CN105925708B - The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application - Google Patents
The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application Download PDFInfo
- Publication number
- CN105925708B CN105925708B CN201610445277.4A CN201610445277A CN105925708B CN 105925708 B CN105925708 B CN 105925708B CN 201610445277 A CN201610445277 A CN 201610445277A CN 105925708 B CN105925708 B CN 105925708B
- Authority
- CN
- China
- Prior art keywords
- muskmelon
- bsa10
- molecular labeling
- male
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of male sterile molecular labeling BSA10 of identification of early stage muskmelon ms5 type and its applications, the primer sequence of the molecular labeling BSA10 are as follows: BSA10F:AGTAGCAACTCTCGTGGCCTATTAG, BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.Above-mentioned molecular labeling BSA10 can be used for identifying muskmelon male sterility ms5 gene and muskmelon molecular mark.The present invention is according to high throughput sequencing technologies, obtain muskmelon genomic data, design and develop caps molecular labeling relevant to muskmelon male sterility, pass through the method for molecular marker assisted selection breeding, it can be carried out the screening of muskmelon male sterile plants in the Muskmelon Seedlings phase, it saves the time limit of breeding and improves the efficiency of breeding, overcoming in florescence can only could distinguish muskmelon male sterile plants in the prior art and the low problem of bring breeding efficiency, realize the technical effect that just can be carried out muskmelon male sterility identification in seedling stage.
Description
Technical field
The invention belongs to plant molecular genetic breeding research field, it is related to a kind of early stage identification muskmelon ms5 type male not
The molecular labeling educated and its application.
Background technique
Muskmelon (Cucumis melo L.) with apparent hybrid vigour compared with other crops, for many years both at home and abroad
Researcher and breeder successively cultivated the excellent muskmelon first generation of hybrid seed of high-volume, create huge economy
Benefit.But hybrid seeding still continues the measures such as manual removal's female parent male flower, artificial pollination, bagging, complex procedures, work at present
Work amount is big, at high cost, be easy to cause the damage of floral organ, to cause the decline of yield.McCreight and Elmstrom
(1984) F is pointed out1Cost for artificial seed is 12-30 times of spontaneous pollination cost.Male sterility is for reducing artificial seed
Cost be one important and stablize effective method, it can be ensured that the success rate and yield of pollination.Male sterility line of plants
Agriculturally there is huge application value, thus the research of male sterility is paid attention to always deeply.Male sterility is wide in plant kingdom
In general presence, especially flowering plant, it is cannot to generate normal anther, pollen or andro gamete in a kind of sexual reproduction process
Genetic phenomenon.Sterile line is cultivated using male sterility and carries out hybrid seeding, can not only reduce breeding cost, and can mention
The purity of high cenospecies.With the development of molecular biology technology, being that material carries out molecule with sterile line and corresponding holding system
Labeled analysis can obtain specific molecular marker possessed by Parents, to realize screening in seedling stage, reduce the labor in field
Momentum reduces production cost.
The male sterile resource of muskmelon is very limited, share 5 male sterility genes be found (Bohn, 1949,1964；
Lozanov, 1983；McCreight, 1984,2005, Pitrat, 1991,2002).1991, Pitrat pointed out muskmelon 5
Male sterility gene is located at linkage group different on muskmelon linkage map, and interaction is not detected between gene,ms-1With sweet tea
Melon red shank gene linkage,ms-2With control yellowing leaf gene linkage, but linkage degree is not close.Other 4 males are not
Educate phenotype (Bohn, 1949,1964；Lozanov, 1983；McCreight, 1984,2005, Pitrat, 1991,2002) with
It is named as in succession afterwardsms-1、ms-2、ms-4 Withms-5.Each male sterility gene controls a kind of phenotype,ms-1 Withms-2 Gene is difficult to pass through phenotypic evaluation in Fields detection；ms-2Mutant is Cantaloup type muskmelonLa Jolla 40460Cultivating process in find, which has the merits such as mildew-resistance, the hero of the mutant plants
Stamen is smaller than normal flower strain stamen, and pollen bag does not crack；Microscopic findings are shownms-2Mutant contain it is a small amount of or
Without containing pollen, artificial pollination success rate is lower than 12 times or so of other plant (Bohn and Principle, 1964).Heredity rule
Rule research shows that carryms-2 The F that mutant sisters hand over2Group, male-fertile and male sterility segregation ratio are 3:1,
And withms-1The cross combination F of configuration2 Group's male-fertile and male sterile segregation ratio are 9:7, as the result is shownms-2Withms-1 Meet two pairs of gene independent inheritances rules (Bohn and Principle, 1964).ms-3 Table can be passed through
Type identification, Park(2004) etc. utilizems-3 Mutant plants and " TAM Dulce " are configured with F2 Group, researchms-3
The genetic development of gene, it is believed that its control by single recessive gene, and find the SCAR mark chain with it, linkage distance
For 2.1cM.Park etc. utilizes F2Group identifies ms-3 genetic development, it is believed that single recessive nuclear gene control muskmelon male is not
It educatesms-3, the result and the result of study of McCreight (1983,1984) are identical, and result of study equally confirms ms-LWith
male sterility –LeesburgAsms-3 Gene.Due toms-4 Withms-5 Development of floral organs initial stage male flower
It degenerates, therefore be easy to be identified by field character (Leouviour et al., 1990；Pitrat, 1991).ms-5
Mutant is found by Clause seeds company, the U.S. earliest, and is applied in the first-filial generation production of hybrid seeds, but correlative study does not appear in the newspapers
To (Leouviour et al., 1990).ms-5 Mutant was most educated earlier than 1966 in cultivation mildew-resistance material " PMR45 "
It is found during kind, the male flower of mutant plants is just considerably less than fertile plant at flower bud development initial stage, in male flower or completely
In flower plant, anther number reduce it is empty flat, pollen begin to degenerate in Meiosis (Leouviour et al.,
1990).During the last ten years, other crops are lagged behind always about male sterile study of muskmelon, and muskmelonms-5The research of gene
Even more have no relevant report.The result of study of forefathers shows,ms-3、ms-4、ms-5 It is the male sterility gene of independent inheritance
(Lecouviour et al., 1990；McCreight and Elmstrom, 1984), it is located at traditional muskmelon genetic map
On 10th, 11,12 article of chromosome (Pitrat, 1991；2002).Muskmelon controls in stamen development gene (a) gene regulation female flower
The development (Boualem et al., 2008) of stamen, the result of study of Park confirm a gene withms-3Gene is not detected
Linkage relationship is also demonstrated that linkage relationship (Pirtrat 1991 is also not present in a gene and other male sterility genes；
2002).
Summary of the invention
The object of the present invention is to provide a kind of male sterile molecular labeling BSA10 of identification of early stage muskmelon ms5 type and its answer
With.The present invention utilizes ms5 malesterile mutants and male fertile plant HM-1, prepares ms5 × HM-1 hybrid Population, constructs F2
Group, extracts the genomic DNA of 252 F2 single plants, multiple years, and investigation Liang Ge group F2 is separated for the pollen fertility of group
Ratio studies the male sterile genetic development of muskmelon, carries out high-throughput genome to two parents and resurveys sequence, design CAPs mark
Note, analysis and the chain region of muskmelon male sterility gene, there are the bases of SNP mutation between lookup parent in the desmic region
Section, and the digestion information of SNP site is analyzed, there are the sequences that CAPS is mutated for acquisition；For mutant nucleotide sequence design primer, utilize
CAPs label carries out male sterility identification in muskmelon F2 group, and the qualification result of molecular labeling is consistent with phenotypic evaluation result.
The purpose of the present invention is what is be achieved through the following technical solutions:
A kind of early stage identification male sterile molecular labeling BSA10 of muskmelon ms5 type, primer sequence are as follows:
BSA10F:AGTAGCAACTCTCGTGGCCTATTAG,
BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.
Above-mentioned molecular labeling BSA10 can be used for identifying muskmelon male sterility ms5 gene.
Above-mentioned molecular labeling BSA10 can be used for muskmelon molecular mark, can identify that ahead of time muskmelon is male in seedling stage
Property sterile material, do not have to could pass through phenotypic evaluation after the plant blossom, for muskmelon breeding, configure cross combination, parent
Early screening saves a large amount of time and manpower and material resources.
The present invention has the advantage that
1, Caps label is the molecular labeling that single nucleotide polymorphisms are generated with restriction enzyme site, the characteristics of due to the label
It is to have a very wide distribution, therefore the stability of variation becomes by force a new generation's label for carrying out the assignment of genes gene mapping in recent years.The present invention according to
High throughput sequencing technologies obtain muskmelon genomic data, design and develop caps molecular labeling relevant to muskmelon male sterility,
By the method for molecular marker assisted selection breeding, the screening of muskmelon male sterile plants can be carried out in the Muskmelon Seedlings phase,
It saves the time limit of breeding and improves the efficiency of breeding, muskmelon hero can only could be distinguished in florescence in the prior art by overcoming
Property sterile plant and the low problem of bring breeding efficiency, realize the technology that just can be carried out muskmelon male sterility identification in seedling stage
Effect.
