CN103667312A - Application of DWT1 gene and method for restoring rice dwarfing stem caused by DWT1 gene deletion - Google Patents

Abstract

The invention relates to an application of a DWT1 gene and a method for restoring rice dwarfing stem caused by DWT1 gene deletion in the technical field of bioengineering. The DWT1 gene is used for encoding amino acids shown as SEQ ID NO.3. The application comprises the following step: performing gene variation or suppression expression to change rice plant morphology to acquire a rice dwarfing strain for producing seeds. The invention also relates to a method for restoring rice dwarfing stem caused by DWT1 gene deletion. The DWT1 gene is amplified through a primer, a mutant plant is converted by using the genetic transformation means, and the mutant can be restored to a wild type phenotype. The obtained rice mutant is slow in tillering growth after entering a reproductive growth stage, the tillering node height is reduced by different degrees compared with the main stem height during the heading period, the yield is not obviously reduced, and the obtained rice mutant has an important application on agricultural production.

Description

The application of DWTl gene and recovery DWTl genetically deficient cause the method for the short bar of paddy rice

The application is that application number is 201210086493.6, the applying date is 2012.3.28, the dividing an application of method > > that denomination of invention is method of the short bar strain of < < paddy rice initiative and uses thereof, recover short bar proterties.

Technical field

What the present invention relates to is the method for the rice strain's initiative in a kind of technical field of bioengineering, and specifically a kind of application of DWTl gene and recovery DWTl genetically deficient cause the method for the short bar of paddy rice.

Background technology

Paddy rice is one of topmost food crop of China, and China has 60% above population to take rice as staple food, is maximum in the world rice producing country and country of consumption.3,000 ten thousand hectares of China paddy rice year sown areas, account for 20% of the world; 1.85 hundred million tons of output, account for the nearly 1/3 of the world, 6.35 tons/hectare of yield per unit.Higher by 65% than 3.85 tons/hectare of global average yields.Paddy rice remains at 40% left and right of total amount in China's grain yield, has occupied nearly half of the country.

It is the critical event in development of higher plants process that plant type is set up, for plant adapt to better external environment, fully to absorb luminous energy significant.The plant type of higher plant is built up several aspects such as depending primarily on plant height, number of branches and branch's angle, relates to generation and the morphogenesis process of various plants organ.In agriculture production, rationally plant type is the basis of crop high yield, and wherein nanism shape is an importance of ideotype proterties.The resistance to fertilizer of short stalk crop kind, resistant to lodging, suitable dense planting, can make full use of soil and illumination resource.The sixties in last century, the selection and popularization of the crop short-stalked varietys such as paddy rice, corn, wheat, has caused the famous Green Revolution in global crop breeding history.

Since reported first such as nineteen twenty-two India scholar Parnell after a naturally short bar mutating strain series of paddy rice, screened so far more than 70 inequipotential short bar and semi-short-stalked strain, but current widespread use aborning is mainly the semi-short-stalked strain containing sd-l blood relationship.According to the results of pedigree analysis of 313 rice varieties that South Rice Region of China between 1980-1985 is bred as, find to account for 75.6% of total kind number containing the kind of sd-l blood relationship.The reason that other short sources are difficult to application is that entrained mutator gene not only has effect to plant height, conventionally also on forming spike number, grain number and the grain of rice yield, weighs in 3 factors certain 1 or a few proterties and produces bad multiple-effect impact.The simplification in short source causes the risk that potential genetic background is single, has also limited the further raising of improved variety output thus.Therefore, the research short bar strain of seed selection Novel rice is also furtherd investigate its Regulation Mechanism, is prerequisite and the basis of further excavating the short source of paddy rice high-quality.

Existing gene engineering technique is to be based upon being applied on the basis of the abundant research of plant development process molecular regulation mechanism and understanding, therefore, to set up mechanism and the regulated and control network of Rice Dwarf particularly and be applied be the basis of researching and developing novel good plant type on producing to further investigation plant type of rice.

Summary of the invention

The present invention is directed to prior art above shortcomings, a kind of application of DWTl gene is provided and recovers the method that DWTl genetically deficient causes the short bar of paddy rice; The present invention utilizes DWTl gene and albumen thereof to participate in the feature that controlling plant type of rice is particularly controlled paddy rice cane height, and utilize transgenic technology to control the characteristic on plant type of rice, by the expression that suddenlys change this protein sequence or suppress this albumen, produce the short bar strain of new paddy rice, in agriculture production, there is very important application.

First aspect, the present invention relates to a kind of application of DWTl gene, the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3, described application is: by genovariation or inhibition, expressed rice plant form is changed, obtain the short bar strain of paddy rice and can be used for seeding.

Second aspect, the invention still further relates to a kind of method that the DWTl of recovery genetically deficient causes the short bar of paddy rice, by primer amplification DWTl gene, uses genetic transformation means to transform mutant plant, can make mutant return to wild-type phenotype.

Preferably, the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3.

Preferably, described primer is:

DWT-COM-F:5'-GCATGGGAATTCCGGTTTGACGCTTACTGTGGT-3';

DWT-COM-R:5'-CCTTAAGGTCACCTGGCGTTAAGCAAAATGATCAG-3'。

Preferably, comprise the steps:

Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) CGMCC No.4819 is proceeded to the short bar strain of described paddy rice, cultivate, obtain; Wherein CGMCC No.4819 contains coding amino acid whose Nucleotide as shown in SEQ ID NO.3; Specifically comprise the steps:

(a) provide agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) the CGMCC No.4819 that carries expression vector;

(b) rice cell or tissue or organ are contacted with the Agrobacterium in step (a), thereby make coding amino acid whose Nucleotide as shown in SEQ ID NO.3 proceed to rice cell, and be incorporated on the karyomit(e) of rice cell;

(c) select to proceed to rice cell or the tissue of described Nucleotide, regeneration, obtains rice plant.

The present invention has following beneficial effect: the present invention obtains by transcription factor DWTl gene and the proteins encoded thereof of control paddy rice Homeobox structural domain the variant that paddy rice stipes is downgraded and plant type changes, and realizes control paddy rice stipes height and plant type and builds up; The rice mutant that the present invention obtains is at vegetative phase and source parent's no significant difference, after entering generative growth phase, tiller development is slow, the stipes height of tillering heading stage has in various degree and declines than stem height, although tiller, grain number per spike is a little less than source parent, but main grain number per spike and grain weigh to have significantly and improve, therefore output there is no remarkable decline, has very important application in agriculture production.

The Agrobacterium tumefaciens that the present invention relates to (Agrobacterium tumefaciens) EHA105(DWT-COM) on April 29th, 2011, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, postcode: 100101, preserving number CGMCC No.4819.

accompanying drawing explanation

Fig. 1 is that pHB carrier and DWTl RNAi build schematic diagram.

Fig. 2 is the morphological observation schematic diagram of dwtl mutant plant.

Fig. 3 is that dwtl mutant is tillered and downgraded type statistics figure.

Fig. 4 is DWTl gene expression pattern figure.

Fig. 5 is that complementary mutant obtains wild-type phenotype schematic diagram.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.These embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, for example Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Described DWTl gene is the nucleotide sequence of coding aminoacid sequence as shown in SEQ ID NO.3.

the method of embodiment 1, the short bar strain initiative of paddy rice

1.1 by genetically engineered or the short bar strain of other means initiative dwtl paddy rice

In the present embodiment, the coding region sequence of DWTl gene is as shown in SEQ ID NO.3.The dwtl mutant material of the present embodiment be by conventional japonica rice kind force educate round-grained rice No. 7 (having another name called 9522) through the RNA of DWTl gene being disturbed or sequence variations obtains.

1.2 rice tillering plant heights are controlled the clone of protein gene

The plant height of tillering that comprises that utilizes that contriver builds is controlled clearly paddy gene positional cloning (map-based cloning or position cloning) colony of that protein gene DWTl and mutator gene dwtl thereof form, those skilled in that art, by molecule marker, be positioned in 1 little genomic fragment, for example, in 50Kb.On this basis, the genomic dna cloning that comprises this fragment with ordinary method separation.Through enzyme, cut and further hybridize and identify that definite one of them cane containing complete paddy rice extends protein D WTl.

Through full nucleotide sequence analysis result, show that paddy rice stalk extension gene total length is 6766bp (SEQ ID NO.1, comprises control region and intron).Through software analysis and cDNA clone, its ORF is as shown in SEQ ID NO.2, and coding total length is that 533 amino acid whose rice tillering plant heights are controlled albumen, and its sequence is as shown in SEQ ID NO.3.

1.3 rice tillering plant heights are controlled the point mutation of protein gene

The dwtl mutant material of the present embodiment be by conventional japonica rice kind force educate round-grained rice No. 7 (having another name called 9522) through the sequence variations of DWTl gene is obtained; through the sequence comparison to DWTl mutator gene dwtl, the plant height of tillering is controlled frameshit and the premature termination of albumen can eliminate the function that the wild plant height of tillering is controlled albumen; The present embodiment DWTl mutator gene is that 1 the base pair disappearance (its sequence is as shown in SEQ ID NO.4) in coding region causes the forfeiture of rice tillering plant height control protein function.

1.4 by the expression level of the DWTl in RNAi means reduction rice varieties

For DWTl albumen is applied, build the carrier of DWTl gene RNAi, and transformed wild-type 9522 plant, with friend, reduce the expression of DWTl, thereby reach the object that changes rice plant form.

From rice cDNA clone (DWTl_EST clone), use primer

DWT-Ri-F:5'GGCAAGCTTTCTAGACACCAGCAGATGCTCTATCA3' and

DWT-Ri-R:5'GGCGAATTCGGATCCGCTCCAGGCGCAGCTCTTGT3'

Amplify the 688th to the 975th specific fragment that is total to 288bp of DWTl coding sequence; This fragment is connected into and is added the pBluescript SK carrier that contains I in Rice ntron sequence by BamHI/XbaI and the forward and reverse insertion of HindIII/EcoRI respectively; Sequence verification is correct, then contains down earnestly the forward and reverse specific fragment of DWTl and Intron and fragment with HindIII and SacI enzyme, is connected in the pHB carrier of cutting through same enzyme (Fig. 1).Whether order-checking check nucleotide sequence is correct again, successfully builds pHB-DWTl-RNAi plasmid.

By the Agrobacterium that contains DWTl gene RNA interference constructing at the flat lining out of YEB that contains Kan (50 μ g/ μ l), the single bacterium colony obtaining.Choose single colony inoculation and in 28 ℃ of shaking culture, spend the night containing in antibiotic YEB liquid nutrient medium to 3ml, within the 2nd day, by 1% inoculum size, transfer 50ml containing in antibiotic AB liquid nutrient medium, 200rpm continues shaking culture to OD ₆₀₀be 0.6 during to 0.8 left and right, fresh Agrobacterium bacterium liquid, in 5000rpm, 4 centrifugal 5 minutes, is collected and is resuspended in the AAM liquid nutrient medium of 1/3 volume, now can be used for the various acceptor materials of rice transformation.

The present embodiment adopts the rataria callus of conventional conversion method for agrobacterium rice transformation 9522.Get after pollination 9522 immature seeds of 12-15 days through 70% alcohol immersion after 1 minute, in NaClO solution, (1:3 mixes with water, add 2-3 and drip polysorbas20) sterilize more than 90 minutes, with aseptic water washing 4-5 time, then with scalper and tweezers, choose evoked callus on rataria inoculation month N6D2 substratum, under 26 ± 1 ℃, lucifuge condition, cultivate, after 4 days, can be used for transforming.Rataria callus be soaked in fresh AAM Agrobacterium bacterium liquid and frequently shaken, after 20 minutes, rice material is shifted out, on aseptic filter paper, sucking too much bacterium liquid, transferring to immediately on N6D2C substratum, in 26 ℃, cultivating altogether 3 days.While cultivating altogether, in common culture medium, add Syringylethanone, working concentration is 100 μ M.After 3 days, from common culture medium, take out callus, cut plumule and proceed on the selection substratum that contains 25mg/L Hyg and select to cultivate.After 7-12 days, resistant calli is forwarded on the selection substratum that contains 50mg/L Hyg and continue to screen.After 10-12 days, eugonic resistant calli is transferred on pre-division culture medium and is cultivated about one week, then moves to differentiation (12 hours illumination/skies) on division culture medium.The seedling of regeneration is at 1/2MS ₀strong plantlets and rootage on H substratum, moves into the cultivation of phytotron basin soil subsequently.

After surviving, the Transplantation of Regenerated Plantlets obtaining again screens transformed plant with weedicide; Positive plant extracts the total DNA of blade, through PCR, further identifies transformed plant.RT-PCR analyzes the expression level of DWTl gene in positive plant, and it is effective RNA interference plant below 50% that expression level is reduced to wild-type.

1.5DWTl protein-active is lost or expression level reduces rice tillering plant height

Morphological observation to dwtl mutant plant.As Fig. 2, the contrast of the phenotype of wild-type and saltant type dwtl shows wild-type stem and tiller highly consistent (left side) (A, B, C), and dwtl saltant type is tillered than stem dwarfing, and stipes internode shortens (right side) (A, B, C); The eustipes part shortening in mutant raw leaf sheath and is stretched and tears (D); In mutant, stipes has shortening (E) in various degree; The cell elongation normal (F) of wild-type eustipes part, and the flat normally longitudinal tensile strain of the cell of the stipes of mutant (G).

In dwt1 mutant, stem height is 73.2cm, with the obvious difference in height of stem (76.16) nothing of wild-type, and the 74.16cm that the average out to 45.86cm of tillering of mutant is tillered far below normal wild type.In mutant, internode foreshortens to 0.5cm left and right by the 10cm-20cm of normal development.In dwt1 mutant, stem all exists stipes in various degree to shorten with tillering, and is mainly divided into following three kinds of shortening patterns: type one, special shortening between second section; Type two, the two or the three special shortenings of internode; Type three, the 234 special shortenings of internode (Fig. 3).Have an appointment 25.93% the special shortening of the second stipes of lower of the ratio that stipes shortens in stem, other almost all grow normal.Tiller (98.60%) of the overwhelming majority has occurred that stipes in various degree shortens phenomenon, and wherein 15.38% is that type one, 35.66% is that type two, 37.06 is type three, and these three kinds of shortening patterns account for the more than 88% of whole shortening patterns.

1.6DWT1 expression characteristic

Utilize source parent 9522 each organ-tissues of dwtl mutant strain, extract RNA, carry out reverse transcription and obtain cDNA the first chain, utilize the method for quantitative fluorescent PCR to determine the expression pattern (as Fig. 4) of DWTl gene, find that DWTl gene is EMBRYO IN RICE bud scale, the tip of a root, young fringe, has remarkable expression in rataria and callus.

The application of 1.7DWTl gene in the short bar strain of other rice strains of initiative

By dwtl mutant and rice variety Long Tepu B or the hybridization of 9311 rice strains; in F2 generation, there is the short bar strain that all occurred tillering in the plant of indica type feature; meet 3:1 law of segregation; and then prove when nucleotide sequence variation occurs DWTl gene in other rice varieties, can produce equally short bar plant; Selection is wherein for the plant of the special dwarfing of tillering is target group.

embodiment 2, the purposes of dwtl mutant in the paddy rice production of hybrid seeds

