CN103667278B - The nucleotide sequence of mediating plant male fertility and use its method - Google Patents
The nucleotide sequence of mediating plant male fertility and use its method Download PDFInfo
- Publication number
- CN103667278B CN103667278B CN201310750734.7A CN201310750734A CN103667278B CN 103667278 B CN103667278 B CN 103667278B CN 201310750734 A CN201310750734 A CN 201310750734A CN 103667278 B CN103667278 B CN 103667278B
- Authority
- CN
- China
- Prior art keywords
- plant
- sequence
- nucleotide sequence
- ribonucleotide
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of nucleotide sequence of mediating plant male fertility and use its method, described nucleotide sequence coded following RNA molecule, described RNA molecule suppresses plant MS26 genetic expression, comprise SEQ? ID? shown in NO:1 at least 19 continuous nucleotide and/or its complementary sequence.The present invention utilizes RNAi technology to construct MS26 male sterile line first, described MS26 male sterile line inhibits the expression of corn MS26 gene, the plant that holandry is sterile can be obtained, the cycle of cross-breeding can not only be shortened, solve current male sterile line scarcity of resources more targetedly, the present situation that hybridization seed production purity is not high, and eliminate the step of emasculation in hybrid seeding process, reduce mechanical emasculation to the physical abuse of milpa and yield effect, ensure that purity and the output of cross-fertilize seed matter, thus realize maximum economic benefit.
Description
Technical field
The present invention relates to a kind of nucleotide sequence of mediating plant male fertility and use its method, particularly relating to and a kind ofly utilize RNAi technology specific depletion or close the expression of fertile gene to produce the genetic method of male sterile plants.
Background technology
Hybrid vigour refers to the performance of F1 cross-fertilize seed than the exhibits excellent of the parent producing F1.In crop plants, hybrid vigour is shown as the output of larger plant, stress tolerance, disease resistance, consistence and raising usually aborning, and these are collectively referred to as cross-fertilize seed vigor.
Hybrid vigour has been observed and has recorded in much important crop varieties, and the development of cross-fertilize seed is considered as routine by plant breeders.But when there is effective and economic pollination control method in plant to ensure cross-pollination and to prevent self-pollination, cross-fertilize seed just can be used to above-mentioned plant.Pollination controlling mechanism comprise machinery, chemistry with the method for heredity.
If the plant flower that spatial separation is male with female or be separated male and female plants, then can be suitable for the mechanical means that hybrid plants is produced.Such as, in the terminal inflorescence of milpa, have the male flower producing pollen, female flower is in the rachis portion along stem.The outcrossing of corn by the mechanical emasculation of female parent to prevent from selfing to guarantee.Although emasculation is at present used in the cross-fertilize seed seed produces of plant, as corn, according to actual emasculation cost and the production loss of maternal emasculation, said process is labor-intensive and is expensive.In addition, during the functional male of most of crop plants and female organ are all spent at same, therefore emasculation is not a simple process.Although can with hand removing pollen formation organ before loose powder, the method that above-mentioned cross-fertilize seed produces be extremely labor-intensive and expensive.
The chemical process of producing hybrid plant comprises use pharmaceutical chemicals and kills or stop the formation of fertile pollen.These pharmaceutical chemicalss are called as gametocide, are used to give temporary transient male sterile.Due to lasting duration and the reliability of the expense of pharmaceutical chemicals and validity and application, the commercially producing of hybrid plant using gametocide to carry out is restricted.The limitation that of gametocide is serious is that it has phytotoxic impact, and its severity depends on genotype.It is not necessarily effective for the crop in kind of blooming period prolonging that other limitation comprises these pharmaceutical chemicalss, because newly the spending and may not be affected of growth.Therefore, the above-mentioned pharmaceutical chemicals of repeated application is needed.
Last century the nineties, the people such as Mariani have started the new way manually preparing male sterile line, they utilize from the specific promoter (TA29) of the anther tapetum of tobacco and ribonuclease gene (Barnase) construction expression box transformation of tobacco and rape, the anther tapetum of transfer-gen plant is caused to be destroyed, form male sterile line, and do not affect other proterties of transfer-gen plant.Except utilizing Barnase to build except male sterile line, current a lot of research shows that other functional gene also can be widely used in gene engineering method to build Transgenic male sterile plant.