2, operating method is simple, and stability is strong, provides the new method of assisted Selection for muskmelon molecular breeding.
3, by detecting the genomic DNA of muskmelon to be measured to use PCR method using specific primer provided by the invention,
CAPS molecular labeling BSA10 is expanded, after restriction enzyme HindIII digestion, muskmelon male sterile plants only have a band, and
Male fertile plant amplified band has two band after restriction enzyme HindIII digestion, can be with by this molecular labeling
Male sterility identification accurately is carried out to muskmelon and greatly improves the breeding efficiency of spinach muskmelon for screening plant.
4, relevant report is had no to the molecular labeling of muskmelon male sterility ms5 gene linkage both at home and abroad at present, this research and development is bright
Molecular labeling BSA10 and muskmelon male sterility gene close linkage, genetic distance 0.1CM.
5, molecular labeling of the present invention has very important value in muskmelon production practices, breeding.
Detailed description of the invention
Fig. 1 marks for BSA10 detects the male sterile electrophoretogram of muskmelon, in figure: M marker, by 8 DNA fragmentation groups
At being successively 100,250,500,7500,1000,2000,3000 and 5000bp from top to bottom；P1Male parent is represented, male can
It educates；P2Represent female parent, male sterility, F1For first-filial generation, F224 single plants are shared, 1-8 is male F2 fertile homozygous plants, 9-
16 be the fertile heterozygous plant of male F2；17-24 is F2 male sterile plants；Male sterile plants are specific band in 750bp,
It is male fertile plant band that digestion products 502bp, which generates specific band, and having band in two sites is heterozygote, male
Property is fertile.
Specific embodiment
Further description of the technical solution of the present invention with reference to the accompanying drawing, and however, it is not limited to this, all to this
Inventive technique scheme is modified or replaced equivalently, and without departing from the spirit and scope of the technical solution of the present invention, should all be covered
Within the protection scope of the present invention.
Specific embodiment 1: present embodiments provide for a kind of early stages to identify the male sterile molecule mark of muskmelon ms5 type
Remember BSA10, primer sequence are as follows:
BSA10F:AGTAGCAACTCTCGTGGCCTATTAG,
BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.
The preparation method of above-mentioned molecular labeling BSA10 is as follows:
1, the building of muskmelon genetic group
Make female parent using muskmelon male-sterile mutation thick-skinned melon ms5, with Heilongjiang Province Melon homozygous line HM-1
Cross combination is configured, F is obtained1、F2Group, BC1P1And BC1P2Group.Plant 650 plants of ms-5 × HM-1F2, sterile plant is obtained,
Acquisition fertile plant 502, sterile plant 148, F2Fertile plant and sterile plant segregation ratio meet 3:1.Plant BC1P1
161 plants of group, BC1P1Fertile in group: infertility is 85:86, meets 1:1 segregation ratio through Chi-square statistic backcross population.Muskmelon
Male sterility ms5 is controlled by single recessive gene, genotype ms5ms5.
2, the extraction of genomic DNA and gene pool building
The genomic DNA of 252 F2 single plants is extracted using CTAB method.
It takes respectively and shows homozygous male sterility and each 30 single plants of male-fertile in F2-3 family, construct for separating group
The gene pool of body fractional analysis (Bulk Segregating AnalysiS, BSA), DNA concentration construct fertile in 100ng/ μ L
Gene pool and sterile gene pond.
3, caps linked marker screens
By carrying out high-flux sequence to malesterile mutants ms5 and HM1-1, the genome sequence of two parents is obtained
Otherness site between two parents is compared in column information, analysis, is obtained using BSA method tight with muskmelon male-sterile character ms5
Close chain molecular labeling, it is right to design and develop molecular labeling 420 altogether, and PCR is carried out between fertile gene pool and sterile gene pond
Amplification and polymorphism screening, screen 240 pairs of primers altogether.Screening and the chain molecular labeling of muskmelon male-sterile character, wherein
It was found that BSA10 and muskmelon male-sterile character close linkage.
Specific embodiment 2: detecting muskmelon male sterility ms5 using molecular labeling method present embodiments provide for a kind of
The method of gene, the specific steps are as follows:
(1) DNA for extracting sample to be tested carries out PCR amplification using molecular labeling BSA10.10 μ L PCR reaction systems are as follows:
Each 0.2 μ L, 10 × PCR buffer1 μ L, 2.5mM dNTp0.3 μ L, Taq of 2 μ L, BSA10 primer upstream and downstream of 30ng/ μ L DNA
Enzyme 0.1 μ L, ddH2O 6.4μL.PCR amplification condition are as follows: 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 20See, 68 DEG C of 1 min of annealing,
72 DEG C of extension 30Sec, totally 6 circulations, each circulating temperature reduce by 2 DEG C；94 DEG C of denaturation 20See, 58 DEG C of annealing 1 min, 72 DEG C
Extend 30Sec, totally 6 circulations, each circulating temperature reduces by 1 DEG C；94 DEG C of denaturation 20See, 50 DEG C of annealing 30Sec, 72 DEG C of extensions
30Sec, totally 20 recycle, last 72 DEG C of extensions 5min.
(2) PCR reaction product is used for XhoI endonuclease reaction, enzymatic cleavage methods are as follows: 10 μ L of PCR reaction product, XhoI are restricted
0.5 μ L of restriction endonuclease, concentration are 1U/ μ L, 10 × Fast Digest buffer, 2 μ L, and 7.5 μ L of deionized water, endonuclease reaction is 37
Warm bath 20min in DEG C water-bath is added after 4 μ 6 × loading of L buffer in 2% Ago-Gel 120U electrophoresis
30min takes pictures in Tanon2500 gel imager.
(3) after PCR amplification and HindIII digestion, electrophoretic can detect DNA sample to be measured, and 750bp segment is
Male sterility muskmelon material, and it is then male fertile muskmelon material that clip size, which is 502bp,.Therefore, pass through close linkage
The amplification of label can accurately distinguish the different genotype in restoring gene site, achieve the purpose that assistant breeding.
<110>Heilongjiang Bayi Agricultural Reclamation University
<120>the male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application
<160>2
<210>1
<211>25
<212>DNA
<400>1
agtagcaact ctcgtggcct attag 25
<210>2
<211>26
<212>DNA
<400>2
gcaagactca agatcaagtg gcatat 26
Claims (6)
1. a kind of early stage identifies the male sterile molecular labeling BSA10 of muskmelon ms5 type, it is characterised in that the molecular labeling
The primer sequence of BSA10 are as follows:
BSA10F:AGTAGCAACTCTCGTGGCCTATTAG,
BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.
2. application of the molecular labeling BSA10 described in claim 1 in identification muskmelon male sterility ms5 gene.
3. application of the molecular labeling BSA10 according to claim 2 in identification muskmelon male sterility ms5 gene, special
Sign is that the method for molecular labeling BSA10 identification muskmelon male sterility ms5 gene is as follows:
(1) DNA for extracting sample to be tested carries out PCR amplification using molecular labeling BSA10；
(2) PCR reaction product is used for XhoI endonuclease reaction, enzymatic cleavage methods are as follows: 10 μ L of PCR reaction product, XhoI restriction enzyme
0.5 μ L of enzyme, concentration are 1U/ μ L, 10 × Fast Digest buffer, 2 μ L, and 7.5 μ L of deionized water, endonuclease reaction is in 37 DEG C of water
Warm bath 20min in bath is added after 4 μ 6 × loading of L buffer in 2% Ago-Gel 120U electrophoresis
30min takes pictures in Tanon2500 gel imager；
(3) after PCR amplification and HindIII digestion, electrophoretic can detect DNA sample to be measured, and 750bp segment is male
Sterile muskmelon material, and it is then male fertile muskmelon material that clip size, which is 502bp,.
4. application of the molecular labeling BSA10 according to claim 3 in identification muskmelon male sterility ms5 gene, special
Sign is the PCR reaction system are as follows: 30ng/ μ L DNA 2 μ L, BSA10 primer upstream and downstream each 0.2 μ L, 10 × PCR
Buffer1 μ L, 2.5mM dNTp0.3 μ L, Taq enzyme 0.1 μ L, ddH2O 6.4μL。
5. application of the molecular labeling BSA10 according to claim 3 in identification muskmelon male sterility ms5 gene, special
Sign is the PCR amplification condition are as follows: 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 20See, 68 DEG C of 1 min of annealing, 72 DEG C of extensions
30Sec, totally 6 circulations, each circulating temperature reduce by 2 DEG C；94 DEG C of denaturation 20See, 58 DEG C of 1 min of annealing, 72 DEG C of extensions
30Sec, totally 6 circulations, each circulating temperature reduce by 1 DEG C；94 DEG C of denaturation 20See, 50 DEG C of annealing 30Sec, 72 DEG C of extensions
30Sec, totally 20 recycle, last 72 DEG C of extensions 5min.
6. application of the molecular labeling BSA10 in muskmelon molecular mark described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610445277.4A CN105925708B (en) | 2016-06-21 | 2016-06-21 | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610445277.4A CN105925708B (en) | 2016-06-21 | 2016-06-21 | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925708A CN105925708A (en) | 2016-09-07 |
| CN105925708B true CN105925708B (en) | 2019-07-16 |
Family
ID=56831685
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610445277.4A Active CN105925708B (en) | 2016-06-21 | 2016-06-21 | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925708B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108531636B (en) * | 2018-03-08 | 2021-06-01 | 天津大学 | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof |
| CN117210596B (en) * | 2023-06-26 | 2024-06-14 | 青岛农业大学 | Melon SNP locus marker combination, SNP locus marker detection probe combination, liquid phase chip and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101736076A (en) * | 2008-11-19 | 2010-06-16 | 朱玉丽 | Research progress in molecular marker positioning of wheat powdery mildew resistance gene |
-
2016
- 2016-06-21 CN CN201610445277.4A patent/CN105925708B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101736076A (en) * | 2008-11-19 | 2010-06-16 | 朱玉丽 | Research progress in molecular marker positioning of wheat powdery mildew resistance gene |
Non-Patent Citations (3)
| Title |
|---|
| 甜瓜F2代群体果实性状的遗传分析;盛云燕等;《北方园艺》;20160415;9-12 |
| 甜瓜雄性不育的遗传研究;陈新宪等;《新疆农业科学》;19910302;174-176 |
| 甜瓜雄性不育苗期早期鉴定方法;王昱丹;《中国优秀硕士学位论文全文数据库 农业科技辑》;20180815;D048-18 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925708A (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104711361B (en) | The method of the red peaceful hybrid seed purity of Rapid identification new water melon breed and the primer and kit of use | |
| CN109652412B (en) | SNP molecular marker, method for detecting melon flower type and application | |
| CN105256031B (en) | Utilize the method and its primer special of high-throughput molecular labeling transformation muskmelon female series | |
| CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
| CN107435066A (en) | Stigma Extrusion of Rice main effect QTL and its localization method and application | |
| CN107236811A (en) | Bacterial leaf spot resistance gene Xa21 assistant breedings molecular labeling and its application | |
| CN110484646A (en) | A kind of molecular labeling, primer and application with the short climing gene C pV close linkage of american pumpkin | |
| CN106868135A (en) | A kind of primer and its method for identifying Soybean male sterile line | |
| CN109486987A (en) | A kind of fast construction method of high density genetic linkage maps | |
| CN105925708B (en) | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| CN106086036B (en) | Rice seedling blade albefaction character gene Oscaac1 and its application | |
| CN108330208B (en) | Molecular marker for detecting cytoplasmic male sterility restoring gene of capsicum | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN107619875A (en) | A kind of insertion and deletion marker site, primer and application for being used to identify Watermelon Fruit shape | |
| CN105734145A (en) | Strawberry anthocyanin regulatory gene functional marker | |
| CN107586874A (en) | For identifying primer pair and its application of capsicum yellow flower pesticide character | |
| CN106048025B (en) | Molecular labeling BSA3-2 and its application with muskmelon male sterility ms5 gene close linkage | |
| CN107828911A (en) | Seedling stage differentiates the molecule labelling method of individual plant fertility in dual-purpose Ms line in pepper | |
| CN107287321A (en) | Stigma Extrusion of Rice main effect QTL and its localization method | |
| CN106636349A (en) | SNP molecular marker in close linkage with bacterial blight resistance gene Xa7 and applications of SNP molecular marker | |
| CN103740817A (en) | Method for identifying male sterile cytoplasm based on kenaf atp8 gene | |
| CN109593874A (en) | A kind of SSR molecular marker and application of watermelon genic male sterile close linkage | |
| CN110527741A (en) | A kind of molecular labeling, primer and application with american pumpkin mildew-resistance biological strain 2F gene close linkage | |
| CN109197569B (en) | Molecular breeding method for improving stigma exposure rate of three-line sterile line of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |