CN105925708A - Molecular marker BSA10 for early identification of melon ms5 type male sterile and application thereof - Google Patents
Molecular marker BSA10 for early identification of melon ms5 type male sterile and application thereof Download PDFInfo
- Publication number
- CN105925708A CN105925708A CN201610445277.4A CN201610445277A CN105925708A CN 105925708 A CN105925708 A CN 105925708A CN 201610445277 A CN201610445277 A CN 201610445277A CN 105925708 A CN105925708 A CN 105925708A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- bsa10
- fructus melo
- melon
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker BSA10 for early identification of melon sm5 type male sterile and application of molecular marker BSA10. The primer sequence of the molecular marker BSA10 is: BSA10F: AGTAGCAACTCTCGTGGCCTATTAG; and BSA10R: GCAAGACTCAAGATCAAGTGGCATAT. The above molecular marker BSA10R can be used for identifying the melon male sterile ms5 gene and melon molecular marker assistant breeding. According to the high throughput sequencing, the melon genome data can be obtained, and caps molecular mark related to the melon male sterile can be designed and developed. The molecular marker-assisted selection method can screen the melon male sterile plant on the seedling stage of melon, shorten the breeding period, improve the breeding efficiency, overcome the problem of low breeding efficiency due to the fact that melon male sterile plant can be distinguished only in the flowering period in the prior art and realize the technical effect that melon male sterile identification can be conducted on the seedling stage.
Description
Technical field
The invention belongs to plant molecular genetic breeding research field, relate to a kind of the qualification Fructus Melo male sterile molecular marker of ms5 type and application thereof in early days.
Background technology
Fructus Melo (Cucumis melo L.) having obvious hybrid vigor compared with other crops, researcher the most both domestic and external and breeder have successively cultivated the Fructus Melo first generation of hybrid seed that high-volume is excellent, create huge economic benefit.But hybrid seeding still continues the measures such as manual removal's female parent male flower, artificial pollination, bagging at present, and complex procedures, workload are big, cost is high, easily cause the damage of floral organ, thus cause the decline of yield.McCreight and Elmstrom (1984) points out F1For artificial seed 12-30 times that cost is spontaneous pollination cost.Male sterility for reduce the cost of artificial seed be one important and stablize effective method, it can be ensured that the success rate of pollination and yield.Male sterility line of plants is agriculturally having huge using value, thus the research of male sterility is paid attention to the most deeply.Male sterility is widely present in plant kingdom, and especially in flowering plant, it is the genetic phenomenon that can not produce normal flower pesticide, pollen or androgamete in a kind of sexual reproduction process.Utilize male sterility to cultivate sterile line and carry out hybrid seeding, breeding cost can not only be reduced, and the purity of cenospecies can be improved.Along with the development of Protocols in Molecular Biology, it is to carry out molecular marker analysis for material with sterile line and corresponding holding, it is possible to obtain the specific molecular marker that Parents is had, thus realizes screening in seedling stage, reduce the amount of labour in field, reduce production cost.
The male sterile resource of Fructus Melo is very limited, have 5 male sterility genes be found (Bohn, 1949,1964；Lozanov, 1983；McCreight, 1984,2005, Pitrat, 1991,2002).1991, Pitrat pointed out that 5 male sterility genes of Fructus Melo lay respectively at linkage groups different on Fructus Melo linkage map, is not detected by interaction between gene,ms-1With Fructus Melo red shank gene linkage,ms-2With control yellowing leaf gene linkage, but linkage degree is the tightst.Other 4 male sterility Phenotypes (Bohn, 1949,1964；Lozanov, 1983；McCreight, 1984,2005, Pitrat, 1991,2002) subsequently by the most namedms-1、ms-2、ms-4 Withms-5.Each male sterility gene controls a kind of Phenotype,ms-1
Withms-2 Gene is difficult to pass through phenotypic evaluation in Fields detection；ms-2Mutant is Cantaloup type Fructus MeloLa Jolla 40460Cultivating process in find, this mutant material has the merits such as mildew-resistance, the stamen of this mutant plants is less than normal flower strain stamen, and pollen bag does not ftractures；Microscopic findings showsms-2Mutant contains a small amount of or does not contains pollen, and artificial pollination success rate is less than about 12 times (Bohn of other plant
And Principle, 1964).The research of genetic development shows to carryms-2 The F that mutant sisters hand over2Colony, male-fertile and male sterility segregation ratio are 3:1, and withms-1The cross combination F of configuration2 Colony's male-fertile and male sterile segregation ratio are 9:7, and result showsms-2With
