CN103667312B - The application of DWTl gene and recovery DWTl genetically deficient cause the method for the short bar of paddy rice - Google Patents

Abstract

The present invention relates to the application of the DWTl gene in a kind of technical field of bioengineering and recover the method that DWTl genetically deficient causes the short bar of paddy rice, the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3, described application is: by genovariation or suppress expression to make rice plant form change, and obtains paddy rice short bar strain and can be used for seeding.The invention still further relates to a kind of method that the DWTl of recovery genetically deficient causes the short bar of paddy rice, by primer amplification DWTl gene, use genetic transformation means untransformed mutants plant, mutant can be made to return to wild type phenotype.After the rice mutant that the present invention obtains enters generative growth phase, tiller development is slow, and stipes height of tillering heading stage has compared to stem height and declines in various degree, and output there is no remarkable decline, and agriculture production has important application.

Description

The application of DWTl gene and recovery DWTl genetically deficient cause the method for the short bar of paddy rice

The application is application number is 201210086493.6, and the applying date is 2012.3.28, and denomination of invention is the divisional application of " method and uses thereof of paddy rice short bar strain initiative, recover the method for short bar proterties ".

Technical field

What the present invention relates to is the method for rice strain's initiative in a kind of technical field of bioengineering, specifically a kind of DWTl gene application and recover the method that DWTl genetically deficient causes the short bar of paddy rice.

Background technology

Paddy rice is one of topmost food crop of China, and China has more than 60% population to take rice as staple food, is eating rice production state maximum in the world and country of consumption.China paddy rice year sown area 3,000 ten thousand hectares, accounts for 20% of the world; Output 1.85 hundred million tons, accounts for nearly 1/3 of the world, yield per unit 6.35 tons/hectare.Higher by 65% than global average yield 3.85 tons/hectare.Paddy rice remains at about 40% of total amount in China's grain yield, occupies nearly half of the country.

Plant type foundation is the critical event in development of higher plants process, adapts to external environment better, fully absorption luminous energy is significant for plant.The plant type of higher plant builds up several aspects such as depending primarily on plant height, number of branches and Branch Angle, relates to generation and the morphogenesis process of various plants organ.In agriculture production, reasonable plant type is the basis of crop high yield, and wherein Dwarf ism is an importance of ideotype proterties.The resistance to fertilizer of short stalk crop kind, resistant to lodging, suitable dense planting, can make full use of soil and illumination resource.The sixties in last century, the selection and popularization of the crop short-stalked varietys such as paddy rice, corn, wheat, has caused the Green Revolution famous in world crops breeding history.

Since reported first such as nineteen twenty-two India scholar Parnell after a naturally short bar mutating strain series of paddy rice, screen more than 70 inequipotential short bar and semi-short-stalked strain so far, but the semi-short-stalked strain mainly containing sd-l blood relationship of widespread use aborning at present.According to the results of pedigree analysis of 313 rice varieties be bred as South Rice Region of China between 1980-1985, find that the kind containing sd-l blood relationship accounts for 75.6% of total kind number.The reason that other short sources are difficult to apply is that entrained mutator gene not only has effect to plant height, usually also weighs in 3 factors certain 1 or a few proterties produce bad multiple-effect impact to forming the spike number of rice yield, grain number and grain.The simplification in short source causes the risk that potential genetic background is single, also limit the further raising of improved variety output thus.Therefore, the research short bar strain of seed selection Novel rice is also furtherd investigate its Regulation Mechanism, is prerequisite and the basis of excavating the short source of paddy rice high-quality further.

Existing gene engineering technique is based upon to be applied on the abundant basis studied and be familiar with of plant development process molecular regulation mechanism, therefore, furtheing investigate that plant type of rice sets up the mechanism of particularly Rice Dwarf and regulated and control network and be applied is the basis of researching and developing novel excellent plant type on producing.

Summary of the invention

The present invention is directed to prior art above shortcomings, provide a kind of application of DWTl gene and recovery DWTl genetically deficient to cause the method for the short bar of paddy rice; The present invention utilizes DWTl gene and albumen thereof to participate in the feature that controlling plant type of rice particularly controls paddy rice cane height, and the characteristic utilizing transgenic technology to control on plant type of rice, by suddenling change this protein sequence or suppress the expression of this albumen to produce the short bar strain of new paddy rice, agriculture production has very important application.

First aspect, the present invention relates to a kind of application of DWTl gene, the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3, described application is: by genovariation or suppress expression to make rice plant form change, and obtains paddy rice short bar strain and can be used for seeding.

Second aspect, the invention still further relates to a kind of method that the DWTl of recovery genetically deficient causes the short bar of paddy rice, by primer amplification DWTl gene, uses genetic transformation means untransformed mutants plant, mutant can be made to return to wild type phenotype.

Preferably, the amino acid of described DWTl genes encoding as shown in SEQ ID NO.3.

Preferably, described primer is:

DWT-COM-F:5'-GCATGGGAATTCCGGTTTGACGCTTACTGTGGT-3';

DWT-COM-R:5'-CCTTAAGGTCACCTGGCGTTAAGCAAAATGATCAG-3'。

Preferably, comprise the steps:

Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) CGMCC No.4819 is proceeded to the short bar strain of described paddy rice, cultivates, to obtain final product; Wherein CGMCC No.4819 contains coding amino acid whose Nucleotide as shown in SEQ ID NO.3; Specifically comprise the steps:

A () provides agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) CGMCC carrying expression vector No.4819;

B rice cell or tissue or organ contact with the Agrobacterium in step (a) by (), thus make coding amino acid whose Nucleotide as shown in SEQ ID NO.3 proceed to rice cell, and are incorporated on the karyomit(e) of rice cell;

C () selects the rice cell or the tissue that proceed to described Nucleotide, regeneration obtains rice plant.

The present invention has following beneficial effect: the present invention passes through to control the transcription factor DWTl gene of paddy rice Homeobox structural domain and the variant of the stipes dwarfing of proteins encoded acquisition paddy rice and plant type change thereof, and realization controls paddy rice stipes height and plant type is built up; The rice mutant that the present invention obtains is at vegetative phase and source parent's no significant difference, after entering generative growth phase, tiller development is slow, stipes height of tillering heading stage has compared to stem height and declines in various degree, although tiller, grain number per spike is a little less than source parent, but main grain number per spike and grain weigh to have and significantly improve, therefore output there is no remarkable decline, and agriculture production has very important application.

Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105(DWT-COM that the present invention relates to) be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) on April 29th, 2011, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, postcode: 100101, preserving number CGMCC No.4819.

Accompanying drawing explanation

Fig. 1 is that pHB carrier and DWTl RNAi build schematic diagram.

Fig. 2 is the morphological observation schematic diagram of dwtl mutant plants.

Fig. 3 is that dwtl mutant is tillered and downgraded type statistics figure.

Fig. 4 is DWTl gene expression pattern figure.

Fig. 5 is that complemented mutant body obtains wild type phenotype schematic diagram.

Embodiment

Below in conjunction with specific embodiment, set forth the present invention further.These embodiments are only not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, such as Sambrook equimolecular clone: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.

Described DWTl gene is the nucleotide sequence of coding aminoacid sequence as shown in SEQ ID NO.3.

the method of embodiment 1, the short bar strain initiative of paddy rice

1.1 by genetically engineered or the short bar strain of other means initiative dwtl paddy rice

In the present embodiment, the coding region sequence of DWTl gene is as shown in SEQ ID NO.3.The dwtl mutant material of the present embodiment educates No. 7, round-grained rice (having another name called 9522) through disturbing or sequence variations acquisition the RNA of DWTl gene by conventional japonica rice kind force.

1.2 rice tillering plant heights control the clone of protein gene

The plant height of tillering that comprises utilizing contriver to build controls protein gene DWTl and mutator gene dwtl thereof forms, those skilled in that art clearly paddy gene positional cloning (map-based cloning or position cloning) colony, by Molecular mapping in 1 little genomic fragment, such as, in 50Kb.On this basis, the genomic dna cloning comprising this fragment is separated by ordinary method.Cut through enzyme and further hybridize qualification and determine that one of them cane containing complete paddy rice extends protein D WTl.

Show that paddy rice stalk extension gene total length is 6766bp (SEQ ID NO.1, comprises control region and intron) through full nucleotide sequence analysis result.Through software analysis and cDNA clone, its ORF is as shown in SEQ ID NO.2, and encoding full leng is that 533 amino acid whose rice tillering plant heights control albumen, and its sequence is as shown in SEQ ID NO.3.

1.3 rice tillering plant heights control the point mutation of protein gene

The dwtl mutant material of the present embodiment educates No. 7, round-grained rice (having another name called 9522) through obtaining the sequence variations of DWTl gene by conventional japonica rice kind force; through the gene comparision to DWTl mutator gene dwtl, the frameshit of plant height of tillering control albumen and premature termination can eliminate the function that wild plant height of tillering controls albumen; The present embodiment DWTl mutator gene causes rice tillering plant height to control protein function at 1 base pair deletion (its sequence is as shown in SEQ ID NO.4) of coding region to lose.

1.4 reduce the expression level of the DWTl in rice varieties by RNAi means

In order to apply DWTl albumen, construct the carrier of DWTl gene RNAi, and transformed wild type 9522 plant, reduce the expression of DWTl with friend, thus reach the object changing rice plant form.

Primer is used from rice cDNA clone (DWTl_EST clone)

DWT-Ri-F:5'GGCAAGCTTTCTAGACACCAGCAGATGCTCTATCA3' and

DWT-Ri-R:5'GGCGAATTCGGATCCGCTCCAGGCGCAGCTCTTGT3'

Amplify the specific fragment of the 688th to the 975th common 288bp of DWTl coding sequence; This fragment is connected into the pBluescript SK carrier added containing I in Rice ntron sequence respectively by the forward and reverse insertion of BamHI/XbaI and HindIII/EcoRI; Sequence verification is correct, then contains the forward and reverse specific fragment of DWTl and Intron and fragment with HindIII and SacI enzyme is lower earnestly, is connected in the pHB carrier cut through same enzyme (Fig. 1).Whether order-checking inspection nucleotide sequence is correct again, successfully builds pHB-DWTl-RNAi plasmid.

By the Agrobacterium containing DWTl gene RNA interference constructing at the flat lining out of YEB containing Kan (50 μ g/ μ l), the single bacterium colony obtained.Choose single colony inoculation to spend the night in 28 DEG C of shaking culture to 3ml containing in antibiotic YEB liquid nutrient medium, within the 2nd day, transfer 50ml containing in antibiotic AB liquid nutrient medium by 1% inoculum size, 200rpm continues shaking culture to OD ₆₀₀when being about 0.6 to 0.8, by fresh Agrobacterium bacterium liquid in 5000rpm, 4 centrifugal 5 minutes, collect and be resuspended in the AAM liquid nutrient medium of 1/3 volume, now namely can be used for the various acceptor material of rice transformation.

The present embodiment adopts the rataria callus of conventional conversion method for agrobacterium rice transformation 9522.To get after pollination 9522 immature seeds of 12-15 days through 70% alcohol immersion after 1 minute, (mix with water 1:3 in NaClO solution, add 2-3 and drip polysorbas20) sterilize more than 90 minutes, with aseptic water washing 4-5 time, then choose rataria with scalper and tweezers and inoculate evoked callus on moon N6D2 substratum, 26 ± 1 DEG C, cultivate under lucifuge condition, can be used for after 4 days transforming.Rataria callus to be soaked in fresh AAM Agrobacterium bacterium liquid and frequently to shake, after 20 minutes, rice material being shifted out, aseptic filter paper sucks too much bacterium liquid, transfer on N6D2C substratum immediately, in 26 DEG C of Dual culture 3 days.During Dual culture, in Dual culture substratum, add Syringylethanone, working concentration is 100 μMs.After 3 days, take out callus from Dual culture substratum, cut plumule and proceed on the Selective agar medium containing 25mg/L Hyg and carry out selection cultivation.After 7-12 days, resistant calli is forwarded on the Selective agar medium containing 50mg/L Hyg and continue screening.After 10-12 days, eugonic resistant calli is transferred on pre-division culture medium and is cultivated about one week, then moves to differentiation (12 h light/sky) on division culture medium.The seedling of regeneration is at 1/2MS ₀strong plantlets and rootage on H substratum, moves into the cultivation of phytotron basin soil subsequently.

Again transformed plant is screened with weedicide after the Transplantation of Regenerated Plantlets obtained survives; Positive plant extracts blade STb gene, identifies transformed plant further through PCR.RT-PCR analyzes the expression level of DWTl gene in positive plant, and expression level is reduced to wild-type less than 50% for effective RNA interference plant.

1.5DWTl protein-active is lost or expression level reduces rice tillering plant height

To the morphological observation of dwtl mutant plants.As Fig. 2, wild-type shows wild-type stem and highly consistent (left side) (A, B of tillering with the phenotype contrast of saltant type dwtl; C), and dwtl saltant type tiller than stem downgrade, stipes shortened internodes (right side) (A; B, C); The eustipes part shortened in mutant raw leaf sheath and is stretched and tears (D); In mutant, stipes has shortening (E) in various degree; The cell elongation of wild-type eustipes part normal (F), and the cell of the stipes of mutant is flat cannot normal longitudinal tensile strain (G).

In dwt1 mutant, stem height is 73.2cm, with the stem (76.16) of wild-type without obvious difference in height, and the 74.16cm that the average out to 45.86cm of tillering of mutant is tillered far below normal wild type.In mutant, internode foreshortens to about 0.5cm by the 10cm-20cm of normal development.In dwt1 mutant, stem and the stipes all existed in various degree of tillering shorten, and are mainly divided into following three kinds of shortening patterns: type one, special shortening between second section; Type two, the special shortening of the two or three internode; Type three, the special shortening of the 234 internode (Fig. 3).Lower of the ratio that stipes shortens in stem have an appointment 25.93% the special shortening of the second stipes, other almost all grow normal.Tiller (98.60%) of the overwhelming majority has occurred that stipes in various degree shortens phenomenon, and wherein 15.38% is type one, and 35.66% is type two, and 37.06 is type three, and these three kinds of shortening patterns account for more than 88% of whole shortening pattern.

1.6DWT1 expression characteristic

Utilize each organ-tissue of source parent 9522 of dwtl mutant strain, extract RNA, carry out reverse transcription and obtain cDNA first chain, the method of quantitative fluorescent PCR is utilized to determine the expression pattern (as Fig. 4) of DWTl gene, find that DWTl gene is EMBRYO IN RICE bud scale, the tip of a root, young fringe, has remarkable expression in rataria and callus.

The application of 1.7DWTl gene in the short bar strain of other rice strains of initiative

Dwtl mutant and rice variety Long Tepu B or 9311 rice strains are hybridized; have in the plant of indica type feature in F2 generation and all occurred short bar strain of tillering; meet 3:1 law of segregation; and then when proving that nucleotide sequence change occurs DWTl gene in other rice varieties, short bar plant can be produced equally; Select wherein for the plant of special dwarfing of tillering is target group.

embodiment 2, the purposes of dwtl mutant in the paddy rice production of hybrid seeds

Dwtl mutant is hybridized as the sterile parent during male parent and three are or double-line hybrid combines, obtains F1 generation.In F2 generation, screen the plant simultaneously with short bar and sterile feature, maintenance line corresponding with former sterile parent for this plant is hybridized.Again in F2 generation, screening the plant simultaneously with short bar and sterile feature hybridize with maintenance line, through how for obtaining new short bar sterile line after screening by hybridization, being suitable for as the female parent in cross combination.In paddy rice cross breeding breeding practice, need to spray Plant hormones regulators,gibberellins to male parent before season of pollinating, impel male parent fringe higher than maternal fringe, the efficiency of pollen transmission and hybridization can be improved like this.Dwtl mutant is tillered short bar characteristic, makes maternal most of fringe shorter than male parent, can omit male parent and spray Plant hormones regulators,gibberellins step.

the method of embodiment 3, recovery dwtl sudden change low body bar proterties

The genome nucleotide sequence of encoding D WTl gene is proceeded to mutant dwtl plant, mutant can be made to return to wild type phenotype.

With primer from fine BAC clone (OsJNBb0063g05) of paddy rice Japan:

DWT-COM-F:5'GCATGGGAATTCCGGTTTGACGCTTACTGTGGT3' and

DWT-COM-R:5'CCTTAAGGTCACCTGGCGTTAAGCAAAATGATCAG3'

Amplify the genomic sequence fragment of the 6766bp of DWTl gene as shown in SEQ ID NO.3.

This fragment is inserted in the binary vector pCAMBIA1301 carrier for rice transformation by EcoRI and BstEII; Sequence verification is correct, this carrier imports agrobacterium tumefaciens EHA105 by electric shock, obtain Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (DWT-COM) CGMCC No.4819, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) on April 29th, 2011, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, postcode: 100101, preserving number CGMCCNo.4819.Use genetic transformation means untransformed mutants dwt1 and wild-type 9522 mature embryo callus, mutant whether can be made to return to wild type phenotype to observe.In T0 generation, obtains complementary plant, and Fig. 4 shows the wild type phenotype that T0 shows for complementary plant.

In sum, the transcription factor DWTl gene of the present invention by control paddy rice Homeobox structural domain and the variant of the stipes dwarfing of proteins encoded acquisition paddy rice and plant type change thereof, realize control paddy rice stipes height and plant type is built up; The rice mutant that the present invention obtains is at vegetative phase and source parent's no significant difference, after entering generative growth phase, tiller development is slow, stipes height of tillering heading stage has compared to stem height and declines in various degree, although tiller, grain number per spike is a little less than source parent, but main grain number per spike and grain weigh to have and significantly improve, therefore output there is no remarkable decline, and agriculture production has very important application.

Claims (1)

1. the application of a DWT1 gene, it is characterized in that, the amino acid of described DWT1 genes encoding as shown in SEQ ID NO.3, described application is: suppress expression that rice plant form is changed by RNAi, obtain the short bar strain of paddy rice and be used for seeding.