Using dwtl mutant as male parent and three be or double-line hybrid combination in sterile parent hybridization, obtain F1 generation.The F2 plant that in generation, screening has short bar and sterile feature simultaneously, the maintenance line that this plant is corresponding with former sterile parent is hybridized.In F2 generation, screening has the plant and maintenance line hybridization of short bar and sterile feature simultaneously again, through how, obtains new short bar sterile line after for screening by hybridization, suitable to the female parent in cross combination.In paddy rice cross breeding breeding practice, before the season of pollinating, need male parent to spray Plant hormones regulators,gibberellins, impel male parent fringe higher than maternal fringe, can improve like this efficiency that pollen transmits and hybridizes.The dwtl mutant short bar characteristic of tillering, makes maternal most of fringe shorter than male parent, can omit male parent and spray Plant hormones regulators,gibberellins step.

the method of embodiment 3, recovery dwtl sudden change low body bar proterties

The genome nucleotide sequence of encoding D WTl gene is proceeded to mutant dwtl plant, can make mutant return to wild-type phenotype.

From the paddy rice fine BAC clone of Japan (OsJNBb0063g05), use primer:

DWT-COM-F:5'GCATGGGAATTCCGGTTTGACGCTTACTGTGGT3' and

DWT-COM-R:5'CCTTAAGGTCACCTGGCGTTAAGCAAAATGATCAG3'

Amplify the genome sequence fragment of the 6766bp of DWTl gene as shown in SEQ ID NO.3.

This fragment is inserted into the binary vector pCAMBIA1301 carrier for rice transformation by EcoRI and BstEII; Sequence verification is correct, this carrier imports agrobacterium tumefaciens EHA105 by electric shock, obtain Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) CGMCC No.4819, on April 29th, 2011, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, postcode: 100101, preserving number CGMCCNo.4819.Use genetic transformation means to transform mutant dwt1 and wild-type 9522 mature embryo callus, to observe, whether can make mutant return to wild-type phenotype.T0 is for obtaining complementary plant, and Fig. 4 shows the wild-type phenotype that T0 shows for complementary plant.

In sum, the present invention obtains by transcription factor DWTl gene and the proteins encoded thereof of control paddy rice Homeobox structural domain the variant that paddy rice stipes is downgraded and plant type changes, and realizes control paddy rice stipes height and plant type and builds up; The rice mutant that the present invention obtains is at vegetative phase and source parent's no significant difference, after entering generative growth phase, tiller development is slow, the stipes height of tillering heading stage has in various degree and declines than stem height, although tiller, grain number per spike is a little less than source parent, but main grain number per spike and grain weigh to have significantly and improve, therefore output there is no remarkable decline, has very important application in agriculture production.

Claims (5)

1. the application of a DWTl gene, it is characterized in that, the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3, described application is: by genovariation or inhibition, expressed rice plant form is changed, obtain the short bar strain of paddy rice and can be used for seeding.

2. recover the method that DWTl genetically deficient causes the short bar of paddy rice, it is characterized in that, by primer amplification DWTl gene, use genetic transformation means to transform mutant plant, can make mutant return to wild-type phenotype.

3. recovery DWTl genetically deficient as claimed in claim 2 causes the method for the short bar of paddy rice, it is characterized in that the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3.

4. recovery DWTl genetically deficient as claimed in claim 2 causes the method for the short bar of paddy rice, it is characterized in that, described primer is:

DWT-COM-F:5'-GCATGGGAATTCCGGTTTGACGCTTACTGTGGT-3';

DWT-COM-R:5'-CCTTAAGGTCACCTGGCGTTAAGCAAAATGATCAG-3'。

5. recovery DWTl genetically deficient as claimed in claim 2 causes the method for the short bar of paddy rice, it is characterized in that, comprises the steps:

Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) CGMCC No.4819 is proceeded to the short bar strain of described paddy rice, cultivate, obtain; Wherein CGMCC No.4819 contains coding amino acid whose Nucleotide as shown in SEQ ID NO.3; Specifically comprise the steps:

(a) provide agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) the CGMCC No.4819 that carries expression vector;

(b) rice cell or tissue or organ are contacted with the Agrobacterium in step (a), thereby make coding amino acid whose Nucleotide as shown in SEO ID NO.3 proceed to rice cell, and be incorporated on the karyomit(e) of rice cell;

(c) select to proceed to rice cell or the tissue of described Nucleotide, regeneration, obtains rice plant.

Images