ms-1 Meet two pairs of gene independent inheritance rules (Bohn and Principle, 1964).ms-3 Phenotypic evaluation, Park(2004 can be passed through) etc. utilizems-3 Mutant plants and " TAM Dulce " are configured with F2 Colony, researchms-3The genetic development of gene, it is believed that it is controlled by single recessive gene, and find the SCAR mark chain with it, linkage distance is 2.1cM.Park etc. utilize F2Colony identifies ms-3 genetic development, it is believed that single recessive nuclear gene controls Fructus Melo male sterilityms-3, this result is identical with the result of study of McCreight (1983,1984), and result of study confirms ms-equallyLWith male sterilityLeesburg
It is
ms-3 Gene.Due toms-4 Withms-5 The degeneration of development of floral organs initial stage male flower, be therefore easy to by field character carry out identifying (Leouviour et al., 1990；Pitrat, 1991).ms-5Mutant is the earliest by U.S. Clause
Seeds company finds, and is applied in the first-filial generation production of hybrid seeds, but correlational study has no report for work (Leouviour et al., 1990).ms-5 Mutant found in cultivating mildew-resistance material " PMR45 " breeding process early than 1966, the male flower of mutant plants is at flower bud development initial stage the most considerably less than fertile plant, in male flower or complete flower plant, flower pesticide number reduces empty flat, pollen begins to degenerate (Leouviour et al., 1990) at Meiosis.During the last ten years, lag behind other crops about the male sterile research of Fructus Melo always, and Fructus Meloms-5The research of gene has no relevant report especially.The result of study of forefathers shows,ms-3、ms-4、ms-5 Be independent inheritance male sterility gene (Lecouviour et al., 1990；McCreight and Elmstrom, 1984), lay respectively on tradition the 10th, 11,12 articles of chromosomes of Fructus Melo genetic map (Pitrat, 1991；2002).Fructus Melo controls growth (the Boualem et of stamen in stamen development gene (a) gene regulation female flower
Al., 2008), the result of study of Park confirm a gene withms-3Gene is not detected by linkage relationship, is also demonstrated that a gene and other male sterility gene the most do not exist linkage relationship (Pirtrat 1991；2002).
Summary of the invention
It is an object of the invention to provide a kind of qualification Fructus Melo ms5 type male sterile molecular marker BSA10 and application thereof in early days.The present invention utilizes ms5 malesterile mutants and male fertile plant HM-1, preparation ms5 × HM-1 hybrid Population, build F2 colony, extract the genomic DNA of 252 F2 individual plants, multiple years, investigation Liang Ge colony F2 is for the pollen fertility segregation ratio of colony, the research male sterile genetic development of Fructus Melo, two parents carry out high flux genome resurvey sequence, design CAPs labelling, analyze the region chain with Fructus Melo male sterility gene, the base section that there is SNP mutation between parent is searched in this desmic region, and analyze the enzyme action information of SNP site, obtain the sequence that there is CAPS sudden change；Designing primer for mutant nucleotide sequence, utilize CAPs to be marked in Fructus Melo F2 colony and carry out male sterility qualification, the qualification result of molecular marker is consistent with phenotypic evaluation result.
It is an object of the invention to be achieved through the following technical solutions:
A kind of qualification Fructus Melo ms5 type male sterile molecular marker BSA10 in early days, its primer sequence is:
BSA10F:AGTAGCAACTCTCGTGGCCTATTAG,
BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.
Above-mentioned molecular marker BSA10 can be used for identifying Fructus Melo male sterility ms5 gene.
Above-mentioned molecular marker BSA10 can be used for Fructus Melo molecular mark, Fructus Melo male sterile material can be identified ahead of time in seedling stage, phenotypic evaluation could be passed through after need not waiting until plant blossom, save substantial amounts of time and manpower and materials for Fructus Melo breeding, configuration cross combination, the early screening of parent.
Present invention have the advantage that
1, Caps labelling is the molecular marker producing single nucleotide polymorphisms with restriction enzyme site, and owing to the feature of this labelling is to have a very wide distribution, the most therefore the stability of variation become the labelling of new generation carrying out gene mapping in recent years.The present invention is according to high throughput sequencing technologies, obtain Fructus Melo genomic data, design and develop the caps molecular marker relevant to Fructus Melo male sterility, method by molecular marker assisted selection breeding, the screening of Fructus Melo male sterile plants is can be carried out in the Muskmelon Seedlings phase, save the time limit of breeding and improve the efficiency of breeding, overcome the problem that the breeding efficiency that can only could distinguish Fructus Melo male sterile plants in florescence in prior art and bring is low, it is achieved just can carry out the technique effect of Fructus Melo male sterility qualification in seedling stage.