Van der Meer etc. suppress, with the expression of pollen development genes involved chalcone synthase (CHS), to achieve the male sterile of petunia by the method that RNA disturbs; Antisense alternative oxidase (alternative oxidase) is connected with TA29 and forms mosaic gene transformation of tobacco by Kitashiba etc., causes the abortion of transgene tobacco partial pollen.Since MS26 gene is cloned out, mainly recover the fertility of MS26 mutant with this gene, do not find so far to utilize RNAi technology to build the relevant report of MS26 male sterile line.
Summary of the invention
The object of this invention is to provide a kind of nucleotide sequence of mediating plant male fertility and use its method, namely utilizing RNAi technology to obtain new MS26 male sterile strain.
For achieving the above object, the invention provides a kind of nucleotide sequence, it is characterized in that, its following RNA molecule of encoding, described RNA molecule suppresses plant MS26 genetic expression, comprises at least 19 continuous nucleotides shown in SEQ ID NO:1 and/or its complementary sequence.
Further, described nucleotide sequence comprises at least 19 continuous nucleotides shown in SEQ ID NO:1 500-1000 position and/or its complementary sequence.
Further, described nucleotide sequence comprises SEQ ID NO:2 and/or its complementary sequence.
Preferably, described nucleotides sequence is classified as SEQ ID NO:3.
For achieving the above object, present invention also offers a kind of expression cassette, be included in the described nucleotide sequence under the regulating and controlling sequence regulation and control effectively connected.
For achieving the above object, present invention also offers a kind of recombinant vectors comprising described nucleotide sequence or described expression cassette.
For achieving the above object, present invention also offers a kind of ribonucleotide, it suppresses plant MS26 genetic expression, and transcribed by following DNA sequence dna, described DNA sequence dna comprises described nucleotide sequence.
For achieving the above object, present invention also offers a kind of for suppressing the method for plant MS26 genetic expression, comprising and utilizing described ribonucleotide to suppress the expression of plant MS26 gene.
For achieving the above object, present invention also offers a kind of male sterile method of inducing plant, comprise and utilize described ribonucleotide to suppress the expression of plant MS26 gene.
Further, described ribonucleotide comprises the first ribonucleotide and the second ribonucleotide, described first ribonucleotide suppresses the expression of plant MS26 gene, described second ribonucleotide and described first ribonucleotide complementation.
Further, described ribonucleotide also comprises intervening sequence.
Preferably, described ribonucleotide is SEQ ID NO:3.
For achieving the above object, present invention also offers a kind of method producing male sterile plants, comprise described expression cassette introduced plant cell to produce transfer-gen plant.
Preferably, described plant is soybean, wheat, barley, corn, tobacco, paddy rice, rape or Sunflower Receptacle.
The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.
The preferred method carrying out posttranscriptional gene containment in plant use justice directed and antisense orientation, through the stable RNA transcribed, such as, as hair fastener and loop-stem structure.So following for carrying out the preferred DNA construct of posttranscriptional gene containment, wherein, first paragraph fragment coding shows the RNA of antisense orientation, it shows the perfect homology between target gene fragment to be contained, described first paragraph fragment is connected with second segment fragment, and second segment fragment coding shows has highly complementary RNA with first paragraph fragment.This type of construct is estimated to be formed loop-stem structure (this to be hybridized with second segment fragment by first paragraph fragment to be formed) and from the ring structure both being connected.
In the present invention, " nucleic acid " refers to list or the dichain polymer of the thymus nucleic acid that from 5 ' to 3 ' end is read or ribonucleic acid base.Alternatively, " nucleic acid " also can contain non-natural exists or reformed base, and it allows the correct reading by polysaccharase, can not reduce the expression of the polypeptide of this nucleic acid encoding." nucleotide sequence " refers to as the existence of independent strand or the justice and the antisense strand that are present in the nucleic acid in disome." Yeast Nucleic Acid " (RNA) comprises RNAi(RNA interference), dsRNA(double-stranded RNA), siRNA(siRNA), mRNA(messenger RNA(mRNA)), miRNA(Microrna), tRNA(transfer RNA, quilt or do not added electric charge by corresponding acylated amino) and cDNA and genomic dna and DNA RNA hybrid." nucleic acid fragment ", " nucleic acid sequence fragments " or more common " fragment " will be readily appreciated by one skilled in the art for: it comprises the nucleotide sequence of genome sequence, ribosomal RNA sequences, transfer RNA sequence, messenger RNA(mRNA) sequence, operon sequence and less engineered mistake, and described sequence is expressed maybe can be transformed into marking protein, polypeptide or peptide.
In the present invention " expression " refer to transcribing and stable accumulation of the justice that obtains from nucleic acid disclosed by the invention or sense-rna.Expression can also represent the translation of mRNA to polypeptide or protein.In the present invention, " justice " RNA refers to the rna transcription basis corresponding to following sequence or fragment, and described sequence or fragment exist with the form translating into the mRNA of protein by vegetable cell.In the present invention, " antisense " RNA refers to the RNA with all or part of complementation of the normal mRNA produced in plant.The complementation of sense-rna can be any part for specific gene transcript, i.e. 5 ' non-coding sequence, 3 ' non-coding sequence, intron or encoding sequence.What in the present invention, " rna transcription this " referred to carry out DNA sequence dna transcribes by RNA polymerase catalysis the product obtained.When rna transcription is originally the complete complementary copy of DNA sequence dna, it is called as one-level transcript, or it can be RNA one-level transcript being transcribed to post-treatment acquisition, and it is called as mature rna.
They be at least about 19 to about 23 Nucleotide for DNA fragmentation length of the present invention, or about 23 to about 100 Nucleotide, but are less than about 2000 Nucleotide.
In the present invention " suppression to genetic expression " refer to that the albumen of target gene and/or mRNA product level do not exist (or observable reduction).Specificity refers to: suppress target gene and do not have influential ability without effect to any gene in the cell producing dsRNA molecule to other gene of cell.
In the present invention dsRNA or siRNA molecule comprise double-strand through polymerization ribonucleotide, it can comprise the modification to phosphoric acid ester sugar backbone or nucleosides.Modification in RNA structure can be coupled with tail, suppresses to allow specific genetic.
By enzyme method, dsRNA molecule is modified in the present invention, can siRNA be produced.SiRNA can effectively mediate negative tune effect for target gene.This enzyme method has come by utilizing RNAse III enzyme that exists in vegetable cell or DICER enzyme in eucaryotic RNA i approach.The method also can utilize restructuring DICER or RNAse III be incorporated in vegetable cell by recombinant DNA technology to carry out, and this is that those skilled in the art easily know.Naturally be present in DICER enzyme that is in vegetable cell or that manufactured by recombinant DNA technology or larger dsRNA chain can be cut into less oligonucleotide by RNAse III.DsRNA molecule can be cut into siRNA fragment by DICER enzyme specifically, and wherein, it is long that each siRNA fragment is approximately 19-25 Nucleotide, and dsRNA molecule is cut into the siRNA of 12-15 base pair by RNAse III enzyme usually.The siRNA molecule produced by above-mentioned any enzyme has 3 ' suspension of 2-3 Nucleotide and 5 ' phosphoric acid and 3 ' C-terminal.By RNAse III enzyme produce siRNA with in eucaryotic RNA i approach by DICER manufacture identical, therefore can be targeted, and after loose by interior intracellular rna degradation mechanism degrade, be separated into single stranded RNA, and the RNA sequence hybridization of transcribing with target gene.This method the RNA sequence nucleotide sequence coded to target gene effectively can be degraded or removes.Result is target gene silence.
DsRNA molecule can the interior or external synthesis by body.DsRNA can by the RNA chain formation of wall scroll self-complementary, or can by two complementary RNA chain formation.The Endogenous RNA polymerase of cell can mediate transcription in vivo, or the RNA polymkeric substance of clone can be used in body or in-vitro transcription.Targeted inhibition can be carried out: the specific transcriptional in organ, tissue or cell type by following method; The stimulation of envrionment conditions (such as, infect, coerce, temperature, chemical inducer); And/or the engineering to carry out in the etap is transcribed.RNA chain can yes or no gather polyadenylation; RNA chain or can not be translated as polypeptide by the translating equipment of cell.
RNA, dsRNA, siRNA or miRNA of the present invention are produced by chemical process or enzyme method by those skilled in the art, and this is by artificial or automatic reaction or carry out in another organism.Also manufacture RNA by organic synthesis partially or completely; Any ribonucleotide through modifying is introduced by vitro enzyme synthesis or organic synthesis.RNA can be synthesized by intracellular rna polysaccharase or phage rna polymerase (such as T3, T7, SP6).Expression construct use and manufacture is known in the art.If synthesized by chemosynthesis or by vitro enzyme, before introducing cell, purifying can be carried out to RNA.Such as by with solvent or resin extraction, precipitation, electrophoresis, chromatogram or its combination, RNA can be purified into from mixture.Or, at not purifying or RNA can be used when only carrying out minimal purifying, to avoid because the loss caused processed by sample.RNA can be dried with storage, or be dissolved in the aqueous solution.Solution can contain buffer reagent and salt, to promote the stable of disome chain and/or annealing.
Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, leader sequence, intron and other be operably connected to the adjustment sequence of described target gene.
Described promotor is effable promotor in plant, and described " in plant effable promotor " refers to and guarantee that connected encoding sequence carries out the promotor expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from the promotor etc. of the 35S promoter of cauliflower mosaic virus, ubi promoter of maize, paddy rice GOS2 gene.Alternatively, in plant, effable promotor can be tissue-specific promotor, namely this promotor in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization (test by conventional RNA and measure) of plant in chlorenchyma, as PEP carboxylase promoter.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the proteolytic enzyme suppressor gene (pin I and pin II) of potato and tomato and the promotor of zein enzyme level gene (MPI).
Described transit peptides (also known as secretory signal sequence or targeting sequencing) instructs transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.
Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus leaders, as MDMV(Maize Dwarf Mosaic Virus) leader sequence; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.
Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.
For monocotyledons application for, described intron including but not limited to, corn hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or paddy rice Act1 intron.For dicotyledons application for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.
Described terminator can for the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from the polyadenylation signal sequence of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.
Nucleotide sequence of the present invention can comprise the inverted repeat separated by " intervening sequence ".Intervening sequence can be the region comprising following any nucleotide sequence, and if necessary, described nucleotide sequence can promote that between every section of repetition, secondary structure is formed.Intervening sequence is a part for justice for mRNA or antisense encoding sequence.Or intervening sequence can comprise can any combination of the Nucleotide covalently bound with nucleic acid molecule or its homologue.Intervening sequence can comprise the nucleotide sequence that length is at least approximately 10-100 Nucleotide, or length is at least about 100-200 Nucleotide, and length is at least about 200-400 Nucleotide, or length is at least about 400-500 Nucleotide.
" effectively connect " described in the present invention represents the connection of nucleotide sequence, and described connection makes a sequence can provide function concerning needing linked sequence." effectively connect " in the present invention and can, for promotor to be connected with interested sequence, make transcribing of this interested sequence be subject to the control of this promotor and regulation and control." effectively connect " when interested sequence encoding albumen and when going for the expression of this albumen and represent: promotor is connected with described sequence, and the mode be connected makes the transcript efficient translation obtained.If the connection of promotor and encoding sequence is transcript when merging and want the expression realizing the albumen of encoding, manufactures such connection, make the first translation initiation codon in the transcript obtained be the initiator codon of encoding sequence.Alternatively, if the connection of promotor and encoding sequence is translated when merging and want the expression realizing the albumen of encoding, manufacture such connection, the first translation initiation codon of containing in 5 ' non-translated sequence and promotor are connected, and mode of connection make the translation product obtained meet reading frame with the relation of the translation opening code-reading frame of the albumen wanted of encoding.The nucleotide sequence that can " effectively connect " includes but not limited to: sequence (the i.e. gene expression element providing genetic expression function, such as promotor, 5 ' untranslated region, intron, protein encoding regions, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), the sequence of marker function of can scoring is provided, interior sequence (the i.e. polylinker sequence of assisting series of operations of external or body, Site-specific recombinase sequence) and sequence (the i.e. replication orgin of bacterium of copy function is provided, autonomously replicating sequence, centromeric sequence).
Nucleic acid molecule or its fragment can carry out specific hybrid with other nucleic acid molecule in any case.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementary completely, then one of them nucleic acid molecule is claimed to be another nucleic acid molecule " complement ".In the present invention, when corresponding nucleotide complementary with another nucleic acid molecule of each Nucleotide of a nucleic acid molecule, then these two nucleic acid molecule are claimed to demonstrate " complete complementary ".If two nucleic acid molecule can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if two nucleic acid molecule can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecule are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecule as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salt concn.
In the present invention, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salt concn in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salt concn can all change, and also can one of them to remain unchanged and another variable changes.
Construct described in the present invention or described recombinant vectors are imported plant, and conventional transformation methods includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, direct DNA DNA being taken in the mediation of protoplastis, electroporation or silicon whisker imports.
Described in the present invention by nucleotide sequence " introducing " plant time, it represents and to occur by the method that directly transforms, and described method is such as to the Agrobacterium-medialed transformation, corpuscular emission bombardment, electroporation etc. of plant tissue; Or by the plant and another plant with heterologous nucleotide sequence are hybridized to carry out, offspring is had and is incorporated to their genomic nucleotide sequences.This type of breeding technique well known to a person skilled in the art.
The invention provides a kind of nucleotide sequence of mediating plant male fertility and use its method, having the following advantages:
1, the present invention utilizes RNAi technology to construct MS26 male sterile line first.
2, abortion is thorough.The MS26 male sterile line that the present invention utilizes RNAi technology to build inhibits the expression of corn MS26 gene, can obtain the sterile plant of holandry.
3, profitable, purity is high.The MS26 male sterile line that the present invention utilizes RNAi technology to build can not only shorten the cycle of cross-breeding, solves current male sterile line scarcity of resources more targetedly, the present situation that hybridization seed production purity is not high; And eliminate the step of emasculation in hybrid seeding process, reduce mechanical emasculation to the physical abuse of milpa and yield effect, ensure that purity and the output of cross-fertilize seed matter, thus realize maximum economic benefit.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
Accompanying drawing explanation
Fig. 1 be mediating plant male fertility of the present invention nucleotide sequence and use its method recombinant cloning vector DBN01-T build schema;
Fig. 2 be mediating plant male fertility of the present invention nucleotide sequence and use its method recombinant expression vector DBN100349 build schema;
Fig. 3 is the nucleotide sequence of mediating plant male fertility of the present invention and uses its transgenic corn plant T of method
0the pollen in generation and anther development figure;
Fig. 4 is the nucleotide sequence of mediating plant male fertility of the present invention and uses its transgenic corn plant T of method
1the pollen in generation and anther development figure.
Embodiment
Further illustrate the nucleotide sequence of mediating plant male fertility of the present invention below by specific embodiment and use its technical scheme of method.
The synthesis of the first embodiment, rZmMS26 nucleotide sequence
According to known ZmMS26 nucleotide sequence (as shown in SEQ ID NO:1 in sequence table), obtain RZmMS26 nucleotide sequence of the present invention as shown in SEQ ID NO:2 in sequence table; Described rZmMS26 nucleotide sequence is as shown in SEQ ID NO:3 in sequence table, and described rZmMS26 nucleotide sequence is synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of the described rZmMS26 nucleotide sequence (SEQ ID NO:3) of synthesis is also connected with RsrII restriction enzyme site, and 3 ' end of described rZmMS26 nucleotide sequence (SEQ ID NO:3) is also connected with BsaI restriction enzyme site.
The structure of the second embodiment, recombinant expression vector and recombinant expression vector transformation Agrobacterium
1, the recombinant cloning vector DBN01-T containing rZmMS26 nucleotide sequence is built
The rZmMS26 nucleotide sequence of synthesis is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by Promega Products pGEM-T carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; RZmMS26 is rZmMS26 nucleotide sequence (SEQ ID NO:3); MCS is multiple clone site).
Then by recombinant cloning vector DBN01-T heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake), scribble IPTG(isopropylthio-β-D-galactoside on surface) and the chloro-3-indoles of the bromo-4-of X-gal(5--β-D-galactoside) LB flat board (the Tryptones 10g/L of penbritin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, the precipitation thalline solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that 150 μ l newly prepare), pipe is put upside down 4 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ l (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, adds 2 times of volume dehydrated alcohols in supernatant liquor, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant liquor, and precipitation concentration (V/V) is dry after the washing with alcohol of 70%; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.
The plasmid extracted is after RsrII and BsaI enzyme cuts qualification, sequence verification is carried out to positive colony, result shows that the described rZmMS26 nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:3, and namely rZmMS26 nucleotide sequence correctly inserts.
2, the recombinant expression vector DBN100349 containing rZmMS26 nucleotide sequence is built
With restriction enzyme RsrII and BsaI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), between RsrII and the BsaI site rZmMS26 nucleotide sequence fragment cut being inserted into expression vector DBNBC-01, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector DBN100349, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:4); RZmMS26:rZmMS26 nucleotide sequence (SEQ ID NO:3); Nos: the terminator (SEQ ID NO:5) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQ ID NO:6); LB: left margin).
By recombinant expression vector DBN100349 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100349), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme RsrII of extraction and BsaI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression vector DBN100349 between RsrII and BsaI site is classified as nucleotide sequence, i.e. rZmMS26 nucleotide sequence shown in SEQ ID NO:3 in sequence table.
3, recombinant expression vector transformation Agrobacterium
Through building correct recombinant expression vector DBN100349 liquid nitrogen method, Agrobacterium LBA4404 (Invitrgen is transformed into oneself, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector); Be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes; Agrobacterium LBA4404 after conversion is inoculated in LB test tube and cultivates 2 hours under temperature 28 DEG C, rotating speed are 200rpm condition, be applied on the LB flat board containing the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, carry out digestion verification after cutting recombinant expression vector DBN100349 enzyme with restriction enzyme A hdI and AatII, result shows that recombinant expression vector DBN100349 structure is entirely true.
3rd embodiment, the acquisition proceeding to the milpa of rZmMS26 nucleotide sequence and checking
1, the milpa proceeding to rZmMS26 nucleotide sequence is obtained
The Agrobacterium infestation method conveniently adopted, the corn variety of sterile culture is combined 31(Z31) rataria and the second embodiment in Agrobacterium Dual culture described in 3, so that the T-DNA(in the 2 recombinant expression vector DBN100349 built in the second embodiment is comprised rZmMS26 nucleotide sequence, the promoter sequence of corn Ubiquitin gene, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtain the milpa proceeding to rZmMS26 nucleotide sequence; In contrast with wild-type corn plant simultaneously.
For agriculture bacillus mediated corn transformation, briefly, from corn, be separated immature rataria, contact rataria with agrobacterium suspension, wherein rZmMS26 nucleotide sequence can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium.In this step, rataria preferably immerses agrobacterium suspension (OD660=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (MS division culture medium and MS root media) containing the callus that the substratum of selective agent grows.
Screen the resistant calli obtained and transfer to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.
2, the milpa of rZmMS26 nucleotide sequence is proceeded to TaqMan checking
The blade getting the milpa proceeding to rZmMS26 nucleotide sequence is about 100mg as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detected the copy number of rZmMS26 nucleotide sequence by Taqman fluorescence probe quantitative PCR method.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.
The concrete grammar detecting rZmMS26 nucleotide sequence copy numbers is as follows:
Step 11, get each 100mg of blade of milpa and the wild-type corn plant proceeding to rZmMS26 nucleotide sequence respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;
The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;
Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;
The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Following primer and probe are used for detecting rZmMS26 nucleotide sequence:
Primer 1(MF1): CATCGTCCAGCACTGCTATTACC is as shown in SEQ ID NO:7 in sequence table;
Primer 2 (MR1): TTTGCTCCATAGATCGTATGATGTG is as shown in SEQ ID NO:8 in sequence table;
Probe 1(MP1): CAGCCAGACTGTCGGATGGACCACAC is as shown in SEQ ID NO:9;
PCR reaction system is:
Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.
PCR reaction conditions is:
Utilize SDS2.3 software (Applied Biosystems) analytical data.
Experimental result shows, rZmMS26 nucleotide sequence oneself be incorporated in the genome of detected milpa, and the milpa proceeding to rZmMS26 nucleotide sequence obtains the transgenic corn plant containing single copy rZmMS26 nucleotide sequence.
4th embodiment, analysis transgenic corn plant
For plant configuration in the 3rd embodiment, there is the milpa (T proceeding to rZmMS26 nucleotide sequence described in single copy
0) 18 strains are assessed, analyze for flower pesticide and pollen.Except the degree of male fertility, between the milpa and wild-type corn adjoining tree of the described rZmMS26 of proceeding to nucleotide sequence, do not observe other form different.Result shows: have the milpa (T proceeding to rZmMS26 nucleotide sequence described in single copy
0) be that (partly-completely) is male sterile in various degree, wherein show as holandry sterile have 12 strains (Fig. 3, flower pesticide is shrivelled in yellow, and WUHUAFEN dyes), account for 66.7% of test transgenosis strain number.Wild-type corn adjoining tree is then (Fig. 3, flower pesticide is full in green, normal pollen staining) that holandry can be educated.The milpa proceeding to rZmMS26 nucleotide sequence described in sterile by holandry obtains T
1for seed, after planting grow up to T
1for plant, all T
1pollen formation (Fig. 4) is not all had for plant.
Prove that the milpa proceeding to rZmMS26 nucleotide sequence utilizing RNAi technology to build inhibits the expression of corn MS26 gene, can obtain the plant that holandry is sterile thus.
In sum, the present invention utilizes RNAi technology to construct MS26 male sterile line first, and described MS26 male sterile line inhibits the expression of corn MS26 gene, can obtain the plant that holandry is sterile; Described MS26 male sterile line can not only shorten the cycle of cross-breeding, solve current male sterile line scarcity of resources more targetedly, the present situation that hybridization seed production purity is not high, and eliminate the step of emasculation in hybrid seeding process, reduce mechanical emasculation to the physical abuse of milpa and yield effect, ensure that purity and the output of cross-fertilize seed matter, thus realize maximum economic benefit.
It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.
Claims (11)
1. a nucleotide sequence, is characterized in that, its following RNA molecule of encoding, and described RNA molecule suppresses plant MS26 genetic expression, and described nucleotide sequence is made up of the complementary sequence of SEQ ID NO:2, intervening sequence and SEQ IDNO:2.
2. nucleotide sequence according to claim 1, it is characterized in that, described nucleotides sequence is classified as SEQID NO:3.
3. an expression cassette, is characterized in that, is included in nucleotide sequence described in the claim 1 or 2 under the regulating and controlling sequence regulation and control effectively connected.
4. one kind comprises the recombinant vectors of expression cassette described in nucleotide sequence described in claim 1 or 2 or claim 3.
5. a ribonucleotide, is characterized in that, it suppresses plant MS26 genetic expression, and transcribed by following DNA sequence dna, described DNA sequence dna is nucleotide sequence described in claim 1 or 2.
6. for suppressing a method for plant MS26 genetic expression, it is characterized in that, comprise and utilize ribonucleotide described in claim 5 to suppress the expression of plant MS26 gene, described plant is corn.
7. the male sterile method of inducing plant, is characterized in that, comprise and utilize ribonucleotide described in claim 5 to suppress the expression of plant MS26 gene, described plant is corn.
8. the male sterile method of inducing plant according to claim 7, it is characterized in that, described ribonucleotide comprises the first ribonucleotide and the second ribonucleotide, described first ribonucleotide suppresses the expression of plant MS26 gene, described second ribonucleotide and described first ribonucleotide complementation.
9. the male sterile method of inducing plant according to claim 8, it is characterized in that, described ribonucleotide also comprises intervening sequence.
10. the male sterile method of inducing plant according to claim 9, it is characterized in that, described ribonucleotide is transcribed by SEQ ID NO:3.
11. 1 kinds of methods producing male sterile plants, it is characterized in that, comprise by expression cassette introduced plant cell described in claim 3 to produce transfer-gen plant, described plant is corn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310750734.7A CN103667278B (en) | 2013-12-31 | 2013-12-31 | The nucleotide sequence of mediating plant male fertility and use its method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310750734.7A CN103667278B (en) | 2013-12-31 | 2013-12-31 | The nucleotide sequence of mediating plant male fertility and use its method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667278A CN103667278A (en) | 2014-03-26 |
| CN103667278B true CN103667278B (en) | 2015-10-28 |
Family
ID=50306051
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310750734.7A Active CN103667278B (en) | 2013-12-31 | 2013-12-31 | The nucleotide sequence of mediating plant male fertility and use its method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667278B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2552657A (en) * | 2016-07-29 | 2018-02-07 | Elsoms Dev Ltd | Wheat |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001006845A1 (en) * | 1999-07-25 | 2001-02-01 | State Of Israel/Ministry Of Agriculture | A method for obtaining 100 % male sterile plants to serve as the female parent in hybrid seeds production |
| CN101248183A (en) * | 2005-06-24 | 2008-08-20 | 先锋高级育种国际公司 | Nucleotide sequences mediating plant male fertility and method of using same |
| US7612251B2 (en) * | 2000-09-26 | 2009-11-03 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating male fertility and method of using same |
-
2013
- 2013-12-31 CN CN201310750734.7A patent/CN103667278B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001006845A1 (en) * | 1999-07-25 | 2001-02-01 | State Of Israel/Ministry Of Agriculture | A method for obtaining 100 % male sterile plants to serve as the female parent in hybrid seeds production |
| US7612251B2 (en) * | 2000-09-26 | 2009-11-03 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating male fertility and method of using same |
| CN101248183A (en) * | 2005-06-24 | 2008-08-20 | 先锋高级育种国际公司 | Nucleotide sequences mediating plant male fertility and method of using same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667278A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2015007194A1 (en) | Method for plant genome site-directed modification | |
| CN103667211B (en) | Affect the protein of male fertility, its encoding gene and purposes | |
| WO2016029630A1 (en) | Regulatory sites of mir528 and use thereof | |
| EP2935586B1 (en) | Plant regulatory elements and uses thereof | |
| CN109207512A (en) | Plant control element and its application | |
| JP7438253B2 (en) | Plant regulatory elements and their uses | |
| EP3058073B1 (en) | Zea mays regulatory elements and uses thereof | |
| CN111630171A (en) | Lodging resistance of plants | |
| KR100899993B1 (en) | A Low Nicotine Transgenic Tabacco and A method of producing thereof | |
| CN103667209B (en) | Protein influencing male fertility and coding gene and application thereof | |
| CN103667278B (en) | The nucleotide sequence of mediating plant male fertility and use its method | |
| CN103667277B (en) | The nucleotide sequence of mediating plant male fertility and use its method | |
| CN105219773A (en) | Chimeric promoters and uses thereof | |
| US10047368B2 (en) | Zea mays regulatory elements and uses thereof | |
| US20160138032A1 (en) | Poaceae plant whose flowering time is controllable | |
| BR102014024813A2 (en) | metallothionein-type regulatory elements of zea mays and their uses | |
| CN105112423B (en) | It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application | |
| CN103525809A (en) | Building body of mediating plant fertility and application thereof | |
| CN103387984B (en) | Application of microRNA396d or coding gene thereof in regulation of rice plant height | |
| CN105566468A (en) | Plant fertility related protein and applications thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN103709240B (en) | The nucleotide sequence of mediating plant male fertility and use its method | |
| CN110964724B (en) | Application of cymbidium goeringii miR390c in enhancing cold resistance of plants | |
| US10370676B2 (en) | Genes related to salt or drought stress resistances and transformed plants with the same | |
| CN109384835B (en) | Insect-resistant related protein and application of encoding gene thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Patentee after: Beijing Dabeinong Technology Group Co., Ltd. Patentee after: BEIJING DBN BIOTECH CO., LTD. Address before: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Patentee before: Beijing Dabeinong Technology Group Co., Ltd. Patentee before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd. |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20200907 Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49 Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd. |
|
| TR01 | Transfer of patent right |