CN103667303A - Expression method of antibacterial peptide Hclocidin18 in escherichia coli - Google Patents
Expression method of antibacterial peptide Hclocidin18 in escherichia coli Download PDFInfo
- Publication number
- CN103667303A CN103667303A CN201310639841.2A CN201310639841A CN103667303A CN 103667303 A CN103667303 A CN 103667303A CN 201310639841 A CN201310639841 A CN 201310639841A CN 103667303 A CN103667303 A CN 103667303A
- Authority
- CN
- China
- Prior art keywords
- polh
- antibacterial peptide
- expression method
- gene
- fusion rotein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention relates to the biotechnology field and the technical field of biological medicines, and particularly relates to an expression method of an antibacterial peptide Hclocidin18 in escherichia coli. The expression method is characterized by comprising following steps of: a. plasmid construction, wherein the escherichia coli is utilized to perform recombinant plasmid construction, and a polyhedron of a bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is utilized as a fusion partner; b. induction expression; c. purification of a fusion protein coded by the recombinant plasmid; and d. schizolysis of the fusion protein and collection of the antibacterial peptide Hclocidin18. The polyhedron of the bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is utilized as the fusion partner to achieve success expression of the antibacterial peptide Hclocidin18 in the escherichia coli. The alkali dissolution characteristic of the polyhedron is utilized to achieve efficient recovery of the antibacterial peptide Hclocidin18.
Description
Technical field
The present invention relates to biotechnology and biological medicine technology field, particularly the expression method of a kind of antibacterial peptide Hclocidin18 in intestinal bacteria.
Background technology
Halocidin be a class derive from Ascidian (
halocynthia aurantium) antibacterial peptide, natural Halocidin contains Liang Ge subunit, the subunit (Hclocidin 15) of the subunit of 18 amino-acid residues (Hclocidin 18) and 15 amino-acid residues is by disulfide bonds.Hclocidin18 has good anti-microbial activity, because it has very strong lethal effect to receive much concern to many pathogenic gram-positive microorganisms in animal and bird intestines.Its anti-microbial effect and microbiotic are suitable, are the most promising antibiotic substitute matter.The biosynthesizing of antibacterial peptide is also at present a lot of researchists' popular research topic.Because of the anti-microbial activity of antibacterial peptide to bacterium, be difficult to be expressed in escherichia expression system.
Summary of the invention
The invention provides a kind of Hclocidin18 gene of expressing for antibacterial peptide Hclocidin18.
The present invention also provides the expression method of a kind of antibacterial peptide Hclocidin18 in intestinal bacteria, and the method can make antibacterial peptide Hclocidin18 in intestinal bacteria, carry out high efficient expression.
The technical solution adopted for the present invention to solve the technical problems is:
A Hclocidin18 gene, its nucleotide sequence is as shown in SEQ ID No.2.
The expression method of a kind of antibacterial peptide Hclocidin18 in intestinal bacteria, it is characterized in that comprising the steps: a, plasmid construction: adopt intestinal bacteria to carry out construction of recombinant plasmid, using the polyhedrin of silkworm cytoplasmic polyhedrosis virus BmCPV as fusion partner; B, abduction delivering; The purifying of the fusion rotein of c, recombinant plasmid coding; The collection of the cracking of d, fusion rotein and antibacterial peptide Hclocidin18.The aminoacid sequence of antibacterial peptide Hclocidin18 is WLNALLHHGLNCAKGVLA(SEQ ID No.1).
As preferably, in plasmid construction, detailed process is as follows:
First, add hydroxylamine cleavage site encoding sequence before Hclocidin18 gene, gene fragment 5 ' end adds EcoR I, and 3 ' end adds Xho I, and synthetic rear clone enters in pUC18, construction recombination plasmid pUC18-Hclocidin18;
Secondly, take BmCPV genome as template, utilize pcr amplification to obtain polyhedron gene, the upstream primer adopting has the nucleotide sequence as shown in SEQ ID No.3, downstream primer has the nucleotide sequence as shown in SEQ ID No.4, by polh fragment be cloned into Hclocidin18 gene in Puc18-Hclocidin18 before, obtain recombinant plasmid pUC18-polh-Hclocidin18, then polh-Hclocidin18 fusion gene fragment is wherein cloned in pET30a to the recombinant plasmid called after pET30a-polh-Hclocidin18 obtaining.
As preferably, the fusion rotein of recombinant plasmid pET30a-polh-Hclocidin18 coding with His label, is beneficial to protein purification at N-terminal, and it is expressed under IPTG induction and completes.
As preferably, steps d is specific as follows: fusion rotein solution is mixed with oxyammonia scission reaction damping fluid, hatch 24h for 55 ℃, polh-Hclocidin18 fusion rotein success cracking, then 20mM pH7.8 PBS dialysis for scission reaction sample, centrifugal, the supernatant that acquisition contains Hclocidin18, preserve and freeze-drying after obtain the raw product of Hclocidin18.Further, the component of oxyammonia scission reaction damping fluid is as follows: 0.22 M Tris base, and 1.7 M hydroxylamine-HCl, 4.5 M gua-nidine-HCl and 1% 1-propanol, pH 9.0; The volume ratio of fusion rotein solution and oxyammonia scission reaction damping fluid is 1:3.
The present invention using silkworm cytoplasmic polyhedrosis virus (BmCPV) polyhedrin as fusion partner in intestinal bacteria successful expression antibacterial peptide Hclocidin18, utilize the alkali dissolution characteristic of polyhedrin to realize the high efficiente callback of antibacterial peptide Hclocidin18 simultaneously.
Embodiment
Below by specific embodiment, technical scheme of the present invention is described in further detail.Should be appreciated that enforcement of the present invention is not limited to the following examples, any pro forma accommodation that the present invention is made and/or change all will fall into protection domain of the present invention.
In the present invention, if not refer in particular to, all part, per-cents are weight unit, and the equipment adopting and raw material etc. all can be buied from market or this area is conventional.Method in following embodiment, if no special instructions, is the ordinary method of this area.The round pcr adopting in the present invention is routine techniques, and those skilled in the art's content according to the present invention can complete the correlated process in the present invention in conjunction with the knowledge of grasping.
Embodiment:
Bacterium strain:
e. colidH5 α is used for the structure of recombinant plasmid,
e. colibL21 is as expression strain.Streptococcus aureus is the detection for anti-microbial activity as a typical Gram-positive bacterial strain.
1, pET30a-polh-Hclocidin18 plasmid construction: be the sequence of one section of process molecular modification for the antibacterial peptide Hclocidin18 expressing in the present invention, hereinafter to be referred as Hclocidin18 gene, its nucleotides sequence is classified tggttgaacgcacttttgcatcacggacttaattgcgctaaaggtgttcttgct(S EQ ID No.2 as).
By the raw work chemosynthesis in Shanghai Hclocidin18 gene, and before Hclocidin18 gene, add hydroxylamine cleavage site encoding sequence (Asn-Gly), gene fragment 5 ' end adds EcoR I, 3 ' end adds Xho I, synthesize rear clone in plasmid pUC18, construction recombination plasmid pUC18-Hclocidin18.
Take BmCPV genome as template, utilize pcr amplification to obtain polyhedron gene (SEQ ID No.5); Described pcr amplification design of primers used is as follows: upstream primer is the 5 '-AAC that contains Nco I restriction enzyme site
cCATGGaTATGCCGGATTATTCATAC-3 ' (SEQ ID No.3)/Nco I; Downstream primer is the 5 '-TCGT that contains EcoR I restriction enzyme site
gAATTCaTACGCCGGACCAG TG-3 ' (SEQ ID No.4)/EcoR I.The pcr amplification reaction of BmCPV polyhedrin is: a circulation, 94 ° of C templates sex change 3 minutes; Then 30 circulations, 94 ° of C sex change 50 seconds, 55 ° of C annealing 30 seconds, 72 ° of C extend 1 minute; Last 1 circulation, 72 ° of C extend 10 minutes.Utilize 1% agarose gel electrophoresis to carry out PCR product analysis to described polyhedron gene, and use
qiagenepCR purification kit purifying, subsequently object PCR product cloning is entered
takara pMD18-T carrier, obtain PMD18-T-polh, utilize dideoxy chain termination to check order to confirm the exactness of PMD18-T-polh clone gene order on nucleotide sequencing instrument.
PMD18-T-polh is through restriction enzyme Nco I and EcoR I double digestion, the enzyme system of cutting is: pMD18-T-polh DNA 10 μ g, each 0.5 μ l of Nco I and EcoR I, 10 * K buffer+BSA, 5 μ l, add ddH2O to cumulative volume be 50 μ l, under the condition of 37 ℃, enzyme is cut 3 h, and the polh fragment that order-checking is correct is reclaimed in rubber tapping, uses the same method simultaneously and processes pUC18-Hclocidin18.The polh fragment of cutting processing through same enzyme is connected, is transformed with pUC18-Hclocidin18, and screening obtains positive colony, called after recombinant plasmid pUC18-polh-Hclocidin18.Linked system is polh fragment 6 μ l, pUC18-Hclocidin18 2 μ l, and T4 ligase enzyme 1 μ l and 10 * buffer, 1 μ l connect 6 h after mixing under 16 ℃ of conditions.Subsequently 10 μ l being connected to mixture joins in 100 μ l DH5 α competent cells, mix, place 30min on ice, be placed in 42 ℃ of water-bath thermal shock 45s, be placed in rapidly 2min on ice, then add 900 μ l LB substratum, 37 ℃ of shaking table jolting 1h, get 200 μ l and be coated on the LB culture plate that contains penbritin, 37 ℃ of overnight incubation.Picking mono-clonal bacterial plaque, enzyme is cut evaluation and screening and is obtained recombinant plasmid.
With restriction enzyme Nco I and Xho I digestion pUC18-polh-Hclocidin18, obtain polh-Hclocidin18 fusion gene fragment, then polh-Hclocidin18 fusion gene fragment is cloned in plasmid pET30a, the recombinant plasmid called after pET30a-polh-Hclocidin18 obtaining, enzyme cuts, it is the same to connect conversion condition.The fusion rotein of recombinant plasmid pET30a-polh-Hclocidin18 coding with His label, is beneficial to protein purification at N-terminal, and their expression completes under IPTG induction.
2, abduction delivering: the expression vector pET30a-polh-Hclocidin18 of gained in step 1 is transformed into
e. colibL21 competent cell, conversion condition is same as above.Picking mono-clonal bacterial plaque, be placed in 5ml LB culture test tube, 10h is cultivated in 37 ℃ of concussions, then according to the ratio amplification culture of 1:100, condition is 37 ℃, and 200 rpm concussions are cultivated, and OD600 reaches at 0.6 o'clock, adding final concentration is the IPTG of 1mM, the expression of induction recombinant protein polh-Hclocidin18.
3, the purifying of fusion rotein: collect the expression polh-Hclocidin18 fusion rotein of gained in step 2
e. colibL21 bacterial strain (4 ℃, 5000rpm), with PBS(pH7.8) resuspension, high speed centrifugation separatin non-soluble inclusion body after ultrasonication (4 ℃, 15000rpm).With PBS(pH9) resuspension, 30min is dissolved in concussion, high speed centrifugation collect insoluble inclusion body (4 ℃, 15000rpm).With PBS(pH12) resuspension, 30min is dissolved in concussion, the albumen after centrifugal collection is dissolved.By 1M salt acid for adjusting pH to 7.8 for protein solution, the standing 2h of room temperature, the protein of centrifugal collecting precipitation.It is 15mg/ml that the PBS for fusion protein sample (pH12) obtaining is dissolved to final concentration.
4, the collection of the cracking of fusion rotein and Hclocidin18 antibacterial peptide: by the oxyammonia scission reaction damping fluid of fusion rotein solution and 3 times of volumes (0.22 M Tris base, 1.7 M hydroxylamine-HCl, 4.5 M gua-nidine-HCl and 1% 1-propanol, pH 9.0) mix, hatch 24h for 55 ℃.With this understanding, polh-Hclocidin18 fusion rotein success cracking.Then scission reaction sample 20mM PBS(pH7.8) dialysis, centrifugal.So obtain the supernatant that contains Hclocidin18, preserve and freeze-drying.This freeze-drying sample carries out bacteriostatic activity detection as the raw product of Hclocidin18.
5, bacteriostatic activity detects: the single colony inoculation of picking streptococcus aureus is in LB substratum, and 37 ℃, 200 r/min vibrate, and incubated overnight to cell density is 10
8cFU/mL, with the LB substratum dilution 10 of fresh sterilizing
4doubly stand-by.Get the bacterium liquid that 2ml gets ready, add 200 μ l for examination protein solution, 37 ℃, 200 r/min vibrations, the about 5h of incubated overnight, surveys OD600.The bacterium liquid of usining adds the aseptic PBS of 200 μ l as positive control.Each processing arranges 3 repetitions above, takes the mean.
Hclocidin18
the anti-microbial activity of raw product
From fusion rotein, cracking is got off and with meat soup experiment, is carried out qualitative test with the anti-microbial activity of the separated restructuring Hclocidin18 regaining after centrifugal, with streptococcus aureus, as a typical gram-positive bacteria, the results are shown in Table 1.The Hclocidin18 synthetic with standard compares, and the insoluble sample of solubility supernatant (S) (IS) that separated centrifugation step obtains does not have fungicidal activity.
Table 1
| Tested solution | OD 600 |
| PBS | 1.351 |
| The Hclocidin18 (5 μ g/ml) that standard is synthetic | 0.286 |
| The Hclocidin18 raw product that the present embodiment makes | 0.424 |
| IS | 1.328 |
| S | 1.343 |
Experimental result shows, in escherichia expression system, can express efficiently with the restructuring Hclocidin18 of BmCPV polyhedrin fusion.Because again folding optional for the biologic activity of Hclocidin18, we apply escherichia expression system, and it has simple high-density cells and cultivates program, lower production cost, is easy to isolation of occlusion bodies to carry out the advantages such as purifying.At expression in escherichia coli antibacterial peptide, selected suitable fusion partner can protect host cell to avoid product toxicity, can avoid proteolytic degradation again, be beneficial to purifying.
Above-described embodiment is a kind of preferably scheme of the present invention, not the present invention is done to any pro forma restriction, also has other variant and remodeling under the prerequisite that does not exceed the technical scheme that claim records.
SEQUENCE LISTING
<110> Zhejiang Province ocean exploitation research institute
The expression method of <120> antibacterial peptide Hclocidin18 in intestinal bacteria
<130> XF001
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> PRT
<213> native sequences
<400> 1
Trp Leu Asn Ala Leu Leu His His Gly Leu Asn Cys Ala Lys Gly Val
1 5 10 15
Leu Ala
<210> 2
<211> 54
<212> DNA
<213> artificial sequence
<400> 2
tggttgaacg cacttttgca tcacggactt aattgcgcta aaggtgttct tgct 54
<210> 3
<211> 29
<212> DNA
<213> artificial sequence
<400> 3
aacccatgga tatgccggat tattcatac 29
<210> 4
<211> 24
<212> DNA
<213> artificial sequence
<400> 4
tcgtgaattc atacgccgga ccag 24
<210> 5
<211> 703
<212> DNA
<213> native sequences
<400> 5
atggcagacg tagcaggaac aagtaaccga gactttcgcg gacgcgaaca aagactattc 60
aacagcgaac aatacaacta taacaacagc ctaaacggag aagtgagcgt gtgggtatac 120
gcatactact cagatgggtc agtactcgta atcaacaaga actcacagta caaagttggc 180
atttcagaga cattcaagac actcaaggaa tatcgcgagg gacagcacaa tgactcttac 240
gatgagtacg aggtgaacca aggcatctac tatcctaacg gcggtgacgc tcgcaagtac 300
cactcaaatg ctaaaccacg cgcaatccag atcgtcttca gtcctagtgt gaacgtacgc 360
accatcaaaa tggctaaggg taactcagta tctgtacctg atgagtatct acagcggtct 420
cacccatggg aagcaaccgg aattaagtac cgcaagatta agagagacgg agaaatcgtt 480
ggttacagtc attactttga actaccccat gaatataact cgatttcgct agcagtaagt 540
ggtgtacaca aaaacccatc atcatacaat gttggatcag cacacaacgt aatggacgtc 600
ttccaatcat gtgatctagc tcttagattc tgcaaccgct actgggctga actcgaattg 660
atcaatcact acgtttcacc gaacgcctac ccatacctcg ata 703
Claims (6)
1. a Hclocidin18 gene, its nucleotide sequence is as shown in SEQ ID No.2.
2. the expression method of antibacterial peptide Hclocidin18 in intestinal bacteria, is characterized in that comprising the steps:
A, plasmid construction: adopt intestinal bacteria to carry out construction of recombinant plasmid, using the polyhedrin of silkworm cytoplasmic polyhedrosis virus BmCPV as fusion partner;
B, abduction delivering;
The purifying of the fusion rotein of c, recombinant plasmid coding;
The collection of the cracking of d, fusion rotein and antibacterial peptide Hclocidin18.
3. expression method according to claim 2, is characterized in that in plasmid construction, detailed process is as follows:
First, add hydroxylamine cleavage site encoding sequence before Hclocidin18 gene, gene fragment 5 ' end adds EcoR I, and 3 ' end adds Xho I, and synthetic rear clone enters in pUC18, construction recombination plasmid pUC18-Hclocidin18;
Secondly, take BmCPV genome as template, utilize pcr amplification to obtain polyhedron gene, the upstream primer adopting has the nucleotide sequence as shown in SEQ ID No.3, downstream primer has the nucleotide sequence as shown in SEQ ID No.4, by polh fragment be cloned into Hclocidin18 gene in Puc18-Hclocidin18 before, obtain recombinant plasmid pUC18-polh-Hclocidin18, then polh-Hclocidin18 fusion gene fragment is wherein cloned in pET30 to the recombinant plasmid called after pET30a-polh-Hclocidin18 obtaining.
4. expression method according to claim 3, is characterized in that: the fusion rotein of recombinant plasmid pET30a-polh-Hclocidin18 coding is at N-terminal with His label, and it is expressed under IPTG induction and completes.
5. expression method according to claim 1, it is characterized in that: steps d is specific as follows: fusion rotein solution is mixed with oxyammonia scission reaction damping fluid, hatch 24h for 55 ℃, polh-Hclocidin18 fusion rotein success cracking, then 20mM pH7.8 PBS dialysis for scission reaction sample, centrifugal, the supernatant that acquisition contains Hclocidin18, preserve and freeze-drying after obtain the raw product of Hclocidin18.
6. expression method according to claim 5, it is characterized in that: the component of oxyammonia scission reaction damping fluid is as follows: 0.22 M Tris base, 1.7 M hydroxylamine-HCl, 4.5 M gua-nidine-HCl and 1% 1-propanol, pH 9.0; The volume ratio of fusion rotein solution and oxyammonia scission reaction damping fluid is 1:3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310639841.2A CN103667303A (en) | 2013-12-04 | 2013-12-04 | Expression method of antibacterial peptide Hclocidin18 in escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310639841.2A CN103667303A (en) | 2013-12-04 | 2013-12-04 | Expression method of antibacterial peptide Hclocidin18 in escherichia coli |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103667303A true CN103667303A (en) | 2014-03-26 |
Family
ID=50306076
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310639841.2A Pending CN103667303A (en) | 2013-12-04 | 2013-12-04 | Expression method of antibacterial peptide Hclocidin18 in escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667303A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107648587A (en) * | 2017-10-23 | 2018-02-02 | 安徽科技学院 | The application of antibacterial peptide and fusion protein in the medicine for preparing treatment helicobacter pylori disease |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101519442A (en) * | 2009-03-31 | 2009-09-02 | 安徽省农业科学院蚕桑研究所 | Method for inducing silkworms to produce antibacterial peptides |
| CN101845439A (en) * | 2010-04-27 | 2010-09-29 | 浙江大学 | Method for using silkworm cultured cell to express antibacterial peptide Cecropin B |
| CN102191251A (en) * | 2011-03-25 | 2011-09-21 | 盐城星海饲料有限公司 | Method for expressing Cecropin CM4 gene in sf9 insect cells |
-
2013
- 2013-12-04 CN CN201310639841.2A patent/CN103667303A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101519442A (en) * | 2009-03-31 | 2009-09-02 | 安徽省农业科学院蚕桑研究所 | Method for inducing silkworms to produce antibacterial peptides |
| CN101845439A (en) * | 2010-04-27 | 2010-09-29 | 浙江大学 | Method for using silkworm cultured cell to express antibacterial peptide Cecropin B |
| CN102191251A (en) * | 2011-03-25 | 2011-09-21 | 盐城星海饲料有限公司 | Method for expressing Cecropin CM4 gene in sf9 insect cells |
Non-Patent Citations (3)
| Title |
|---|
| LAVALLEE CM ET AL.: "EXPRESSION IN ESCHERICHIA COLI OF THE CLONED POLYHEDRIN GENE OF BOMBYX MORI CYTOPLASMIC POLYHEDROSIS VIRUS", 《PROTEIN EXPRESSION AND PURIFICATION》, no. 4, 31 December 1993 (1993-12-31), pages 570 - 579, XP024799954, DOI: 10.1006/prep.1993.1075 * |
| NCBI: "Halocynthia aurantium halocidin precursor mRNA,complete cds ACCESSION：EF363132.1", 《GENBANK》, 13 February 2007 (2007-02-13) * |
| 郭晓敏: "抗菌肽的融合表达及其生物活性的初步研究", 《中国优秀硕士学位论文全文数据库.基础科学辑》, no. 1, 15 January 2013 (2013-01-15), pages 006 - 72 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107648587A (en) * | 2017-10-23 | 2018-02-02 | 安徽科技学院 | The application of antibacterial peptide and fusion protein in the medicine for preparing treatment helicobacter pylori disease |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Molecular cloning and characterisation of a pattern recognition protein, lipopolysaccharide and β-1, 3-glucan binding protein (LGBP) from Chinese shrimp Fenneropenaeus chinensis | |
| CN104745595B (en) | Stichopus japonicus BPI genes, encoding proteins and its cloning process and restructuring stichopus japonicus BPI construction of genetic engineering methods | |
| CN106967660A (en) | A kind of genetic engineering bacterium for producing Resuscitation-promoting Factor and its application | |
| Huang et al. | A novel integrin function in innate immunity from Chinese mitten crab (Eriocheir sinensis) | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN108822202B (en) | Grass carp interleukin 21 recombinant protein and preparation method thereof | |
| CN107937406B (en) | Novel Crustin gene of portunus trituberculatus and application of recombinant protein thereof | |
| CN110592057B (en) | Chimeric lyase ILTphg and polynucleotides encoding same | |
| CN101392249A (en) | Antibiotic peptide gene, preparation method thereof and construction of expression plasmid of the same in pichia vector | |
| CN110408624A (en) | A kind of Ruditapes philippinarum c-type agglutinant protein and the preparation method and application thereof | |
| CN114181321A (en) | Lateolabrax japonicus FGF6A, FGF6B and FGF18 recombinant protein and preparation method and application thereof | |
| CN101525617B (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
| CN104531712B (en) | The preparation and application of Bemisia tabaci peptidoglycan recognition protein with bactericidal activity | |
| CN102586262B (en) | Defensin gene of antimicrobial peptide of bemisia tabaci (Gennadius), antimicrobial peptide encoded by defensin gene and preparation method for defensin gene | |
| CN103667303A (en) | Expression method of antibacterial peptide Hclocidin18 in escherichia coli | |
| CN102532325B (en) | Method for preparing cecropins AD and frog Buforin II fusion antimicrobial peptide by using hydroxylamine cutting method, and uses thereof | |
| CN107365372B (en) | L-type agglutinin of Litopenaeus vannamei, and coding gene and application thereof | |
| CN101565703B (en) | Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof | |
| CN110305890A (en) | The novel 5 kinds of antibacterial peptides expressing in series recombination engineering construction method of one kind and its application | |
| CN102260325B (en) | Antibacterial peptide NX-16, and preparation method and application thereof | |
| CN108048475B (en) | Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria | |
| CN102242138B (en) | Recombination expression of cynoglossus semilaevis antibacterial peptide hepcidin and application thereof | |
| CN107857805B (en) | Litopenaeus vannamei fibrinogen LvFREP and coding gene and application thereof | |
| CN111690636A (en) | Trypsin-like serine protease gene, encoded protein and application | |
| CN108864273A (en) | A kind of simulation human antibiotic peptide and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140326 |