2, operational approach is simple, and stability is strong, provides the new method of assisted Selection for Fructus Melo molecular breeding.
3, by utilizing specific primer that the present invention the provides genomic DNA to using PCR method to detect Fructus Melo to be measured, amplification CAPS molecular marker BSA10, after restricted enzyme HindIII enzyme action, Fructus Melo male sterile plants only has a band, and male fertile plant amplified band is after restricted enzyme HindIII enzyme action, there are two band, accurately Fructus Melo can be carried out male sterility qualification by this molecular marker, for screening plant, it is greatly improved the breeding efficiency of spinach Fructus Melo.
4, at present both at home and abroad the molecular marker of Fructus Melo male sterility ms5 gene linkage being had no relevant report, molecular marker BSA10 that these research and development are bright and Fructus Melo male sterility gene close linkage, the genetic distance is 0.1CM.
5, molecular marker of the present invention has very important value in Fructus Melo production practices, breeding.
Accompanying drawing explanation
Fig. 1 is the BSA10 male sterile electrophoretogram of marker detection Fructus Melo, in figure: M is marker, is made up of 8 DNA fragmentations, is 100,250,500,7500,1000,2000,3000 and 5000bp the most successively；P1Represent male parent, male-fertile；P2Represent female parent, male sterility, F1For first-filial generation, F2Having 24 individual plants, 1-8 is male F2 fertile homozygous plants, and 9-16 is that male F2 can educate heterozygous plant；17-24 is F2 male sterile plants；Male sterile plants is specific band at 750bp, and it is male fertile plant band that digestion products 502bp produces specific band, have in two sites band for heterozygote, male-fertile.
Detailed description of the invention
Below in conjunction with the accompanying drawings technical scheme is further described; but it is not limited thereto; every technical solution of the present invention is modified or equivalent, without deviating from the spirit and scope of technical solution of the present invention, all should contain in protection scope of the present invention.
Detailed description of the invention one: present embodiments provide for a kind of qualification Fructus Melo ms5 type male sterile molecular marker BSA10 in early days, its primer sequence is:
BSA10F:AGTAGCAACTCTCGTGGCCTATTAG,
BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.
The preparation method of above-mentioned molecular marker BSA10 is as follows:
1, the structure of Fructus Melo genetical population
Utilize Fructus Melo male-sterile mutation thick-skinned melon ms5 to make female parent, configure cross combination with Heilongjiang Province Melon homozygous line HM-1, obtain F1、F2Colony, BC1P1And BC1P2Colony.Plant 650 strain ms-5 × HM-1F2, it is thus achieved that sterile plant, it is thus achieved that fertile plant 502, sterile plant 148, F2
Fertile plant and sterile plant segregation ratio meet 3:1.Plantation BC1P1Colony 161 strain, BC1P1Colony can educate: sterile for 85:86, meet 1:1 segregation ratio through Chi-square statistic backcross population.Fructus Melo male sterility ms5 is by single recessive gene control, and genotype is ms5ms5.
2, extraction and the gene pool of genomic DNA builds
CTAB method is used to extract the genomic DNA of 252 F2 individual plants.
Take respectively and F2-3 family shows the male sterility isozygotied and each 30 individual plants of male-fertile, build for segregating population fractional analysis (Bulk Segregating AnalysiS, BSA) gene pool, DNA concentration is at 100ng/ μ L, and structure can educate gene pool and sterile gene pond.
3, caps linked marker screening
By to malesterile mutants ms5
And HM1-1 carries out high-flux sequence, obtain the Genomic sequence information of two parents, diversity site between two parents of com-parison and analysis, utilize BSA method to obtain and Fructus Melo male-sterile character ms5
Closely linked molecular marker, designs and develops molecular marker 420 right altogether, carries out PCR amplification and polymorphism screening educating, screen 240 pairs of primers altogether between gene pool and sterile gene pond.Screen the molecular marker chain with Fructus Melo male-sterile character, wherein find BSA10 and Fructus Melo male-sterile character close linkage.
Detailed description of the invention two: present embodiments provide for a kind of method utilizing molecular labeling method detection Fructus Melo male sterility ms5 gene, specifically comprise the following steps that
(1) extract the DNA of testing sample, use molecular marker BSA10 to carry out PCR amplification.10 μ L PCR reaction systems are: 30ng/ μ L DNA 2 μ L, each 0.2 μ L of BSA10 primer upstream and downstream, 10 × PCR buffer1 μ L, 2.5mM dNTp0.3 μ L, Taq enzyme 0.1 μ L, ddH2O
6.4μL.PCR amplification condition is: 94 DEG C of denaturations 2min, 94 DEG C of degeneration 20See, 68 DEG C of annealing 1 min, 72 DEG C of extensions 30Sec, totally 6 circulations, each circulating temperature reduces by 2 DEG C；94 DEG C of degeneration 20See, 58 DEG C of annealing 1 min, 72 DEG C of extensions 30Sec, totally 6 circulations, each circulating temperature reduces by 1 DEG C；94 DEG C of degeneration 20See, 50 DEG C of annealing 30Sec, 72 DEG C of extensions 30Sec, totally 20 circulations, last 72 DEG C extend 5min.
(2) PCR product is used for XhoI endonuclease reaction, enzymatic cleavage methods is: PCR product 10 μ L, XhoI restricted enzyme 0.5 μ L, concentration is 1U/ μ L, 10 × Fast Digest buffer 2 μ L, deionized water 7.5 μ L, endonuclease reaction bathes 20min 37 DEG C of middle temperature of water-bath, add after 4 μ L 6 × loading buffer in 2% agarose gel 120U electrophoresis 30min, take pictures at Tanon2500 gel imaging instrument.
(3) DNA sample to be measured is after PCR amplification and HindIII enzyme action, and electrophoretic can detect, 750bp fragment for male sterility Fructus Melo material, clip size be 502bp be then male fertile Fructus Melo material.Therefore, the different genotype in Restore gene site can be accurately distinguished by the amplification of close linkage labelling, reach the purpose of assistant breeding.
<110>Heilongjiang Bayi Agricultural Reclamation University
<120>Fructus Melo ms5 type male sterile molecular marker BSA10 and application thereof are identified in early days
<160>2
<210>1
<211>25
<212>DNA
<400>1
agtagcaact ctcgtggcct attag 25
<210>2
<211>26
<212>DNA
<400>2
gcaagactca agatcaagtg gcatat 26
Claims (6)
1. identify Fructus Melo ms5 type male sterile molecular marker BSA10 in early days for one kind, it is characterised in that the primer sequence of described molecular marker BSA10 is:
BSA10F:AGTAGCAACTCTCGTGGCCTATTAG,
BSA10R:GCAAGACTCAAGATCAAGTGGCATAT.
2. the application in identifying Fructus Melo male sterility ms5 gene of the molecular marker BSA10 described in claim 1.
The molecular marker BSA10 the most according to claim 2 application in identifying Fructus Melo male sterility ms5 gene, it is characterised in that molecular marker BSA10 identifies that the method for Fructus Melo male sterility ms5 gene is as follows:
(1) extract the DNA of testing sample, use molecular marker BSA10 to carry out PCR amplification；
(2) PCR product is used for XhoI endonuclease reaction, and enzymatic cleavage methods is: PCR product 10 μ L, XhoI restricted enzyme 0.5 μ L, and concentration is 1U/ μ L, 10 × Fast
Digest buffer 2 μ L, deionized water 7.5 μ L, endonuclease reaction is bathed 20min 37 DEG C of middle temperature of water-bath, is added 4 μ L
In 2% agarose gel 120U electrophoresis 30min after 6 × loading buffer, take pictures at Tanon2500 gel imaging instrument；
(3) DNA sample to be measured is after PCR amplification and HindIII enzyme action, and electrophoretic can detect, 750bp fragment for male sterility Fructus Melo material, clip size be 502bp be then male fertile Fructus Melo material.
The molecular marker BSA10 the most according to claim 3 application in identifying Fructus Melo male sterility ms5 gene, it is characterised in that described PCR reaction system is: 30ng/ μ L DNA 2 μ L, each 0.2 μ L of BSA10 primer upstream and downstream, 10 × PCR
Buffer1 μ L, 2.5mM
DNTp0.3 μ L, Taq enzyme 0.1 μ L, ddH2O 6.4μL。
The molecular marker BSA10 the most according to claim 3 application in identifying Fructus Melo male sterility ms5 gene, it is characterized in that described PCR amplification condition is: 94 DEG C of denaturations 2min, 94 DEG C of degeneration 20See, 68 DEG C of annealing 1 min, 72 DEG C of extension 30Sec, totally 6 circulations, each circulating temperature reduces by 2 DEG C；94 DEG C of degeneration 20See, 58 DEG C of annealing 1 min, 72 DEG C of extensions 30Sec, totally 6 circulations, each circulating temperature reduces by 1 DEG C；94 DEG C of degeneration 20See, 50 DEG C of annealing 30Sec, 72 DEG C of extensions 30Sec, totally 20 circulations, last 72 DEG C extend 5min.
6. molecular marker BSA10 application in Fructus Melo molecular mark described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610445277.4A CN105925708B (en) | 2016-06-21 | 2016-06-21 | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610445277.4A CN105925708B (en) | 2016-06-21 | 2016-06-21 | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925708A true CN105925708A (en) | 2016-09-07 |
| CN105925708B CN105925708B (en) | 2019-07-16 |
Family
ID=56831685
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610445277.4A Active CN105925708B (en) | 2016-06-21 | 2016-06-21 | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925708B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108531636A (en) * | 2018-03-08 | 2018-09-14 | 天津大学 | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower |
| CN117210596A (en) * | 2023-06-26 | 2023-12-12 | 青岛农业大学 | Melon SNP locus marker combination, SNP locus marker detection probe combination, liquid phase chip and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101736076A (en) * | 2008-11-19 | 2010-06-16 | 朱玉丽 | Research progress in molecular marker positioning of wheat powdery mildew resistance gene |
-
2016
- 2016-06-21 CN CN201610445277.4A patent/CN105925708B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101736076A (en) * | 2008-11-19 | 2010-06-16 | 朱玉丽 | Research progress in molecular marker positioning of wheat powdery mildew resistance gene |
Non-Patent Citations (3)
| Title |
|---|
| 王昱丹: "甜瓜雄性不育苗期早期鉴定方法", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 盛云燕等: "甜瓜F2代群体果实性状的遗传分析", 《北方园艺》 * |
| 陈新宪等: "甜瓜雄性不育的遗传研究", 《新疆农业科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108531636A (en) * | 2018-03-08 | 2018-09-14 | 天津大学 | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower |
| CN108531636B (en) * | 2018-03-08 | 2021-06-01 | 天津大学 | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof |
| CN117210596A (en) * | 2023-06-26 | 2023-12-12 | 青岛农业大学 | Melon SNP locus marker combination, SNP locus marker detection probe combination, liquid phase chip and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925708B (en) | 2019-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| CN109652412B (en) | SNP molecular marker, method for detecting melon flower type and application | |
| CN104711361B (en) | The method of the red peaceful hybrid seed purity of Rapid identification new water melon breed and the primer and kit of use | |
| CN110157831B (en) | Molecular marker coseparated with watermelon short vine gene Cldw1 | |
| CN107988420B (en) | Molecular marker of maize male nuclear sterility gene ms39 and application thereof | |
| CN107868847B (en) | Molecular marker closely linked with melon yellow-green leaf color gene ygl | |
| CN106755561B (en) | QTL (quantitative trait locus), SNP (single nucleotide polymorphism) molecular marker related to soybean root dry weight and application | |
| CN109750118B (en) | SNP molecular marker related to pepper nuclear sterility and application thereof | |
| CN107012243A (en) | A kind of molecular labeling for identifying the true hybrid of lichee and its application | |
| BR112020006195A2 (en) | maize plants with better disease resistance | |
| CN108754006A (en) | With the molecular labeling of muskmelon viticula length character gene SI/si close linkages | |
| CN106086036B (en) | Rice seedling blade albefaction character gene Oscaac1 and its application | |
| CN108330208B (en) | Molecular marker for detecting cytoplasmic male sterility restoring gene of capsicum | |
| CN113151550B (en) | Molecular marker CmSSR02 closely linked with main effect QTL fft2 of early flowering characteristics of melons and application thereof | |
| CN105925708B (en) | The male sterile molecular labeling BSA10 of early stage identification muskmelon ms5 type and its application | |
| CN107586874B (en) | Primer pair for identifying yellow anther character of capsicum and application thereof | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN107236810B (en) | Maize male nuclear sterility gene, molecular marker and application thereof | |
| Liu et al. | Fine mapping of the maize cross‐incompatibility locus gametophytic factor 1 (ga1) using a homogeneous population | |
| CN107619875A (en) | A kind of insertion and deletion marker site, primer and application for being used to identify Watermelon Fruit shape | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN106048025B (en) | Molecular labeling BSA3-2 and its application with muskmelon male sterility ms5 gene close linkage | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN108085404B (en) | Strong female-like molecular marker of pumpkin indicum and primer pair for identifying strong female-like character of pumpkin indicum | |
| CN113122653B (en) | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |