CN103667495A - Molecular identification method for kenaf male sterility cytoplasm - Google Patents
Molecular identification method for kenaf male sterility cytoplasm Download PDFInfo
- Publication number
- CN103667495A CN103667495A CN201310710653.4A CN201310710653A CN103667495A CN 103667495 A CN103667495 A CN 103667495A CN 201310710653 A CN201310710653 A CN 201310710653A CN 103667495 A CN103667495 A CN 103667495A
- Authority
- CN
- China
- Prior art keywords
- swimming lane
- male sterile
- bluish dogbane
- primer
- cytoplasm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and relates to a molecular identification method for kenaf male sterility cytoplasm. The molecular identification method comprises the following steps: performing PCR (polymerase chain reaction) by utilizing a specific primer of the ALP (Amplified Length Polymorphism) molecular marker technology to amplify mitochondrial DNA of a kenaf sample to be tested, wherein a material which contains the kenaf male sterility cytoplasm with the same specific bands as those of a cytoplasmic male sterility line can be amplified. The specific primer is the primer of which the nucleotide sequence is shown as SEQID No.3 and 4. The invention further provides a molecular marker MM509 used for the molecular identification method for the kenaf male sterility cytoplasm. According to the molecular identification method, molecular level polymorphism detection is performed on the material of the kenaf male sterility cytoplasm by adopting the ALP molecular marker technology. The method is high in identification speed, high in accuracy, easy to operate, and very applicable to the identification of the kenaf cytoplasmic male sterility line and molecular marker-assisted breeding.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of molecular assay method of bluish dogbane male sterile cytoplasm.
Background technology
Bluish dogbane claims again " mestha ", is the annual phloem fiber crop of Malvaceae hibiscus.Because of its in the Yangtze valley and northern area can not naturally reserve seed for planting, a large amount of seeds are called in annual Yao Cong South China by northern numb district.Bluish dogbane shows powerful hybrid vigour, and its dominant ratio is up to 35%～40%.For a long time, bluish dogbane heterosis utilization is the main goal of attack of domestic and international bluish dogbane breeding.The cultivation of sterile line is to utilize heterotic important foundation, and wherein cytoplasmic male sterility (cytoplasmic male sterility is called for short CMS) is common sterile line type.
In September, 2008, " selection of bluish dogbane Yebai cytoplasmic male sterile line " of the Zhou Ruiyang of Guangxi University invention obtains national inventing patent (ZL200510019454.4).No. [2007] 177, Gui Ke mirror word) No. [2004] 152, Gui Ke mirror word), good fortune 3A, P3A, 917A, 722A, 763A and L23A(be shown according to said method having selected K03A(sees:: 7 cytoplasmic male sterile lines such as, bluish dogbane heterosis utilization makes a breakthrough.
But in agriculture production, there is the pandemic risk of a certain disease in spread and long-term utilization by the cross-fertilize seed of single cell matter male sterile line assembly, because the cross-fertilize seed of this cytoplasmic male sterile line assembly may become the nurture kind of a certain pathogenic micro-organism physiological strain.The Basic Ways addressing this problem is the male sterile line that selects various kinds of cell matter source, and promotes aborning the three line hybrid seed in different cytoplasm source.
For the new male sterile cytoplasm of seed selection, the screening of the method for the existing male sterility maintainer line of general using and existing germ plasm resource test cross, not only workload is very large, and band bears the character of much blindness.
If can find a kind of molecule marker of male sterile cytoplasm, can utilize this mark to identify existing germ plasm resource, to excavate the male sterile cytoplasm resource making new advances, the male sterile line that seed selection makes new advances then.To greatly increase work efficiency thus, and be conducive to the intellectual property protection of existing male sterile line and cross-fertilize seed thereof.
About bluish dogbane male sterile cytoplasm molecular assay method, be not reported both at home and abroad.
Summary of the invention
The object of the invention is to solve the problem of current shortage bluish dogbane male sterile cytoplasm molecular assay method, a kind of molecular assay method of bluish dogbane male sterile cytoplasm is provided.
That the present invention adopts is ALP(Amplified Length Polymorphism, amplification length polymorphism) technology, be for specific site design special primer, carry out pcr amplification, detect the DNA polymorphism obtaining, the technology with this as molecule marker.
The molecular assay method of a kind of bluish dogbane male sterile cytoplasm provided by the invention, concrete steps are as follows:
With the Auele Specific Primer of ALP molecular marking technique, carry out PCR reaction, the Mitochondrial DNA of the bluish dogbane sample to be measured that increases, can amplify the material containing bluish dogbane male sterile cytoplasm that is with cytoplasmic male sterile line with identical specific band;
Described Auele Specific Primer is atp6BQ primer pair:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQID No.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQID No.4).
Wherein, the reaction system of described PCR is as follows:
Reaction system is supplied cumulative volume 20 μ l with distilled water.
Wherein, PCR reaction conditions is: 95 ℃ of denaturation 3min; 94 ℃ of 40s, 58 ℃ of 40s, 72 ℃ of 40s, 35 circulations of increasing, 72 ℃ are extended 10min.
The present invention is also provided for identifying the atp6BQ primer pair of bluish dogbane male sterile cytoplasm:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQID No.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQID No.4)
The present invention is also provided for identifying the molecule marker MM509 of bluish dogbane male sterile cytoplasm, and it is to use the primer amplification as shown in SEQ ID No.3 and SEQ ID No.4 to go out the specific band that length is 509bp.
The application of the molecular assay method that also object of the present invention is to provide described bluish dogbane male sterile cytoplasm in the seed selection of bluish dogbane cytoplasmic male sterile line.
Another object of the present invention is to provide the application in identifying bluish dogbane cytoplasmic male sterile line with described mark or primer.
The present invention adopts ALP molecular marking technique the bluish dogbane cytoplasmic male sterile line material containing bluish dogbane male sterile cytoplasm to be carried out to the polymorphic detection of molecular level, from the result of this research, can find out, the result band of two kinds of Marker Identifications is clear, stable, reliable, and therefore method of the present invention is highly suitable for identify and carry out the molecular marking supplementary breeding of new bluish dogbane cytoplasmic male sterile line material containing the bluish dogbane cytoplasmic male sterile line material of bluish dogbane male sterile cytoplasm.
Accompanying drawing explanation
Fig. 1 is that the ALP of bluish dogbane cytoplasmic male sterile line P3A and maintenance line P3B thereof in the embodiment of the present invention 1 analyzes.Fig. 1 a is atp9 molecule marker MM556, wherein, and M:marker, swimming lane 1:P3A, swimming lane 2:P3B.Fig. 1 b is atp6 molecule marker MM509.Wherein, M:marker, swimming lane 1:P3A, swimming lane 2:P3B.
Fig. 2 is the result with molecule marker MM556 and molecule marker MM509, multiple bluish dogbane sterile line, sterile line filial generation, maintenance line, restorer being detected in the embodiment of the present invention 2.Fig. 2 a is molecule marker MM556 detected result, wherein, swimming lane 1-10 is followed successively by: P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299, swimming lane 11-23 is followed successively by: P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), M:marker.Fig. 2 b is molecule marker MM509 detected result, and even number swimming lane is followed successively by P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299; Odd number swimming lane is followed successively by P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), M:marker.
Fig. 3 is the result with molecule marker MM556,65 kinds of bluish dogbane resource materials being detected in the embodiment of the present invention 3.Wherein, Fig. 3 a swimming lane 1:UG93-2-1, swimming lane 2:UG93-2-2, swimming lane 3:UG93-2-3, swimming lane 4:UG93-2-4, swimming lane 5:UG93-2-6, swimming lane 6:UG93-2-22, swimming lane 7:UG93-2MS-1, swimming lane 8:UG93-2MS-2, swimming lane 9:UG93-2MS-3, swimming lane 10:UG93-2MS-4, Maker:DL2000, Fig. 3 b swimming lane 1:KN250, swimming lane 2:KN250-1, swimming lane 3:ID85, swimming lane 4:C1-7-1, swimming lane 5:C1-7-1-1, swimming lane 6:MSI135, swimming lane 7:H094, swimming lane 8:286, swimming lane 9:Fuhonghang5, swimming lane 10:Y3-3-3, swimming lane 11:CK(P3A), swimming lane 12:CK(P3B), Maker:100bp plus ladder, swimming lane 13:96, swimming lane 14:09-154, swimming lane 15:F
1(763B/8R), swimming lane 16:09-124, swimming lane 17:09-124, swimming lane 18:ID85, swimming lane 19:BG52-135, swimming lane 20:85-339, Fig. 3 c Maker:DL2000, swimming lane 1:CK(P3A), swimming lane 2:CK(P3B), swimming lane 3:P09-135-1, swimming lane 4:P09-135-2, swimming lane 5:P09-143-1, swimming lane 6:P09-143-2, swimming lane 7:P09-146-1, swimming lane 8:P09-151-1, swimming lane 9:P09-151-2, swimming lane 10:P09-156-1, swimming lane 11:P09-157-2, swimming lane 12:P09-161-1, swimming lane 13:P09-166-1, swimming lane 14:P09-138-3, swimming lane 15:P09-147, swimming lane 16:P09-154, swimming lane 17:P09-165, swimming lane 18:KN142, Fig. 3 d swimming lane 1:liao34zao, swimming lane 2:liao7435, swimming lane 3:Iran early-maturing, swimming lane 4:7804, swimming lane 5:ZH01, swimming lane 6:zhengxiaoma1, swimming lane 7:7360A, swimming lane 8:ID296, swimming lane 9:ZF69, swimming lane 10:BG154, swimming lane 11:CK(P3A), swimming lane 12:CK(P3B), swimming lane 13:09-87, swimming lane 14:09-89(KB2-3), swimming lane 15:09-90(C19-10-2), swimming lane 16:09-91(Yue152), swimming lane 17:BG155, swimming lane 18:KN8, swimming lane 19:K325, swimming lane 20:Yueyin751, swimming lane 21:ZB90, swimming lane 22:09-7, swimming lane 23:AS226.
Fig. 4 checks the electrophorogram of molecule marker MM556 detected result with molecule marker MM509 in the embodiment of the present invention 3.Fig. 4 a swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:UG93-2MS-1, swimming lane 4:UG93-2MS-2, swimming lane 5:UG93-2MS-3, swimming lane 6:UG93-2MS-4, swimming lane 7:UG93-2-22, swimming lane 8:UG93-2-1, swimming lane 9:UG93-2-2, swimming lane 10:UG93-2-3, swimming lane 11:UG93-2-4, swimming lane 12:UG93-2-5, swimming lane 13:UG93-2-6, swimming lane 14:UG93-2-7, swimming lane 15:UG93-2-8, swimming lane 16:UG93-2-9, swimming lane 17:UG93-2-11, swimming lane 18:UG93-2-12, swimming lane 19:UG93-2-14, swimming lane 20:UG93-2-16, swimming lane 21:UG93-2-17, swimming lane 22:UG93-2-18, swimming lane 23:UG93-2-19, Maker:DL2000, Fig. 4 b swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:KN142, swimming lane 4:P09-135-1, swimming lane 5:P09-135-2, swimming lane 6:P09-143-1, swimming lane 7:P09-143-2, swimming lane 8:P09-146-1, swimming lane 9:P09-151-1, swimming lane 10:P09-151-2, swimming lane 11:P09-156-1, swimming lane 12:P09-157-2, swimming lane 13:P09-161-1, swimming lane 14:P09-166-1, swimming lane 15:P09-138-3, swimming lane 16:P09-147, swimming lane 17:P09-154, swimming lane 18:P09-165, swimming lane 19:N10-59, swimming lane 20:N10-60, swimming lane 21:N10-61, swimming lane 22:N10-75, swimming lane 23:N10-76, Maker:DL2000, Fig. 4 c swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:KN250, swimming lane 4:KN250-1, swimming lane 5:ID85, swimming lane 6:C1-7-1, swimming lane 7:C1-7-1-1, swimming lane 8:MSI135, swimming lane 9:H094, swimming lane 10:286, swimming lane 11:Fuhonghang5, swimming lane 12:Y3-3-3, swimming lane 13:CK (P3A), swimming lane 14:CK (P3B), swimming lane 15:96, swimming lane 16:09-154, swimming lane 17:F
1(763B/8R), swimming lane 18:09-124, swimming lane 19:09-124, swimming lane 20:ID85, swimming lane 21:BG52-135, swimming lane 22:85-339, swimming lane 23:AS226, Maker:DL2000, Fig. 4 d swimming lane 1:CK (P3A), swimming lane 2:CK (P3B), swimming lane 3:liao34zao, swimming lane 4:liao7435, swimming lane 5:Iran early-maturing, swimming lane 6:7804, swimming lane 7:ZH01, swimming lane 8:zhengxiaoma1, swimming lane 9:7360A, swimming lane 10:ID296, swimming lane 11:ZF69, swimming lane 12:BG154, swimming lane 13:CK (P3A), swimming lane 14:CK (P3B), swimming lane 15:09-87, swimming lane 16:09-89 (KB2-3), swimming lane 17:09-90 (C19-10-2), swimming lane 18:09-91 (Yue152), swimming lane 19:BG155, swimming lane 20:KN8, swimming lane 21:K325, swimming lane 22:Yueyin751, swimming lane 23:ZB90, Maker:DL2000.
Embodiment
Below in conjunction with embodiment, the specific embodiment of the present invention is described in further detail.Following examples are used for illustrating the present invention, but are not used for limiting the scope of the invention.
The molecular assay method of embodiment 1 bluish dogbane male sterile cytoplasm
The test materials of the present embodiment is bluish dogbane cytoplasmic male sterile line P3A and maintenance line P3B thereof, is public kind, and specifying information is as follows:
P3A: have another name called rich No. 1 A in Guangdong, see patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
P3B: have another name called rich No. 1 B in Guangdong, the male sterility maintainer line of the cytoplasmic male sterile line P3A of teacher Zhou Ruiyang of Guangxi University seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
1, bluish dogbane total DNA extraction and purifying
1. get the fresh bluish dogbane young leaflet tablet of 100mg in mortar, with the rapid grind into powder of liquid nitrogen.
2. appropriate powder is proceeded in the EP pipe of 2ml, the CTAB extracting solution that the mass percent that adds 1ml preheating is 15%, puts upside down and mixes, and in 65 ℃ of insulation 40-60min, shakes 2-3 time therebetween.
3. take out EP pipe, slightly cooling after, add isopyknic phenol/chloroform/primary isoamyl alcohol (volume ratio 25:24:1), put upside down and mix, 4 ℃, the centrifugal 10min of 12000r/min.
4. get supernatant, the CTAB/NaCl solution that the mass percent that adds 1/10 volume is 10%, 65 ℃ of insulation 5-10min.Add isopyknic chloroform/primary isoamyl alcohol (volume ratio is 24:1), put upside down and mix, 4 ℃, the centrifugal 10min of 12000r/min.
5. repeating step 4., until there is not white precipitate in two-phase interface.
6. get supernatant, add the precooling dehydrated alcohol of 2 times of volumes, mix gently ,-20 ℃ of standing over night (or-70 ℃ of standing 30min), 4 ℃, the centrifugal 15min of 12000r/min.
7. abandon supernatant, by volume percent 75% washing with alcohol, precipitate 1 time, after drying at room temperature, add the ddH of 600ul
2o(is containing the RNase A of final concentration 50ug/ml), 37 ℃ of insulation 30-45min.
8. use isopyknic chloroform/primary isoamyl alcohol (volume ratio is 24:1) extracting 2 times, 4 ℃, the centrifugal 10min of 12000r/min.
9. get supernatant, add the NaAc of 1/10 volume 3mol/L, the precooling dehydrated alcohol of 2 times of volumes, places 30min, 4 ℃, the centrifugal 10min of 12000r/min for-20 ℃.
10. abandon supernatant, by the washing with alcohol of volume percent 75%, precipitate 2-3 time, after drying at room temperature, be dissolved in the ddH of 20-30ul
2o ,-20 ℃ save backup.
2, the molecule marker based on atp9 gene molecule marker and atp6 gene
2.1 primer
47 bases of 3 ' end disappearance based on atp9 gene in bluish dogbane cytoplasmic male sterile line P3A, a pair of special primer of conserved regions design (delivering) at these saltation zone two ends:
atp9BQF:ATGAATGATAAAGCGCGTGACGAGA；
atp9BQR:5'ATGAGTCACAAGGTGAATTGTAAGC。
The molecule marker called after MM556 of the bluish dogbane male sterile cytoplasm of developing thus.
Based on 30 bases of atp6 conserved regions disappearance in bluish dogbane cytoplasmic male sterile line P3A, a pair of special primer of conserved regions design at these saltation zone two ends:
atp6BQF：TATGTTTGTAAATATCACGTCTGCG；
atp6BQR：TTAGCAGCATAAACAAAGATGGATT。
The bluish dogbane male sterile cytoplasm detection molecules mark called after MM509 developing accordingly.
These two molecule markers can special difference bluish dogbane male sterile cytoplasm.
2.2PCR reaction and detection
The 20ul reaction system of two molecule marker PCR detections comprises the DNA profiling of 20-50ng, 10 * Buffer of 2ul, and 0.2mM dNTP, the upstream and downstream primer of 0.3uM, 1U Taqplus, then uses ddH
2o supplies 20ul.This reaction mixture is 95 ℃ of denaturation 3min first, 94 ℃ of 40s then, and 58 ℃ of 40s, 72 ℃ of 40s, 35 circulations of increasing, last 72 ℃ are extended 10min eventually, 1% agarose detection for PCR reaction product.
The peculiar mark of 2.3 bluish dogbane male sterile cytoplasms
Based on the 3 ' end of atp9 gene in bluish dogbane cytoplasmic male sterile line P3A, find the deletion mutantion of 47bp, and corresponding maintenance line is normal.Therefore, at the two ends of deletion mutantion, design special primer to atp9BQF/atp9BQR, develop one and take PCR as basic ALP molecule marker, this molecule marker amplifies 556bp band in bluish dogbane cytoplasmic male sterile line P3A, therefore called after MM556, and corresponding maintenance line P3B amplifies 603bp band, (Fig. 1 a).
Equally, based on atp6 gene C DS district in bluish dogbane cytoplasmic male sterile line P3A, find the deletion mutantion of 30bp, and corresponding maintenance line is normal, therefore, at the two ends of deletion mutantion design special primer, to atp6BQ, develop one and take PCR as basic ALP molecule marker, this molecule marker amplifies 509bp band in bluish dogbane cytoplasmic male sterile line P3A, therefore by this molecule marker called after MM509, and corresponding maintenance line P3B amplifies 539bp band (Fig. 1 b).
The detection of 2 pairs of existing bluish dogbane male sterile cytoplasms of embodiment
Select to have with bluish dogbane cytoplasmic male sterile line P3A other bluish dogbane sterile lines of same cell matter, the F obtaining after sterile line hybridization
1generation, F
2generation, and bluish dogbane maintenance line, restorer that tool can hatching cell matter verify, with P3A, P3B is contrast.Concrete test materials is as follows:
(1) bluish dogbane cytoplasmic male sterile line (tool bluish dogbane male sterile cytoplasm)
P3A: have another name called rich No. 1 A in Guangdong, see patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
No. 152nd, 917A: Gui Ke mirror word [2004], the cytoplasmic male sterile line of the seed selections such as teacher Zhou Ruiyang of Guangxi University, take UG93 as tenuigenin donor, and 917 is nucleus donor, forms decomposite leaf, stem stalk light red through saturated backcross breeding.
No. [2004] 152,722A: Gui Ke mirror word, the cytoplasmic male sterile line of the seed selections such as teacher Zhou Ruiyang of Guangxi University, take UG93 as tenuigenin donor, and 722 is nucleus donor, through saturated backcross breeding, form, complete leaf, stem stalk is green.
No. [2004] 152,763A: Gui Ke mirror word, the cytoplasmic male sterile line of teacher Zhou Ruiyang of Guangxi University seed selection, take UG93 as tenuigenin donor, and safe red 763 is nucleus donor, through saturated backcross breeding, forms, and flower is purple, stem stalk light red.
No. [2007] 177, L23A: Gui Ke mirror word, the cytoplasmic male sterile line of teacher Zhou Ruiyang of Guangxi University seed selection.
No. [2004] 152, K03A: Gui Ke mirror word, the cytoplasmic male sterile line of teacher Zhou Ruiyang of Guangxi University seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C).
(2) F obtaining after the hybridization of bluish dogbane cytoplasmic male sterile line
1generation, F
2generation (thering is identical male sterile cytoplasm with parent's sterile line in theory)
F
1(P3A/992) be: take P3A as maternal, the 992(of take has another name called good fortune red 992) paternal hybrid, the first-filial generation seed obtaining is F
1(P3A/992) seed, plantation obtains F1(P3A/992) plant.
F
2(P3A/992): plant F
1(P3A/992) plant, isolation free pollination, the seed that results are born, plantation obtains F
2(P3A/992) plant.
F
1(917A/992): take 917A as maternal, take 992 as paternal hybrid, the first-filial generation seed obtaining is F
1(917A/992) seed, plantation obtains F
1(917A/992) plant.
F
1(722A/992): take 722A as maternal, take 992 as paternal hybrid, the first-filial generation seed obtaining is F
1(722A/992) seed, plantation obtains F
1(722A/992) plant.
(3) bluish dogbane maintenance line, restorer (tool can hatching cell matter)
P3B: have another name called rich No. 1 B in Guangdong, the male sterility maintainer line of the cytoplasmic male sterile line P3A of teacher Zhou Ruiyang of Guangxi University seed selection, is shown in patent of invention ZL200510019454.4(publication number CN100415083C) embodiment 3.
917B: have another name called 917, the Kenaf Cultivars of Hemp Inst., China Academy of Agricultural Sciences's seed selection, is the recurrent parent (nucleus donor parents) of 917A, the corresponding maintenance line of 917A.
722B: have another name called 722, the Kenaf Cultivars of Hemp Inst., China Academy of Agricultural Sciences's seed selection, is the recurrent parent (nucleus donor parents) of 722A, the corresponding maintenance line of 722A.
763B: having another name called safe redly 763, is the recurrent parent (nucleus donor parents) of 763A, is the corresponding maintenance line of 763A.
The recurrent parent of L23B:L23A (nucleus donor parents) is the corresponding maintenance line of L23A.
K03B: the male sterility maintainer line of the cytoplasmic male sterile line K03A of teacher Zhou Ruiyang of Guangxi University seed selection, see patent of invention ZL200510019454.4(publication number CN100415083C).
992: have another name called good fortune red 992, University Of Agriculture and Forestry In Fujian's seed selection, identify in July, 2007 by the national crudefiber crop cultivar identification council, cultivar identification numbering: state tasting fiber crops 2007005.
PA302: commonly use Kenaf Cultivars, see the excavation > > (Chinese science and technology paper is online for Buddha's warrior attendant, Zhou Ruiyang) of < < bluish dogbane Yebai CMS kytoplasm SNP molecular label.
F302: commonly use Kenaf Cultivars, see the excavation > > (Chinese science and technology paper is online for Buddha's warrior attendant, Zhou Ruiyang) of < < bluish dogbane Yebai CMS kytoplasm SNP molecular label.
PA299: commonly use Kenaf Cultivars, see the excavation > > (Chinese science and technology paper is online for Buddha's warrior attendant, Zhou Ruiyang) of < < bluish dogbane Yebai CMS kytoplasm SNP molecular label.
1, the detection based on molecule marker MM556
Select molecule marker MM556, working method is referring to embodiment 1, and the primer is to being atp9BQF/atp9BQR.
During electrophoresis, swimming lane 1-10 is followed successively by P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299, and swimming lane 11-23 is followed successively by P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), Marker is DL2000.
The results are shown in Figure 2a, the tenuigenin of these Kenaf Cultivars is two kinds of different types by difference, be sterile cytoplasm with can hatching cell matter, wherein all sterile cytoplasms (swimming lane 11-20) and P3A(swimming lane 11) have identical band, and all can hatching cell matter (swimming lane 1-10) and P3B(swimming lane 1) have an identical band.But also discovery has the kind of male sterile cytoplasm, be the hybridization F of sterile line, sterile line
1generation, F
2generation, have can hatching cell matter be maintenance line, restorer.
2, the detection based on molecule marker MM509
Select molecule marker MM509, working method is referring to embodiment 1, and the primer is to being atp6BQF/atp6BQR.
During electrophoresis, even number swimming lane is followed successively by P3B, 917B, 722B, 763B, L23B, K03B, 992, PA302, F302, PA299; Odd number swimming lane is followed successively by P3A, 917A, 722A, 763A, L23A, K03A, F
1(P3A/992), F
1(917A/992), F
1(722A/992), F
2(P3A/992), Maker is DL2000.
The results are shown in Figure 2b, the tenuigenin of these Kenaf Cultivars is two kinds of different types by difference, be sterile cytoplasm with can hatching cell matter, wherein all sterile cytoplasms (odd number swimming lane) and P3A(swimming lane 1) have an identical band, and all can hatching cell matter (even number swimming lane) and P3B(swimming lane 2) have identical band, but also the kind of finding to have male sterile cytoplasm is the hybridization F of sterile line, sterile line
1generation, F
2generation, have can hatching cell matter be maintenance line, restorer.
The detected result of the detected result of molecule marker MM556 and molecule marker MM509 is verified mutually.
The tenuigenin of 3 pairs of Kenaf Cultivars resources of embodiment detects
Select 65 parts of bluish dogbane resources (10 parts of bluish dogbane UG93 cytoplasmic male sterile line materials and 55 parts of bluish dogbane resources) as material, specific as follows:
UG93-2-1、UG93-2-2、UG93-2-3、UG93-2-4、UG93-2-6、UG93-2-22、UG93-2MS-1、UG93-2MS-2、UG93-2MS-3、UG93-2MS-4、KN250、KN250-1、ID85、C1-7-1、C1-7-1-1、MSI135、H094、286、Fuhonghang5、Y3-3-3、96、09-154、F
1（763B/8R）、09-124、ID85、BG52-135、85-339、P09-135-1、P09-135-2、P09-143-1、P09-143-2、P09-146-1、P09-151-1、P09-151-2、P09-156-1、P09-157-2、P09-161-1、P09-166-1、P09-138-3、P09-147、P09-154、P09-165、KN142、liao34zao、liao7435、Iran?early-maturing、7804、ZH01、zhengxiaoma1、7360A、ID296、ZF69、BG154、09-87、09-89（KB2-3）、09-90（C19-10-2）、09-91（Yue152）、BG155、KN8、K325、Yueyin751、ZB90、09-7、AS226。
1, the detection based on molecule marker MM556
Select molecule marker MM556, working method is referring to embodiment 1, and the primer is to being atp9BQF/atp9BQR.
The detected result of 65 parts of bluish dogbane resources is shown to (Fig. 3), there are 10 parts of resources to there is sterile cytoplasm out screened, these 10 parts of resources comprise respectively UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4, UG93-2-22(Fig. 3 a), wherein UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4 are UG93 male-sterile mutation body strains, and UG93-2-22 is UG93 wild-type kind, in field, show as and can educate, this has illustrated that UG93-2-22 has the recovery gene that recovers sterile cytoplasm.Other 5 tool male sterile cytoplasm resources are: KN250, KN250-1(Fig. 3 b), KN142(Fig. 3 c), ZB90,09-7(Fig. 3 d).Take above-mentioned sterile cytoplasm resource as maternal, is male parent with existing maintenance, successfully selected new male sterile line, shows that thus molecule marker MM556 is for differentiating that the cytoplasm fertility of bluish dogbane is reliable.
2, the detection based on molecule marker MM509
Select molecule marker MM509, working method is referring to embodiment 1, and the primer is to being atp6BQF/atp6BQR.
The detected result of 65 parts of bluish dogbane resources is shown to (Fig. 4), there are 10 parts of resources to there is sterile cytoplasm out screened, these 10 parts of resources comprise respectively UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4, UG93-2-22(Fig. 4 a), wherein UG93-2ms-1, UG93-2ms-2, UG93-2ms-3, UG93-2ms-4 are UG93 male-sterile mutation body strains, and UG93-2-22 is UG93 wild-type kind, in field, show as and can educate, this has illustrated that UG93-2-22 has the recovery gene that recovers sterile cytoplasm.Other 5 tool male sterile cytoplasm resources are: KN250, KN250-1(Fig. 4 c), KN142(Fig. 4 b), ZB90(Fig. 4 d).Take above-mentioned sterile cytoplasm resource as maternal, is male parent with existing maintenance, successfully selected new male sterile line, shows that thus molecule marker MM509 is for differentiating that the cytoplasm fertility of bluish dogbane is reliable.
In sum, the present invention adopts ALP molecular marking technique the bluish dogbane cytoplasmic male sterile line material containing bluish dogbane male sterile cytoplasm to be carried out to the polymorphic detection of molecular level, from the result of this research, can find out, the result band of molecule marker MM556 and two kinds of Marker Identifications of molecule marker MM509 is clear, stable, reliable, and therefore method of the present invention is highly suitable for identify and carry out the molecular marking supplementary breeding of new bluish dogbane cytoplasmic male sterile line material containing the bluish dogbane cytoplasmic male sterile line material of bluish dogbane male sterile cytoplasm.
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements, all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (8)
1. a molecular assay method for bluish dogbane male sterile cytoplasm, is characterized in that, concrete steps are as follows:
With the Auele Specific Primer of ALP molecular marking technique, carry out PCR reaction, the Mitochondrial DNA of the bluish dogbane sample to be measured that increases, can amplify the material containing bluish dogbane male sterile cytoplasm that is with cytoplasmic male sterile line with identical specific band;
Described Auele Specific Primer is atp6BQ primer pair:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQID No.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQID No.4).
2. the molecular assay method of bluish dogbane male sterile cytoplasm as claimed in claim 1, is characterized in that, its PCR reaction system is as follows:
Reaction system is supplied cumulative volume 20 μ l with distilled water.
3. the molecular assay method of bluish dogbane male sterile cytoplasm as claimed in claim 1, is characterized in that, PCR reaction conditions is: 95 ℃ of denaturation 3min; 94 ℃ of 40s, 58 ℃ of 40s, 72 ℃ of 40s, 35 circulations of increasing, 72 ℃ are extended 10min.
4. for the atp6BQ primer pair of bluish dogbane male sterile cytoplasm molecular assay method described in claim 1, it is characterized in that, it is:
Forward primer 5 '-TATGTTTGTAAATATCACGTCTGCG-3 ' (as shown in SEQID No.3)
Reverse primer 5 '-TTAGCAGCATAAACAAAGATGGATT-3 ' (as shown in SEQID No.4).
5. for the molecule marker MM509 of bluish dogbane male sterile cytoplasm molecular assay method described in claim 1, it is to use the primer amplification as shown in SEQ ID No.3 and SEQ ID No.4 to go out the specific band that length is 509bp.
6. the application of the bluish dogbane male sterile cytoplasm molecular assay method as described in claim 1-3 any one in the seed selection of bluish dogbane cytoplasmic male sterile line.
7. the application of primer as claimed in claim 4 in identifying bluish dogbane cytoplasmic male sterile line.
8. the application of molecule marker as claimed in claim 5 in identifying bluish dogbane cytoplasmic male sterile line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310710653.4A CN103667495B (en) | 2013-12-19 | 2013-12-19 | A kind of molecular assay method of bluish dogbane male sterile cytoplasm |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310710653.4A CN103667495B (en) | 2013-12-19 | 2013-12-19 | A kind of molecular assay method of bluish dogbane male sterile cytoplasm |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667495A true CN103667495A (en) | 2014-03-26 |
| CN103667495B CN103667495B (en) | 2015-11-11 |
Family
ID=50306264
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310710653.4A Active CN103667495B (en) | 2013-12-19 | 2013-12-19 | A kind of molecular assay method of bluish dogbane male sterile cytoplasm |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667495B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774939A (en) * | 2015-04-07 | 2015-07-15 | 广西大学 | SNP molecular marker related to kenaf cytoplasmic sterility and amplification primers thereof |
| CN105255868A (en) * | 2015-10-23 | 2016-01-20 | 广西壮族自治区农业科学院经济作物研究所 | Method for identifying sex of fructus cannabis and molecular marker, primer pair and reagent kit thereof |
| CN107996389A (en) * | 2017-12-04 | 2018-05-08 | 广西大学 | A kind of selection of bluish dogbane cultigen cytoplasmic male sterile line |
| CN112877468A (en) * | 2021-04-21 | 2021-06-01 | 广西壮族自治区农业科学院 | CMS molecular tag based on kenaf mitochondrial gene non-coding region, primer pair and application thereof |
| CN113249512A (en) * | 2021-05-28 | 2021-08-13 | 广西壮族自治区农业科学院 | Method for identifying different cytoplasms of kenaf based on difference of mitochondrial gene transcripts and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101401540A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Hibiscus cannabinus l. H040 cytoplasmic male sterility phyletic breeding method |
| CN101401542A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Method for combining hybrid first generation seed with cytoplasmic male sterility system |
-
2013
- 2013-12-19 CN CN201310710653.4A patent/CN103667495B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101401540A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Hibiscus cannabinus l. H040 cytoplasmic male sterility phyletic breeding method |
| CN101401542A (en) * | 2008-11-03 | 2009-04-08 | 广西大学 | Method for combining hybrid first generation seed with cytoplasmic male sterility system |
Non-Patent Citations (1)
| Title |
|---|
| 陈鹏等: ""红麻线粒体中细胞质雄性不育候选基因cox3的克隆与分析"", 《生物技术通讯》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774939A (en) * | 2015-04-07 | 2015-07-15 | 广西大学 | SNP molecular marker related to kenaf cytoplasmic sterility and amplification primers thereof |
| CN104774939B (en) * | 2015-04-07 | 2017-04-19 | 广西大学 | SNP molecular marker related to kenaf cytoplasmic sterility and amplification primers thereof |
| CN105255868A (en) * | 2015-10-23 | 2016-01-20 | 广西壮族自治区农业科学院经济作物研究所 | Method for identifying sex of fructus cannabis and molecular marker, primer pair and reagent kit thereof |
| CN105255868B (en) * | 2015-10-23 | 2018-04-20 | 广西壮族自治区农业科学院经济作物研究所 | Identify bar horse fire fiber crops property method for distinguishing and its molecular labeling, primer pair and kit |
| CN107996389A (en) * | 2017-12-04 | 2018-05-08 | 广西大学 | A kind of selection of bluish dogbane cultigen cytoplasmic male sterile line |
| CN112877468A (en) * | 2021-04-21 | 2021-06-01 | 广西壮族自治区农业科学院 | CMS molecular tag based on kenaf mitochondrial gene non-coding region, primer pair and application thereof |
| CN112877468B (en) * | 2021-04-21 | 2022-08-05 | 广西壮族自治区农业科学院 | CMS molecular tag based on kenaf mitochondrial gene non-coding region, primer pair and application thereof |
| CN113249512A (en) * | 2021-05-28 | 2021-08-13 | 广西壮族自治区农业科学院 | Method for identifying different cytoplasms of kenaf based on difference of mitochondrial gene transcripts and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667495B (en) | 2015-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| US11492668B2 (en) | Indel molecular marker closely linked to photoperiod insensitivity in pumpkins and application thereof | |
| CN103667495B (en) | A kind of molecular assay method of bluish dogbane male sterile cytoplasm | |
| CN105755140B (en) | The method that cotton cells matter male sterile restoring line InDel is marked and its identified | |
| CN104342434B (en) | The method for identifying molecules of cotton cells matter male sterile restoring line | |
| CN102154282B (en) | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet | |
| CN103740817B (en) | Method for identifying male sterile cytoplasm based on kenaf atp8 gene | |
| CN104178560A (en) | Molecular marking method of rice stigma exsertion major QTL sites | |
| CN104004853A (en) | Method for identifying soybean male sterile cytoplasm through SNP marks of chloroplast DNA | |
| CN105647920A (en) | InDel molecular marker based on TYLCV (tomato yellow leaf curl virus) resistance gene Ty-3 | |
| CN102845300A (en) | Identification of muskmelon anti-gummy stem blight polymeric gene | |
| CN101880658A (en) | Molecular marker of line with genic sterile recessive epistatic interaction in brassica napus and application | |
| CN102690812A (en) | Molecular marker SIsv0067 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN102586244A (en) | Radish cytoplasmic male sterility molecular markers and method for assisting selective breeding using same | |
| CN103374616A (en) | Method for separating two tightly linked rice sterile genes | |
| CN102690814A (en) | Molecular marker SIsv0491 closely linked with Setaria italica L. Beauv. seta color gene | |
| CN102925431B (en) | SCAR marker closely linked to onion male sterile restoring gene Ms and application thereof | |
| CN104313149B (en) | A kind of being applicable to detects molecule marker and the application that Folium Raphani marginal slit carves proterties | |
| CN107619875A (en) | A kind of insertion and deletion marker site, primer and application for being used to identify Watermelon Fruit shape | |
| CN102154284B (en) | Molecular marker SIsv0408 capable of being closely linked to Setaria italica pollen color gene | |
| CN102690818A (en) | Molecular marker SIsv0832 closely linked with Setaria italica L. Beauv. heading stage gene | |
| CN102690817A (en) | Molecular marker SIsv0659 closely linked with Setaria italica L. Beauv. pollen color gene | |
| CN102154285A (en) | Molecular marker SIsv0737 closely linked with millet leaf color gene | |
| CN105671039A (en) | Molecular marker indel15-1 of soybean early-flowering-season major QTL (quantitative trait locus) and application thereof | |
| CN104774939A (en) | SNP molecular marker related to kenaf cytoplasmic sterility and amplification primers thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |