、09-90（C19-10-2）、09-91（Yue152）、BG155、KN8、K325、Yueyin751、ZB90、09-7、AS226。
1, based on the detection of molecule marker MM556
Select molecule marker MM556, working method is see embodiment 1, and the primer is to being atp9BQF/atp9BQR.
To detected result display (Fig. 3) of 65 parts of bluish dogbane resources, 10 parts of resources are had to have sterile cytoplasm out screened, these 10 parts of resources comprise UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4, UG93-2-22(Fig. 3 a) respectively, wherein UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4 are UG93 malesterile mutants strains, and UG93-2-22 is UG93 wild-type variety, at variable rate technology for educating, which illustrate UG93-2-22 and there is the Restore gene recovering sterile cytoplasm.Other 5 tool male sterile cytoplasm resources are: KN250, KN250-1(Fig. 3 b), KN142(Fig. 3 c), ZB90,09-7(Fig. 3 d).With above-mentioned sterile cytoplasm resource for female parent, being male parent with existing maintenance, successfully having selected new male sterile line, showing that molecule marker MM556 is for differentiating that the cytoplasm fertility of bluish dogbane is reliable thus.
2, based on the detection of molecule marker MM509
Select molecule marker MM509, working method is see embodiment 1, and the primer is to being atp6BQF/atp6BQR.
To detected result display (Fig. 4) of 65 parts of bluish dogbane resources, 10 parts of resources are had to have sterile cytoplasm out screened, these 10 parts of resources comprise UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4, UG93-2-22(Fig. 4 a) respectively, wherein UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4 are UG93 malesterile mutants strains, and UG93-2-22 is UG93 wild-type variety, at variable rate technology for educating, which illustrate UG93-2-22 and there is the Restore gene recovering sterile cytoplasm.Other 5 tool male sterile cytoplasm resources are: KN250, KN250-1(Fig. 4 c), KN142(Fig. 4 b), ZB90(Fig. 4 d).With above-mentioned sterile cytoplasm resource for female parent, being male parent with existing maintenance, successfully having selected new male sterile line, showing that molecule marker MM509 is for differentiating that the cytoplasm fertility of bluish dogbane is reliable thus.
In sum, the present invention adopts ALP molecular marking technique to carry out the polymorphic detection of molecular level to the bluish dogbane cytoplasmic male sterile line material containing bluish dogbane male sterile cytoplasm, as can be seen from the result of this research, the result band of molecule marker MM556 and molecule marker MM509 two kinds of Marker Identifications is clear, stable, reliable, and therefore method of the present invention is highly suitable for identifying the bluish dogbane cytoplasmic male sterile line material containing bluish dogbane male sterile cytoplasm and carrying out the molecular marking supplementary breeding of new bluish dogbane cytoplasmic male sterile line material.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.
Claims (7)
1. a molecular assay method for bluish dogbane male sterile cytoplasm, is characterized in that, concrete steps are as follows:
Carry out PCR reaction with the Auele Specific Primer of ALP molecular marking technique, the Mitochondrial DNA of the bluish dogbane sample to be measured that increases, the material be containing bluish dogbane male sterile cytoplasm with cytoplasmic male sterile line with identical specific band MM509 can be amplified; Described MM509 is and goes out with the primer amplification such as shown in SEQIDNo.3 and SEQIDNo.4 the specific band that length is 509bp;
Described Auele Specific Primer is atp6BQ primer pair:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQIDNo.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQIDNo.4).
2. the molecular assay method of bluish dogbane male sterile cytoplasm as claimed in claim 1, it is characterized in that, its PCR reaction system is as follows:
Reaction system distilled water supplies cumulative volume 20 μ l.
3. the molecular assay method of bluish dogbane male sterile cytoplasm as claimed in claim 1, it is characterized in that, PCR reaction conditions is: 95 DEG C of denaturation 3min; 94 DEG C of 40s, 58 DEG C of 40s, 72 DEG C of 40s, 35 circulations of increasing, 72 DEG C extend 10min.
4., for the atp6BQ primer pair of bluish dogbane male sterile cytoplasm molecular assay method described in claim 1, it is characterized in that, it is:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQIDNo.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQIDNo.4).
5., for the molecule marker MM509 of bluish dogbane male sterile cytoplasm molecular assay method described in claim 1, it is for going out with the primer amplification such as shown in SEQIDNo.3 and SEQIDNo.4 the specific band that length is 509bp.
6. the application of bluish dogbane male sterile cytoplasm molecular assay method in the seed selection of bluish dogbane cytoplasmic male sterile line as described in any one of claim 1-3.
7. the application of primer as claimed in claim 4 in qualification bluish dogbane cytoplasmic male sterile line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310710653.4A CN103667495B (en) | 2013-12-19 | 2013-12-19 | A kind of molecular assay method of bluish dogbane male sterile cytoplasm |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310710653.4A CN103667495B (en) | 2013-12-19 | 2013-12-19 | A kind of molecular assay method of bluish dogbane male sterile cytoplasm |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667495A CN103667495A (en) | 2014-03-26 |
| CN103667495B true CN103667495B (en) | 2015-11-11 |
Family
ID=50306264
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310710653.4A Active CN103667495B (en) | 2013-12-19 | 2013-12-19 | A kind of molecular assay method of bluish dogbane male sterile cytoplasm |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667495B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774939B (en) * | 2015-04-07 | 2017-04-19 | 广西大学 | SNP molecular marker related to kenaf cytoplasmic sterility and amplification primers thereof |
| CN105255868B (en) * | 2015-10-23 | 2018-04-20 | 广西壮族自治区农业科学院经济作物研究所 | Identify bar horse fire fiber crops property method for distinguishing and its molecular labeling, primer pair and kit |
| CN107996389B (en) * | 2017-12-04 | 2021-02-05 | 广西大学 | Breeding method of cytoplasmic male sterile line of kenaf cultivated species |
| CN112877468B (en) * | 2021-04-21 | 2022-08-05 | 广西壮族自治区农业科学院 | CMS molecular tag based on kenaf mitochondrial gene non-coding region, primer pair and application thereof |
| CN113249512B (en) * | 2021-05-28 | 2023-04-28 | 广西壮族自治区农业科学院 | Method for identifying different cytoplasm of kenaf based on mitochondrial gene transcript difference and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101401540A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Hibiscus cannabinus l. H040 cytoplasmic male sterility phyletic breeding method |
| CN101401542A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Method for combining hybrid first generation seed with cytoplasmic male sterility system |
-
2013
- 2013-12-19 CN CN201310710653.4A patent/CN103667495B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101401540A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Hibiscus cannabinus l. H040 cytoplasmic male sterility phyletic breeding method |
| CN101401542A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Method for combining hybrid first generation seed with cytoplasmic male sterility system |
Non-Patent Citations (1)
| Title |
|---|
| "红麻线粒体中细胞质雄性不育候选基因cox3的克隆与分析";陈鹏等;《生物技术通讯》;20110131;第22卷(第1期);第37-40页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667495A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103667495B (en) | A kind of molecular assay method of bluish dogbane male sterile cytoplasm | |
| CN105755140B (en) | The method that cotton cells matter male sterile restoring line InDel is marked and its identified | |
| WO2019128461A1 (en) | Indel molecular marker closely linked to photoperiod insensitivity in pumpkins and application thereof | |
| CN102154281A (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN103740817B (en) | Method for identifying male sterile cytoplasm based on kenaf atp8 gene | |
| CN104004853A (en) | Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA | |
| CN104342434A (en) | Molecular identification method of cytoplasm male sterile restoring line | |
| CN102732621A (en) | Rapid identification method of genetic purity of muskmelon hybrid seeds based on PCR | |
| CN102154282A (en) | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet | |
| CN105647920A (en) | InDel molecular marker based on TYLCV (tomato yellow leaf curl virus) resistance gene Ty-3 | |
| CN104372085B (en) | The Indel mark of cucumber anti-watermelon mosaic virus gene wmv and application thereof | |
| CN102845300A (en) | Identification of muskmelon anti-gummy stem blight polymeric gene | |
| CN107937588A (en) | The molecule labelling method of the heat-resisting main effect QTL site qHTF 1 of Rice Heading blooming stage and application | |
| CN101880658A (en) | Molecular marker of line with genic sterile recessive epistatic interaction in brassica napus and application | |
| CN102690812A (en) | Molecular marker SIsv0067 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN103468805B (en) | Marker and method for identifying cytoplasmic sterility homozygous restorer line of Gossypium harknessii | |
| CN100460521C (en) | Method for identifying Chinese cabbage variety and inspecting seed purity by using SCAR marker | |
| CN103382471A (en) | Setaria italica anti-rust gene coseparated molecular marker and detection method thereof | |
| CN102618647B (en) | Molecular identification method for cotton restoring line containing sterile cytoplasm of gossypium harknessii | |
| CN102952797B (en) | SCAR marker closely linked with onion male sterility gene ms and application thereof | |
| CN105925708B (en) | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application | |
| CN107619875A (en) | A kind of insertion and deletion marker site, primer and application for being used to identify Watermelon Fruit shape | |
| CN104561364B (en) | A kind of method of rapid detection saccharum SPSB gene pleiomorphism and application | |
| CN104450900B (en) | For the primer for the molecular labeling for aiding in identification soybean M type cytoplasmic male sterility restoring gene Rf m1 | |
| CN102925431A (en) | SCAR marker closely linked to onion male sterile restoring gene Ms and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |