CN103525809A - Building body of mediating plant fertility and application thereof - Google Patents

Abstract

The invention relates to a building body of mediating plant fertility and application thereof. The building body comprises (a) a first nucleotide sequence, wherein male fertility of a plant is restored when the first nucleotide sequence is expressed; (b) a second nucleotide sequence, wherein formation or function of fertile male gametes in the plant is inhibited when the second nucleotide sequence is expressed, (3) a third nucleotide sequence, wherein inhibition or neutralization on a herbicide is formed when the third nucleotide sequence is expressed. The building body of mediating plant fertility and application thereof disclosed by the invention are applied to a method for keeping a homozygous recessive state of a male sterile plant, so that the building body is good in benefit, and simple to operate; the generated male sterile descendant is non-transgenic; the building body is convenient to identify, high in sorting efficiency, good in effect and especially applicable to the situation that the contained building body is inconveniently identified in the seed stage when the building body is applied to the method for producing seeds from the plant with female gametes and male gametes.

Description

The construct of mediated plant fertility and application thereof

Technical field

The present invention relates to a kind of construct and application thereof of mediated plant fertility, particularly relate to a kind of construct and application thereof of the mediated plant fertility that comprises herbicide resistance gene.

Background technology

The development of plant hybridization breeding technique makes the quality of crop and the raising that quantity all has certain degree.Due to the application of hybridization technique, output is increased and expect that the various combinations of feature (variation that for example disease resistance, insect-resistant, thermotolerance, drought tolerance and plant form) all become possibility.Generally, the application-dependent of hybridization technique, in the male parent of pollen is provided to female parent, obtains cross-fertilize seed thus.

If transfer to same of same plant or another from the pollen envelop of a flower, take, so exactly this plant is being carried out to self-pollination.If pollen is from the flower of different plants, plant is just by cross-pollination so.Paddy rice breeds by self-pollination conventionally, and rape is cross-pollination.Corn shows unique situation, and it both can also can be bred by cross-pollination by self-pollination.

The method of control plant fertility is very important for the improvement of plant breeding, and especially, for the exploitation of corn hybrid seed, it depends on certain male sterility system.

To the exploitation of corn hybrid seed, need to develop the self-mating system of isozygotying, make these hybridizations between selfed lines, and assess crossbred.First-generation cross-fertilize seed offspring is named as F ₁.In to the exploitation of cross-fertilize seed, only investigate F ₁cross-fertilize seed plant.F ₁cross-fertilize seed is more healthy and stronger than its self-mating system parent.The stalwartness of this cross-fertilize seed or hybrid vigour can embody by number of ways, comprise and have additional nutrients growth and increase output.

Can produce corn hybrid seed by male sterility systems such as artificial emasculations.For producing cross-fertilize seed, from the maternal self-mating system (it can be planted in multiple different mode from male parent self-mating system) of growing, manually remove tassel.Subsequently, as long as enough separation are carried out in external Pollen Maydis source, the young fringe of maternal self-mating system will be only fertilized from the pollen of male parent self-mating system, and the seed obtaining is cross-fertilize seed (F ₁), and form crossbred plant.

But environmental change may cause after female parent is carried out to artificial emasculation plant tassel again.Or may not remove the tassel of maternal self-mating system plant completely.The generation of above-mentioned situation all will cause the maternal plant pollen that successfully comes off, and some maternal plants, by self-pollination, make to be mingled with maternal self-mating system seed in the normal cenospecies of producing, and the productivity of maternal self-mating system seed are not as F ₁seed.In addition, the existence of maternal self-mating system seed is representing a kind of germplasm security risk concerning the company of production cross-fertilize seed.

Or, can be by machine to the emasculation of maternal self-mating system plant.The reliability of machinery emasculation and artificial emasculation is basic identical, but faster and cost is lower.Yet, to compare with artificial emasculation, most of emasculation machines can cause more injury to plant.Therefore the emasculation mode, not also being entirely satisfactory is at present to reduce production costs and to eliminate maternal self-pollination in cenospecies production.

Heritable male sterility system is a kind of reliable mode.By using cytoplasmic male sterilty (CMS) self-mating system, in some genotype, avoided heavy emasculation process.When lacking fertility and recover gene, CMS self-mating system plant is male sterile, and this is owing to from cytogene group but not the factor of nuclear genome.Therefore, this feature exclusively by maternal inheritance, maternal provides tenuigenin to fertilization seed because only have in milpa.Use the pollen from non-male sterile another self-mating system to make the fertilization of CMS plant, from the pollen of the second self-mating system, can or can not contribute and make the male fertile gene of crossbred plant.Conventionally, the seed fusion that the normal corn seed of the emasculation of hanging oneself must be produced with the CMS of same crossbred, to guarantee there is enough pollen for fertilization and guarantees Cytoplasmic diversity when the crossbred plant strain growth.

But, there are some researches show that the specific mutation of CMS is relevant with some crop disease susceptibility.This problem has hindered the widespread use of CMS mutant in corn hybrid seed is produced, and has produced what is more negative impact.

Brar etc. disclose a kind of Sterility of inheritance type, but it need to keep various mutations gene by a plurality of different positionss in genome, and in order to follow the tracks of gene and to make system conveniently also need complicated Mk system.Patterson has also described a kind of chromosome translocation genic system, but also very complicated.

In order to improve above-mentioned defect, Fabijanski etc. have developed a lot of methods to cause plant male sterile.Method comprises that this gene is relevant to male tissue specificity promoter to introducing a gene for a kind of cytotoxic substance of coding in plant.Another kind method relates to antisense system, and wherein out identified and its antisense sequences of fertility key gene is inserted into plant.Mariani etc. have also shown many cytotoxin antisense systems.Also have other system to use " containment " gene, these gene inhibition for the expression of another gene of male sterile key.

Another kind of improved system is that natural plant has by making, for the gene silencing of male fertility key, and use the gene for male fertility key being connected with inducible promoter (controlling following genetic expression) to replace n DNA, thereby realize the controllable male sterile method of giving.Therefore, this plant is that composition is upper sterile, only when the male fertility genetic expression that promotor is induced and it is appended, just can become and can educate.

In most cases, male sterile plants proterties shows by the maintenance recessive state of isozygotying.Can be more difficult in the time must keeping homozygotic state with genetically modified recovery gene.For example, for male sterile key gene, natural sudden change can be given male sterile phenotype (when the allelotrope of this mutant is homozygotic state) to plant.If to the not mutated form of introducing this gene in plant, can be to this sterile recovery, still, the recovery of this form can be removed the recessive state of isozygotying of wanting, and recovers male fertility completely, and has hindered the maintenance to pure male sterile female parent.For avoiding the generation of this situation, can eliminate containing the pollen that recovers gene, provide thus and only produced not containing the maintenance line plant that recovers the pollen of gene, offspring has retained homozygotic state.As disclosed in Dellaporta etc., produced the plant with the construct that narrows, this construct comprises the gene producing the fatal product of cell, and this gene is connected with pollen specific promoter, and this construct comprises recovery gene.When hybridizing with the recessive male sterile plants that isozygotys, offspring has retained the recessive state of isozygotying thus.When this maintenance line plant selfing, produce 50% isozygoty recessive male sterile plants and 50% maintenance line plant.For ease of separated this maintenance line plant, this construct also can comprise marker gene, and as color gene, but need expensive machine or manually carry out later stage sorting, and for, weak effect low with the seed separation efficiency of clever shell such as paddy rice etc.

Summary of the invention

The object of this invention is to provide a kind of construct and application thereof of mediated plant fertility, utilize the construct of mediated plant fertility of the present invention to keep the recessive state of isozygotying of male sterile plants, and breed maintenance line plant.

For achieving the above object, the invention provides a kind of construct, comprise:

(a) the first nucleotide sequence will recover the male fertility of plant when it is expressed;

(b) the second nucleotide sequence can suppress can educate in described plant formation or the function of male gamete when it is expressed;

(c) trinucleotide sequence can form and suppress or neutralizing effect weedicide when it is expressed.

Preferably, described the first nucleotide sequence can be Ms26 nucleotide sequence, Ms45 nucleotide sequence, DPW nucleotide sequence, Ms3 nucleotide sequence or Ms22 nucleotide sequence.

Further, described the first nucleotide sequence is effectively connected in tetranucleotide sequence, and described tetranucleotide sequence preference is in the expression of instructing androecy cell.

Alternatively, described tetranucleotide sequence only just has function when there is inductive substance or inductive condition.

Preferably, described tetranucleotide sequence can be 5126 male tissue regulating and controlling sequence, the male tissue regulating and controlling sequence of Ms26, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms45, DPW, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms3 or Ms22.

Preferably, described the second nucleotide sequence can be nucleotide sequence, the nucleotide sequence of α-amylase gene or the nucleotide sequence of cytotoxin gene of DAM methylase gene.

Further, described the second nucleotide sequence is effectively connected in pentanucleotide sequence, and described pentanucleotide sequence preference is in the expression of instructing male gamete.

Preferably, described pentanucleotide sequence can be for the regulating and controlling sequence of polygalacturonase 47 genes, the regulating and controlling sequence of the regulating and controlling sequence of Zm13 gene, pectin methyl esterase gene, the regulating and controlling sequence of the regulating and controlling sequence of caldesmon gene, actin depolymerizing factor gene or the regulating and controlling sequence of actin binding protein gene.

Preferably, described trinucleotide sequence can be the nucleotide sequence of herbicide resistance gene.

More preferably, described trinucleotide sequence can be for the nucleotide sequence of EPSPS gene, the nucleotide sequence of the nucleotide sequence of pat gene or BAR gene.

Further, described trinucleotide sequence is effectively connected in regulating and controlling sequence, and described regulating and controlling sequence can be composing type regulating and controlling sequence or organizing specific type regulating and controlling sequence.

For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described construct.

For achieving the above object, the present invention also provides a kind of vegetable cell that comprises described construct.

For achieving the above object, it is a kind of for keeping the method for the recessive state of isozygotying of male sterile plants that the present invention also provides, and comprises:

(a) provide the first plant, the Recessive alleles that isozygotys that described the first plant comprises male sterility gene, and described the first plant is male sterile;

(b) in the second plant, introduce construct claimed in claim 1, the Recessive alleles that isozygotys of the male sterility gene that the Recessive alleles that isozygotys that described the second plant comprises the male sterility gene comprising with described the first plant is identical; Described construct is the state of narrowing; In described construct, when being listed in while expressing in described the second plant, described the first nucleotides sequence will recover its male fertility; When described the second nucleotide sequence is expressed, can suppress can educate in described the second plant formation or the function of male gamete, thereby make to produce the educated male gamete that does not comprise described construct in described the second plant; When described trinucleotide sequence is expressed, can weedicide be formed and be suppressed or neutralizing effect;

(c) with the male gamete of described the second plant, make described the first plant fertilization, to produce, keep the isozygoty offspring of recessive state of described the first plant.

Preferably, described the first nucleotide sequence can be Ms26 nucleotide sequence, Ms45 nucleotide sequence, DPW nucleotide sequence, Ms3 nucleotide sequence or Ms22 nucleotide sequence.

Further, described the first nucleotide sequence is effectively connected in tetranucleotide sequence, and described tetranucleotide sequence preference is in the expression of instructing androecy cell.

Alternatively, described tetranucleotide sequence only just has function when there is inductive substance or inductive condition.

Preferably, described tetranucleotide sequence can be 5126 male tissue regulating and controlling sequence, the male tissue regulating and controlling sequence of Ms26, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms45, DPW, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms3 or Ms22.

Preferably, described the second nucleotide sequence can be nucleotide sequence, the nucleotide sequence of α-amylase gene or the nucleotide sequence of cytotoxin gene of DAM methylase gene.

Further, described the second nucleotide sequence is effectively connected in pentanucleotide sequence, and described pentanucleotide sequence preference is in the expression of instructing male gamete.

Preferably, described pentanucleotide sequence can be for the regulating and controlling sequence of polygalacturonase 47 genes, the regulating and controlling sequence of the regulating and controlling sequence of Zm13 gene, pectin methyl esterase gene, the regulating and controlling sequence of the regulating and controlling sequence of caldesmon gene, actin depolymerizing factor gene or the regulating and controlling sequence of actin binding protein gene.

Preferably, described trinucleotide sequence can be the nucleotide sequence of herbicide resistance gene.

More preferably, described trinucleotide sequence can be for the nucleotide sequence of EPSPS gene, the nucleotide sequence of the nucleotide sequence of pat gene or BAR gene.

Further, described trinucleotide sequence is effectively connected in regulating and controlling sequence, and described regulating and controlling sequence can be composing type regulating and controlling sequence or organizing specific type regulating and controlling sequence.

For achieving the above object, it is a kind of for producing seed bearing method from having the plant of female gamete and male gamete that the present invention also provides, and comprises:

(a) to the 3rd plant of the Recessive alleles that isozygotys that comprises male sterility gene, introduce construct claimed in claim 1, described the 3rd plant is male sterile; In described construct, when being listed in while expressing in described the 3rd plant, described the first nucleotides sequence will recover its male fertility; When described the second nucleotide sequence is expressed, can suppress can educate formation or the function of male gamete in described the 3rd plant, thereby make to produce the educated male gamete that does not comprise described construct in described the 3rd plant; When described trinucleotide sequence is expressed, can weedicide be formed and be suppressed or neutralizing effect;

(b) make described the 3rd plant selfing;

(c) produce the seed that contains described construct.

Further, described for producing seed bearing method and also comprise and identify the plant that contains described construct from thering is the plant of female gamete and male gamete.

Further, the plant that described evaluation contains described construct is specially:

Plant the seed producing after described the 3rd plant selfing;

Make described seed grow up to plant to be identified;

With plant to be identified described in herbicide spray, identify the plant contain described construct, described in contain described construct plant compare and there is the plant injury weakening with other plant that do not contain described construct.

Preferably, described the first nucleotide sequence can be Ms26 nucleotide sequence, Ms45 nucleotide sequence, DPW nucleotide sequence, Ms3 nucleotide sequence or Ms22 nucleotide sequence.

Further, described the first nucleotide sequence is effectively connected in tetranucleotide sequence, and described tetranucleotide sequence preference is in the expression of instructing androecy cell.

Alternatively, described tetranucleotide sequence only just has function when there is inductive substance or inductive condition.

Preferably, described tetranucleotide sequence can be 5126 male tissue regulating and controlling sequence, the male tissue regulating and controlling sequence of Ms26, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms45, DPW, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms3 or Ms22.

Preferably, described the second nucleotide sequence can be nucleotide sequence, the nucleotide sequence of α-amylase gene or the nucleotide sequence of cytotoxin gene of DAM methylase gene.

Further, described the second nucleotide sequence is effectively connected in pentanucleotide sequence, and described pentanucleotide sequence preference is in the expression of instructing male gamete.

Preferably, described pentanucleotide sequence can be for the regulating and controlling sequence of polygalacturonase 47 genes, the regulating and controlling sequence of the regulating and controlling sequence of Zm13 gene, pectin methyl esterase gene, the regulating and controlling sequence of the regulating and controlling sequence of caldesmon gene, actin depolymerizing factor gene or the regulating and controlling sequence of actin binding protein gene.

Preferably, described trinucleotide sequence can be the nucleotide sequence of herbicide resistance gene.

More preferably, described trinucleotide sequence can be for the nucleotide sequence of EPSPS gene, the nucleotide sequence of the nucleotide sequence of pat gene or BAR gene.

Further, described trinucleotide sequence is effectively connected in regulating and controlling sequence, and described regulating and controlling sequence can be composing type regulating and controlling sequence or organizing specific type regulating and controlling sequence.

Heredity male sterile is one of gene crucial for the particular step that sporule occurs by sudden change, contains or be subject to the result of other impact, and this term application is in the whole process of pollen formation.These genes can be collectively referred to as male fertility gene or male sterility gene.In gene function affects the whole approach of fertility, have a lot of steps, in corn, hereditary male sterile frequency has been supported this argument just.From Inbred Lines to unaltered population material, do not find the neomorph of male-sterile mutation body.

Gene crucial for male fertility is a lot, comprises and ends spore development (AbortedMicrospores, i.e. AMS) gene, NEF1 gene, AtGPAT1 gene, dde2-2 suddenly change (it demonstrates the defect of allene oxide synthase gene), flp1(faceless pollen-1) gene, the dead 1(Male Meiocyte of male parent cell Death 1) gene, tapetum specificity zinc finger gene TAZ1, tapetum factor of determination 1(Tapetum Determinant 1) gene, MS1 gene, DPW(MS2) gene, MS3 gene, MS5 gene, MS7 gene, MS8 gene, MS9 gene, MS 10 genes, MS11 gene, MS12 gene, MS 13 genes, MS14 gene, MS 17 genes, MS20 gene, MS22 gene, MS23 gene, MS24 gene, MS25 gene, MS26 gene, MS27 gene, MS28 gene, MS29 gene, MS30 gene, MS31 gene, MS32 gene, MS33 gene, MS34 gene, MS36 gene, MS37 gene, MS38 gene, MS43 gene, MS45 gene, MS48 gene, MS50 gene.

In addition, the nucleotide sequence that affects male fertility of expressing in plant male tissue in the present invention is codified carbohydrate degradation or modifying enzyme, amylase, debranching factor and polygalacturonase also, for example α-amylase gene, plant hormone, rol B, cytotoxin, diphtheria toxin, DAM methylase, avidin or can be selected from protokaryon regulator control system.For example, the RNase(of the RNase-T1 of aspergillus oryzae (Aspergillus oryzae) or bacillus amyloliquefaciens (Bacillus amyloliquefaciens) is named as " barnase ") induced expression in tapetum breaking of tapetal cell, cause male sterile.Agrobacterium (Arobacterium rhizogenes) thus rolB genes encoding by discharge the enzyme that free indoles disturbs growth hormone metabolism from indolol-β-glucoside.There are some researches show, in tobacco, the pollen sac of rolB gene is specific expressed has produced the withered plant of pollen sac, and wherein, the generation of pollen greatly reduces, so rolB gene is the example that can be used for controlling the gene that pollen produces.

Regulating and controlling sequence described in the present invention includes but not limited to that promotor, transit peptides, terminator, enhanser, leader sequence, intron and other are operably connected to the adjusting sequence of goal gene.

Promotor of the present invention can be come separated from 5th ' district of the natural coding region in its 5 ' untranslated region (5 ' UTR).Similarly, terminator can come separated in the 3rd ' district from flank in its each terminator codon.

Those skilled in the art can identify promoter region at an easy rate.Identify the initiator codon of inferring that contains ATG primitive, the upstream of this initiator codon is exactly the promotor of inferring." promotor " is section of DNA regulation and control regions, and it comprises conventionally can know that RNA polymerase II is at the synthetic TATA box of the initial RNA of suitable transcription initiation site for specific coding sequence.Promotor can additionally comprise other recognition sequence, these sequences are usually located at upstream or the 5 ' end of TATA box, they are called as upstream promoter element, affect transcription initiation speed, such as acting on the tissue expression of encoding sequence and those elements of time expression, enhanser etc.In an identical manner, can identify, isolate make the promoter element that can for example, express in destination organization (male tissue), it be used together with other core promoter, with the expression of verifying that male tissue is preferential.Core promoter refers to the initial required minimal sequence of transcribing, for example, be called as the sequence of TATA box, and this is that the promotor of the gene of coded protein all has conventionally.Therefore, alternatively, the upstream promoter of Ms26 can with himself or associated from the core promoter in other source.Promotor is natural or non-natural with respect to the cell of therefrom finding it.

Core promoter can make any known core promoter, for example cauliflower mosaic virus 35S or 19S promotor, ubiquitin promoter, IN2 promotor or figwort mosaic virus promotor.

The regulation and control region of Ms26 has been accredited as the region that comprises the TATA box upstream 1005bp inferring.In addition, definite: the essential regions of promotor comprises the region of TATA box upstream 180bp, especially ,-176 to-44 regions are necessary especially.

Can also be modified promoter sequence, so that the scope of expression of heterologous nucleotide sequences level to be provided.Can utilize than whole piece promotor region still less, and drive the preferential ability of expressing of pollen sac still can retain.But the expression level of mRNA may reduce along with the disappearance of a promoter sequence part.Therefore, promotor can be modified to weak or strong promoter.Conventionally, " weak promoter " refers to and drives encoding sequence with the promotor of low expression level." low-level " refers to the level of about 1/10000 transcript to about 1/100000 transcript to about 1/500000 transcript.On the contrary, strong promoter drives encoding sequence to express with high level (or about 1/10 transcript is to about 1/100 transcript to about 1/1000 transcript).Conventionally, at least about 30 Nucleotide of promoter sequence will be used to drive the expression of nucleotide sequence.For increasing transcriptional level, enhanser and promoter region can be used in combination.Enhanser is the nucleotide sequence that performance increases promoter region expressional function, such as SV40 enhanser region, 35S enhancer element etc.

In the present invention, the promotor in described construct can make natural promoter or substituted promotor.Promotor in described construct can be inducible promoter, makes to control by being exposed to inductor the expression of justice in construct or antisense molecule.Any plant compatibility promoter element all can be used for described construct, can be plant gene promoter, ribulose-1,5-bisphosphate for example, the promotor of 5-bisphosphate carboxylase small subunit; Or the promotor of the tl plasmid of agrobacterium tumefaciens, for example rouge alkali synthetase and octopine synthase promoter; Or viral promotors, for example cauliflower mosaic virus (CaMV) 19S and 35S promoter or radix scrophulariae mosaic virus 35 S promoter; Barley fat transfer protein promoter L TP2; Ubiquitin promoter; END2 promotor and polygalacturonase PG47 promotor.

The scope of obtainable plant compatibility promotor comprises tissue-specific promoter and inducible promoter.Induction type controlling element is can respond to inductor directly or indirectly to activate the element of transcribing of one or more DNA sequence dna or gene.While not there is not inductor, DNA sequence dna or gene can not be transcribed.Typically, exist with inactive form with the rho factor of induction type controlling element specific combination with activated transcription, it is directly or indirectly converted into activity form by inductor again.Inductor can be chemical reagent, for example protein, meta-bolites, growth regulatory factor, weedicide or phenolic compound or directly by hot, cold, salt or toxic element applies or the physiology that for example, indirectly applies by pathogenic agent Actin muscle or disease agent (virus) is coerced.The vegetable cell that contains induction type controlling element can be exposed to inductor, by spraying, water, heating or similar approach be applied to inductor on cell or plant.

Any inducible promoter all can be used for the present invention.Exemplary inducible promoter comprises ecdysone receptor promoter; The promotor that responds to copper from ACE1 system; From In2-1 and the In2-2 gene of corn, it responds to benzenesulfonamide herbicide safener; Corn GST promotor, it is activated by the hydrophobic electrophilic compound that is used as front urgent weedicide; With tobacco PR-1a promotor, it is activated by Whitfield's ointment.Other is subject to the promotor of chemical regulation to comprise that sterol replys type promotor and tsiklomitsin induction type and tsiklomitsin containment type promotor.

Organize type of priority promotor can be used for strengthening in the specific plant tissue of target transcribing and/or expressing.Promotor can be expressed also and express in other plant tissue in destination organization, can be in destination organization strong expression and organize the much lower expression of degree than other, or can highly preferably in destination organization, express.In the present invention, promotor is to prefer in the male or female tissue of plant to express.A lot of this type of promotor well known by persons skilled in the art can be used.Natural Ms26 promotor is an example of spendable promotor.Another kind of this type of promotor is 5126 promotors, and it prefers to and instructs the gene of its connection to express in male plant tissue.Other example also comprises Ms45 promotor, SF3 promotor, BS92-7 promotor; SGB6 controlling element; TA29 promotor; II type metalloid metallothionein gene promotor and rape Bca9 promotor.

Male gamete type of priority promotor comprises PG47 promotor mentioned above and ZM13 promotor; Actin depolymerizing factor promotor; The promotor ZmC5 of the similar gene of corn pectin methyl esterase; The promotor of caldesmon Mpcbp.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequence that the function needing concerning the sequence that is connected can be provided.In the present invention, " effectively connect " and can, for promotor is connected with interested sequence, makes transcribing of this interested sequence be subject to this promotor and control and regulate and control.When interested sequence encoding albumen and while going for the expression of this albumen " effectively connecting " represent: promotor is connected with described sequence, and connected mode is efficiently translated the transcript obtaining.If when promotor is the expression of transcript fusion and the albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, in the transcript that makes to obtain, the first translation initiation codon is the initiator codon of encoding sequence.Alternatively, when if promotor is the expression of translation fusion and the albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, the first translation initiation codon and the promotor that in 5 ' non-translated sequence, contain are connected, and mode of connection make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of genetic expression function is provided, promotor for example, 5 ' untranslated region, intron, encoding histone region, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), it (is T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the marker function of can scoring is provided, sequence external or the interior assistance of body series of operations (is polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is the replication orgin of bacterium, autonomously replicating sequence, centromeric sequence).

Object purposes based on gene, construct described in the present invention can also comprise other component, such as selective marker, target or regulating and controlling sequence, critical sequences or homing sequence, intron etc.Described construct has transcribing and translation termination region of function in also 3 ' the end in target heterologous nucleotide sequence being included in to plant.Stopping region can obtain from the Ti-plasmids of agrobacterium tumefaciens, for example the termination region of rouge alkali synthetase and octopine synthetic enzyme.

Described construct can be extra contain 5 ' leader sequence, described leader sequence can be brought into play the effect that strengthens translation, its including but not limited to, picornavirus leader sequence, EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus group leader sequence, for example TEV(marmor erodens) leader sequence; The MDMV(corn mosaic virus that stunts) leader sequence; Human immunoglobulin matter heavy chain conjugated protein (BiP); From the coat protein mRNA of alfalfa mosaic virus, do not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence; And maize chlorotic mottle virus leader sequence (MCMV).Described construct also can contain the sequence that strengthens translation and/or mRNA stability, for example intron.

In hope, guide the expression product of heterologous nucleotide sequence into specific cells device; particularly plastid, amyloplast; or guide endoplasmic reticulum into; or the in the situation that of cell surface or cell exocrine; described construct also can comprise the transit peptides encoding sequence of (claiming again secretory signal sequence or targeting sequencing); concerning receptor protein; described transit peptides can be allos; its including but not limited to, the transit peptides of acyl group transporter, the small subunit of RUBISCO, plant EPSP synthase, corn Brittle-1 chloroplast transit peptides etc.For having a lot of selections to specific cells device expression product, for example, barley α-amylase sequence is normally used for instructing the expression to endoplasmic reticulum.

The invention provides the carrier that can express described construct.Generally speaking, described carrier should have function in vegetable cell.Sometimes, carrier in intestinal bacteria, have function be preferred (for example, produce protein for generation of antibody, DNA sequence analysis, structure insert, while obtaining the amount of nucleic acid).

Construct described in the present invention can contain the gene that weedicide is formed to inhibition or neutralizing effect in addition, be preferably herbicide resistance gene, it includes but not limited to, to the resistant gene of sulfonylurea, to the resistant gene of bromoxynil, to the resistant gene of glyphosate, to the resistant gene of glufosinates, to the resistant gene of careless fourth phosphine, to the resistant gene of imidazolone type with to 2,4-dichlorphenoxyacetic acid ester (2, resistant gene 4-D).

Construct described in the present invention or described recombinant vectors are imported to plant, and conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplastis, electroporation or silicon whisker mediation.

Described in the present invention by nucleotide sequence " introducing " plant time, its expression can occur by the method for direct conversion, described method is such as to the agriculture bacillus mediated conversion of plant tissue, particulate transmitting bombardment, electroporation etc.; Or can, by plant and another plant with heterologous nucleotide sequence are hybridized to carry out, offspring be had and be incorporated to their genomic nucleotide sequences.This type of breeding technique is well known to a person skilled in the art.

The method of backcrossing can be used for gene to introduce plant.In a kind of typical backcrossing scheme, the interested original kinds of people (recurrent parent) with carry monogenic the second kind of target to be transferred (nonrecurrent parent) hybridization.Then the offspring who obtains from this hybridization is hybridized with recurrent parent again, repeat this process, until obtain following plant, wherein, in the plant through transforming, except the single metastatic gene from nonrecurrent parent, the Morphological and physiological characteristics of the recurrent parent that major part is wanted is all restored.

In the present invention, when people wish to use transgenosis recovery ways, can keep the male sterile of the male sterile plants recessive state of isozygotying, reduce the quantity that keeps having required plant, cultivation and step of the plant of this type of proterties simultaneously.Homozygosity is such genetic state, now on homologous chromosomes, on the locus of correspondence, has identical allelotrope.Heterozygosity is such genetic state, and now, what on locus corresponding to homologous chromosomes, exist is different allelotrope.Semizygosis is such genetic state, now only has a copy of gene (or group of gene), there is no allelotrope copy on sister chromosome.In one embodiment, the recessive state of isozygotying is given male sterile to plant.When the function of homozygotic state being supplied to sequence while introducing plant (when introducing and expressing, can recover the sequence of wild-type status when the plant with the recessive state of isozygotying in), fertility is recovered, and this is by the recovery realization of wild-type fertility phenotype.

To the maintenance of the recessive state of isozygotying by obtaining like this: restorative transgenic constructs is introduced to plant, and described construct is connected with disturbing the formation of described plant male gamete or the sequence of function, to produce maintenance line or donor plant.When restorative transgenosis is introduced the plant that male sterile isozygotys recessive, fertility is recovered, and described plant is only produced contain Recessive alleles copy and containing restorative genetically modified fertile pollen.Transgenosis is called as the situation narrowing in maintenance line plant.Term transgenosis represents to introduce by gene engineering any nucleotide sequence of cellular genome.Transgenosis can be natural DNA sequence or allogeneic dna sequence (being foreign DNA).Term natural DNA sequence refers to the nucleotide sequence of natural discovery in cell, but it can live through the modification to its primitive form.Pollen from maintenance line can be used for making the plant of isozygotying concerning this male sterile recessive character to be fertilized, and therefore offspring will retain their recessive state of isozygotying.The maintenance line plant that contains restorative transgenic constructs breeds by selfing, and the seed obtaining is for the production of being more plant of isozygotying recessive plant and containing restorative transgenic constructs.

Maintenance line plant is used as pollen donor, supplies with to having the recessive male sterile plant of isozygotying.Alternatively, maintenance line produces from having the recessive male sterile plant of isozygotying, its also have introducing wherein, male sterile nucleotide sequence that the Recessive alleles that recovers to isozygoty is produced.In addition, restorative sequence is connected with disturbing the formation of male gamete or the gene of function.This gene can work by any form in multiple known forms, prevents the formation of male gamete or prevents the function of male gamete, and this gene includes but not limited to, expresses male gamete is had to Cytotoxic product; The product of inhibition another important gene for male gamete function or formation forms; Be combined with another gene product, produce the material that hinders gene formation or function; Antisense is in gene crucial concerning the function of male gamete or formation or cause the common containment to said gene; By form to disturb expression etc. with hair fastener.Known a lot of nucleotide sequence can suppress pollen formation or function, and any sequence that can carry out this function all meets the demands, for example cytotoxin gene, methylase gene and growth suppressor gene.

Cytotoxin gene described in the present invention includes but not limited to from chrysanthemum Pectinatus (Erwinia chrysanthermi) pectate lyase genes pelE; Genomic from cms-T Corn Mitochondria; From the CytA toxin gene of bacillus thuringiensis, it causes membranolysis; DNAses, RNAses; Proteolytic enzyme, or the gene of antisence RNA.Suitable gene also codified relates to the albumen that suppresses gynoecium growth, the interaction of pollen column cap, pollen tube growth or fertilization or its combination.In addition, can also be the gene that disturbs the normal accumulation of starch in pollen or affect osmotic equilibrium in pollen.

In one embodiment of the invention, use DAM methylase, its expression product catalysis methylates to VITAMIN B4 residue in DNA of plants.Through methylated VITAMIN B4, can have influence on cell survival, it only just can find in the tissue of expressing DAM methylase gene.In another embodiment, can use α-amylase and male tissue type of priority promotor.At the initial duration of germination of cereal seed, gluten cell will synthesize α-amylase, and it participates in the process that hydrolyzed starch forms glucose and maltose, and the plumule required nutritive substance of growing is provided thus.α-amylase gene used can be corn α-amylase-1 gene, as shown in SEQ ID NO:20 in sequence table.Typically, can not find the diastatic sequence of coding for alpha in pollen cell, when being expressed to male tissue by guidance, result is that the collapse of pollen granule energy derive and pollen development are contained.

One skilled in the art would recognize that construct of the present invention and method can be applicable to have any crop of outcross possibility, include but not limited to corn, paddy rice, soybean, Chinese sorghum.

Common ground, for manufacturing more plant with recessive state, can be by recessive plant and another recessive plant hybridization.The recessive character of growing for impact breeding, this may realize.Or, homozygous plants and second plant with restorative gene can be hybridized, but this needs further hybridization to separating restorative gene, again to reach recessive phenotype.Can instead can keep the recessive state of isozygotying in one approach, itself and maintenance line plant be hybridized simultaneously.The method can be used for keeping the male sterile recessive state of isozygotying.This has produced has cost-benefit system, and this system relatively easily operates, with the colony of the recessive plant that keeps isozygotying.

Sporophyte gene is to be independent of the gene that gamete works.When the recessive state of isozygotying is to grow to cause male sterile time by hindering male sporophyte, maintenance line plant just must contain functional restorative transgenic constructs, and this structure physical efficiency is supplied sudden change and the recessive plant that makes to isozygoty can produce fertile pollen.By the restorative gene of this sporophyte, being connected causes having produced following maintenance line plant with the second functional nucleotide sequence (disturbing formation or the function of plant male gamete), the pollen that this plant produces only contains the Recessive alleles of sporophyte gene on its natural gene seat, and this is to cause because the second nucleotide sequence has disturbed the effect of pollen formation or function.For restorative transgenic constructs, this fertile pollen is not genetically modified.

In the present invention, the gene that weedicide is formed to inhibition or neutralizing effect can be provided in described construct together along with restorative gene.Preferably, use herbicide resistance gene, for example, with pat gene, identify the plant that contains described construct.

The invention provides construct and the application method thereof of mediated plant fertility, wherein, use the first nucleotide sequence (gene of key concerning male fertility), the second nucleotide sequence (inhibition can be educated formation or the function of male gamete), trinucleotide sequence (weedicide is formed and suppressed or neutralizing effect), (it is effectively connected with the first nucleotide sequence optional tetranucleotide sequence, prefer to the expression of instructing androecy cell), (it is effectively connected with the second nucleotide sequence optional pentanucleotide sequence, prefer to the expression of instructing male gamete).

A kind of method of the present invention is that the plant with restorative nucleotide sequence can, by selfing, soon be transferred to taking of same plant from the pollen of this plant, to obtain the breeding of restorative plant.Described selfing comprises such situation: the plant that produces pollen is fertilized by the pollen with same plant, also comprise another kind of situation: two strains or the same selfing plant of many strains are planted in together, use from the pollen of same selfing plant different same selfing plant is pollinated.Pollen will not contain restorative transgenic constructs, but 50% in ovule (female gamete) will contain described construct.The seed obtaining after plantation selfing, can identify the plant with restorative transgenic constructs by spraying herbicide, and the plant that contains described construct is compared and has the plant injury weakening with other plant that do not contain described construct.

In the present invention, male gamete-organize type of priority promotor can be induction type.In needs, by making to have the plant of restorative nucleotide sequence, be that composing type is male sterile, in this process, carry out extra control.For this plant is become, can educate, inductive substance must be provided, plant can educate becoming.Equally, when itself and construct of the present invention and application method combination thereof, only produce the pollen containing restorative nucleotide sequence.

The invention provides a kind of construct and application thereof of mediated plant fertility, have the following advantages:

1, profitable, simple to operate.Of the present invention for keeping the method for the recessive state of isozygotying of male sterile plants, to described the second plant (being maintenance line plant), introduce construct of the present invention, described structure physical efficiency recovery male-sterile character and make described the second plant can produce fertile pollen.Described fertile pollen only contains the male sterile Recessive alleles that isozygotys, and this is to cause because described the second nucleotide sequence has disturbed the effect of pollen formation or function, and accuracy is high.With described fertile pollen, make described the first plant fertilization, to produce, keep the isozygoty offspring of recessive state of described the first plant.Described method has been saved the step of emasculation in hybrid seeding process, has saved manpower and materials, has larger cost benefit, and simple to operate.

2, evaluation is convenient, the efficiency of separation is high, effective.The present invention is for producing seed bearing method from having the plant of female gamete and male gamete, to described the 3rd plant, introduce construct of the present invention, the pollen that described the 3rd plant produces will not contain described construct, but 50% in ovule (female gamete) will contain described construct.The seed that described the 3rd plant selfing plantation are produced, because described trinucleotide sequence forms and suppresses or neutralizing effect weedicide, therefore, by spraying herbicide, can identify easily the plant that contains described construct, and the efficiency of separation is high, effective.The present invention is specially adapted to inconvenience and identifies at seed stage the situation that contains described construct, such as the seed that utilizes seed color sorting paddy rice etc. with clever shell (clever shell does not develop the color).

3, non-transgenic.Of the present invention for keeping the method for the recessive state of isozygotying of male sterile plants, to described the second plant (being maintenance line plant), introduce construct of the present invention, described structure physical efficiency recovery male-sterile character and make described the second plant can produce fertile pollen.Described fertile pollen only contains the male sterile Recessive alleles that isozygotys, and this is to cause because described the second nucleotide sequence has disturbed the effect of pollen formation or function.Therefore, for described construct, described fertile pollen is not genetically modified, with described fertile pollen, makes described the first plant fertilization, and the offspring who produces remains not genetically modified.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the construct of mediated plant fertility of the present invention and the recombinant cloning vector DBN01-T of application thereof build schema;

Fig. 2 is that the construct of mediated plant fertility of the present invention and the recombinant expression vector DBN100123 of application thereof build schema;

Fig. 3 is that the construct of mediated plant fertility of the present invention and the recombinant cloning vector DBN05-T of application thereof build schema;

Fig. 4 is that the construct of mediated plant fertility of the present invention and the recombinant expression vector DBN100010 of application thereof build schema;

Fig. 5 is that the construct of mediated plant fertility of the present invention and the recombinant cloning vector DBN09-T of application thereof build schema;

Fig. 6 is that the construct of mediated plant fertility of the present invention and the recombinant expression vector DBN100011 of application thereof build schema.

Embodiment

Below by specific embodiment, further illustrate the construct of mediated plant fertility of the present invention and the technical scheme of application thereof.

The first embodiment, the recombinant expression vector DBN100123 maize transformation plant that comprises male fertility gene M s45, DAM methylase gene and anti-herbicide gene PAT

1, build recombinant cloning vector DBN01-T, DBN02-T, DBN03-T, DBN04-T

Synthetic 5126:Ms45 fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; 5126 is Pollen Maydis capsule specificity promoter (SEQ ID NO:1); Ms45 is the encoding sequence (SEQ ID NO:2) of corn male fertility gene; MCS is multiple clone site).

Then recombinant cloning vector DBN01-T is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl 10g/L, penbritin 100mg/L, adjusts pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by mass concentration, dries; Add 30 μ l containing Rnase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.

The plasmid extracting is cut after evaluation through BsaI enzyme, and positive colony is carried out to sequence verification, and result shows that 5126:Ms45 fragment synthetic in recombinant cloning vector DBN01-T correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic PG47:DAM:Pin II fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN02-T, wherein, PG47 is Pollen Maydis specificity promoter (SEQID NO:3), and DAM is the encoding sequence (SEQ ID NO:4) of e. coli dna methyltransgerase, the terminator that Pin II is potato protease inhibitor Ⅱ (SEQ ID NO:5).BsaI enzyme cut with sequence verification recombinant cloning vector DBN02-T in synthetic PG47:DAM:Pin II fragment correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic Ubi:PAT:Nos fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN03-T, wherein, Ubi is corn Ubiquitin(ubiquitin) promotor (SEQ ID NO:6) of gene, the encoding sequence (SEQID NO:7) of the careless fourth phosphinothricin acetyl transferring enzyme that PAT is streptomycete, the terminator that Nos is rouge alkali synthetase (SEQ ID NO:8).BsaI enzyme cut with sequence verification recombinant cloning vector DBN03-T in synthetic Ubi:PAT:Nos fragment correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic Ubi:PMI:Nos fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN04-T, wherein, Ubi is corn Ubiquitin(ubiquitin) promotor (SEQ ID NO:6) of gene, the encoding sequence that PMI is phosphomannose isomerase (SEQ ID NO:9), the terminator that Nos is rouge alkali synthetase (SEQ ID NO:8).BsaI enzyme cut with sequence verification recombinant cloning vector DBN04-T in synthetic Ubi:PMI:Nos fragment correctly insert.

2, build recombinant expression vector DBN100123

With restriction enzyme BsaI respectively enzyme cut recombinant cloning vector DBN01-T, DBN02-T, DBN03-T, DBN04-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), by the 5126:Ms45 fragment cutting, PG47:DAM:Pin II fragment, Ubi:PAT:Nos fragment and Ubi:PMI:Nos fragment are connected into expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, BsaI restriction enzyme site in expression vector DBNBC-01 is also to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100123, it builds flow process (Kan: kanamycin gene as shown in Figure 2, RB: right margin, 5126: Pollen Maydis capsule specificity promoter (SEQ ID NO:1), Ms45: the encoding sequence of corn male fertility gene (SEQ ID NO:2), PG47: Pollen Maydis specificity promoter (SEQ ID NO:3), DAM: the encoding sequence of e. coli dna methyltransgerase (SEQ ID NO:4), Pin II: the terminator of potato protease inhibitor Ⅱ (SEQ ID NO:5), Ubi: the corn Ubiquitin(ubiquitin) promotor of gene (SEQ ID NO:6), PAT: the encoding sequence of the careless fourth phosphinothricin acetyl transferring enzyme of streptomycete (SEQ ID NO:7), Nos: the terminator of rouge alkali synthetase (SEQ ID NO:8), PMI: the encoding sequence of phosphomannose isomerase (SEQ ID NO:9), LB: left margin).

Recombinant expression vector DBN100123 is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100123), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme BsaI enzyme, and by the positive colony evaluation of checking order, result shows that recombinant expression vector DBN100123 is the construct of mediated plant fertility between BsaI site, and the construct of described mediated plant fertility comprises 5126:Ms45 fragment, PG47:DAM:Pin II fragment, Ubi:PAT:Nos fragment and Ubi:PMI:Nos fragment.

3, recombinant expression vector DBN100123 transforms Agrobacterium

Oneself is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA through building correct recombinant expression vector DBN100123 by liquid nitrogen method; Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector DBN100123); Be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes; It is under 200rpm condition, to cultivate 2 hours in 28 ℃ of temperature, rotating speed that Agrobacterium LBA4404 after transforming is inoculated in LB test tube, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, after cutting with restriction enzyme BglII and AhdI enzyme, carry out enzyme and cut checking, result shows that recombinant expression vector DBN100123 structure is entirely true.

4, obtain transgenic corn plant

The male sterile female plant that ms45 mutant (ms45) is isozygotied with from corn, combine 31(Z31) the pollinia recross of plant, cause number after generation, this ms45 allelotrope gradually infiltrates and is easy to the comprehensive 31(Z31 that transforms) corn germplasm.The converting material source obtaining consists of the embryo for ms45 separated (1:1 or 3:1), and it allows to be directly transformed into the ms45 background of isozygotying, and allows T ₀in plant, the hereditary supplemental of ms45 sudden change is tested.

The Agrobacterium infestation method adopting according to routine, corn sterile culture above-mentioned to the Recessive alleles ms45 that isozygotys is combined 31(Z31) Agrobacterium in the rataria of kind and the present embodiment described in 3 cultivates altogether, so that the T-DNA(in the 2 recombinant expression vector DBN100123 that build in the present embodiment is comprised to 5126:Ms45 fragment, PG47:DAM:Pin II fragment, Ubi:PAT:Nos fragment, Ubi:PMI:Nos fragment) be transferred in maize chromosome group, obtained transgenic corn plant.

For agriculture bacillus mediated corn, transform, briefly, from corn, separated immature rataria, contacts rataria with agrobacterium suspension, and wherein Agrobacterium can be passed to the construct of described mediated plant fertility at least one cell (step 1: infect step) of one of rataria.In this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to culturing step) altogether.Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent having microbiotic but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the rataria of inoculation is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the substratum of selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.

The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.

5, with TaqMan, verify transgenic corn plant

Get the about 100mg of blade of transgenic corn plant-Ms45 as sample, with the DNeasyPlant Maxi Kit of Qiagen, extract its genomic dna, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Ms45-PG47 gene and PMI gene.In contrast with wild-type milpa, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects Ms45-PG47 gene and PMI gene copy number is as follows:

Step 151, get each 100mg of blade of transgenic corn plant-Ms45 and wild-type milpa, be ground into homogenate respectively in mortar with liquid nitrogen, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 152, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 153, with NanoDrop 2000(Thermo Scientifc) measure the genomic dna concentration of above-mentioned sample;

Step 154, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 155, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard substance, using the sample of wild-type milpa as negative contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Ms45-PG47 gene order:

Primer 1(MF 1): GACATAGTAGTGACCGACCCGAG is as shown in SEQ IDNO:10 in sequence table;

Primer 2 (MR1): CGTCCGATAGCTTGATCATGG is as shown in SEQ IDNO:11 in sequence table;

Probe 1(MP 1): CGAGCCAAACCGAGCGGACG is as shown in SEQ IDNO:12 in sequence table;

Following primer and probe are used for detecting PMI gene order:

Primer 3(PF): GTATGGAAAATCCGTCCAGCC is as shown in SEQ ID NO:13 in sequence table;

Primer 4(PR): TGAACTGCTTTTCGGATGTGC is as shown in SEQ ID NO:14 in sequence table;

Probe 2(PP): CGATGGCCGAGCTGTGGATGG is as shown in SEQ ID NO:15 in sequence table;

PCR reaction system is:

Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l 1 * TE damping fluids, and at 4 ℃, be housed in amber test tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data.

Experimental result shows, the construct of described mediated plant fertility (comprising 5126:gMs45 fragment, PG47:DAM:Pin II fragment, Ubi:PAT:Nos fragment, Ubi:PMI:Nos fragment) is own in being incorporated into the genome of detected milpa, and has obtained the transgenic corn plant-Ms45 of the described mediated plant fertility construct with single copy.

6, analyze transgenic corn plant

Transgenic corn plant-Ms45(T for plant configuration to the described mediated plant fertility construct with single copy in the present embodiment 5 ₀) assessed, for genetically modified propagation in pollen and blastular, analyze.Except the degree of male fertility, between described transgenic corn plant-Ms45 and non-transgenic corn adjoining tree (the male sterile milpa that ms45 isozygotys recessive), do not observe other form different.Transgenic corn plant-the Ms45(T with the described mediated plant fertility construct of single copy ₀) be that part is male fertile, but not transgenic corns adjoining tree-ms45 is that holandry is sterile, this show Ms45 gene expression complementation the recessive ms45 male sterile phenotype of isozygotying.Also explanation: the expression of DAM gene carries genetically modified pollen granule by removal and caused part male sterile; While there is no DAM gene, Ms45 transgenosis can be recovered ms45 male sterile completely.By at described transgenic corn plant-Ms45(T ₀) and non-transgenic milpa-ms45 between controlled pollination, further determined DAM gene and kept the correct function of the recessive state of isozygotying of male sterile plants.Use from described transgenic corn plant-Ms45(T ₀) pollen granule non-transgenic corn adjoining tree-ms45 is pollinated.From the young fringe of described non-transgenic corn adjoining tree-ms45, gather in the crops immature embryo; respectively at MS substratum (MS salt 4.3g/L, MS vitamin b6 usp, sucrose 30g/L, agar 8g/L, pH5.8) and contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] cultivate 18 days in the MS substratum of-DL-high lactamine.100% embryo can germinate on MS substratum; and 100% embryo all can not contain 3.0mg/L4-[hydroxyl (methyl) phosphono] germinate on the MS substratum of-DL-high lactamine; this shows that described mediated plant fertility construct-Ms45 does not pass to offspring by pollen, as shown in table 1.From described non-transgenic corn adjoining tree-ms45, gather in the crops T ₁seed-ms45, plants described T ₁seed-ms45 is until grow up to T ₁plant-ms45,100% described T ₁plant-ms45 can not produce pollen and selfing can not be solid, is holandry sterile plant, described transgenic corn plant-Ms45(T that this comprises mediated plant fertility construct-Ms45 described in showing ₀) can be for keeping the recessive state of isozygotying of male sterile plants, as shown in table 2.

In addition, use pollen from wild-type corn adjoining tree to described transgenic corn plant-Ms45(T ₀) pollination.From described transgenic corn plant-Ms45(T ₀) young fringe on gather in the crops immature embryo; respectively at MS substratum (MS salt 4.3g/L, MS vitamin b6 usp, sucrose 30g/L, agar 8g/L, pH5.8) and contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] cultivate 18 days in the MS substratum of-DL-high lactamine.100% embryo can germinate on MS substratum; but only have 50% embryo containing 3.0mg/L4-[hydroxyl (methyl) phosphono] germinate on the MS substratum of-DL-high lactamine; this show described mediated plant fertility construct-Ms45 by ovum to estimate that Frequency Transfer is to offspring, as shown in table 3.

In table 1, embryo by the transmission of transgene of pollen

In table 2, seed by the transmission of transgene of pollen

In table 3, embryo by the transmission of transgene of ovum

7, the breeding of maintenance line plant and evaluation

Make described transgenic corn plant-Ms45(T ₀) selfing.From the ms45 recessive described transgenic corn plant-Ms45(T that isozygotys ₀) upper results selfing T ₁seed-Ms45, plants described selfing T ₁seed-Ms45 is until grow up to selfing T ₁plant-Ms45(V3 leaf phase), with 3.0mg/L 4-[hydroxyl (methyl) phosphono]-DL-high lactamine sprays described selfing T ₁plant-Ms45, determines according to the leaf degree of impairment of observing for the 10th day after V3 leaf phase herbicide treatment whether plant damages.As shown in table 4,50% described selfing T ₁plant-Ms45 there is no and demonstrates leaf damage, this show described mediated plant fertility construct-Ms45 by ovum to estimate that Frequency Transfer, to offspring, is accredited as the transgenic corn plant-Ms45(maintenance line plant that comprises described mediated plant fertility construct-Ms45).From the described transgenic corn plant that comprises described mediated plant fertility construct-Ms45-Ms45, gather in the crops seed, for breeding maintenance line plant.

Table 4, herbicide treatment transfer-gen plant selfing T ₁the result of plant

The second embodiment, the recombinant expression vector DBN100010 maize transformation plant that comprises male fertility gene M s26, α-amylase gene and anti-herbicide gene PAT

1, build recombinant cloning vector DBN05-T, DBN06-T, DBN07-T, DBN08-T

Synthetic 5126:Ms26 fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN05-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 3; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; 5126 is Pollen Maydis capsule specificity promoter (SEQ ID NO:1); Ms26 is the encoding sequence (SEQ ID NO:16) of corn male fertility gene; MCS is multiple clone site).

Then recombinant cloning vector DBN05-T is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN05-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl 10g/L, penbritin 100mg/L, adjusts pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by mass concentration, dries; Add 30 μ l containing Rnase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.

The plasmid extracting is cut after evaluation through BsaI enzyme, and positive colony is carried out to sequence verification, and result shows that 5126:Ms26 fragment synthetic in recombinant cloning vector DBN05-T correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN05-T, synthetic PG47:Amylase:In2 fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, obtain recombinant cloning vector DBN06-T, wherein, PG47 is Pollen Maydis specificity promoter (SEQ ID NO:3), bt1 is corn Brittle-1 chloroplast transit peptides (SEQ IDNO:17), Amylase is the encoding sequence (SEQ ID NO:18) of corn α-amylase, and In2 is the terminator (SEQ ID NO:19) of corn In2-1 gene.BsaI enzyme cut with sequence verification recombinant cloning vector DBN06-T in synthetic PG47:Amylase:In2 fragment correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN05-T, synthetic Ubi:PAT:Nos fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN07-T, wherein, Ubi is corn Ubiquitin(ubiquitin) promotor (SEQ ID NO:6) of gene, the encoding sequence (SEQID NO:7) of the careless fourth phosphinothricin acetyl transferring enzyme that PAT is streptomycete, the terminator that Nos is rouge alkali synthetase (SEQ ID NO:8).BsaI enzyme cut with sequence verification recombinant cloning vector DBN07-T in synthetic Ubi:PAT:Nos fragment correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN05-T, synthetic Ubi:PMI:Nos fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN08-T, wherein, Ubi is corn Ubiquitin(ubiquitin) promotor (SEQ ID NO:6) of gene, the encoding sequence that PMI is phosphomannose isomerase (SEQ ID NO:9), the terminator that Nos is rouge alkali synthetase (SEQ ID NO:8).BsaI enzyme cut with sequence verification recombinant cloning vector DBN08-T in synthetic Ubi:PMI:Nos fragment correctly insert.

2, build recombinant expression vector DBN100010

With restriction enzyme BsaI respectively enzyme cut recombinant cloning vector DBN05-T, DBN06-T, DBN07-T, DBN08-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), by the 5126:Ms26 fragment cutting, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment and Ubi:PMI:Nos fragment are connected into expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, BsaI restriction enzyme site in expression vector DBNBC-01 is to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100010, it builds flow process (Kan: kanamycin gene as shown in Figure 4, RB: right margin, 5126: Pollen Maydis capsule specificity promoter (SEQ ID NO:1), Ms26: the encoding sequence of corn male fertility gene (SEQ ID NO:16), PG47: Pollen Maydis specificity promoter (SEQ IDNO:3), bt1: corn Brittle-1 chloroplast transit peptides (SEQ ID NO:17), Amylase: the encoding sequence of corn α-amylase (SEQ ID NO:18), In2: the terminator of corn In2-1 gene (SEQID NO:19), Ubi: the corn Ubiquitin(ubiquitin) promotor of gene (SEQ ID NO:6), PAT: the encoding sequence of the careless fourth phosphinothricin acetyl transferring enzyme of streptomycete (SEQ ID NO:7), Nos: the terminator of rouge alkali synthetase (SEQ ID NO:8), PMI: the encoding sequence of phosphomannose isomerase (SEQID NO:9), LB: left margin).

Recombinant expression vector DBN100010 is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100010), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme BsaI enzyme, and by the positive colony evaluation of checking order, result shows that recombinant expression vector DBN100010 is the construct of mediated plant fertility between BsaI site, and the construct of described mediated plant fertility comprises 5126:Ms26 fragment, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment and Ubi:PMI:Nos fragment.

3, recombinant expression vector DBN100010 transforms Agrobacterium

Oneself is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA through building correct recombinant expression vector DBN100010 by liquid nitrogen method; Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector DBN100010); Be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes; It is under 200rpm condition, to cultivate 2 hours in 28 ℃ of temperature, rotating speed that Agrobacterium LBA4404 after transforming is inoculated in LB test tube, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, after cutting with restriction enzyme BglI and AhdI enzyme, carry out enzyme and cut checking, result shows that recombinant expression vector DBN100010 structure is entirely true.

4, obtain transgenic corn plant

The male sterile female plant that ms26 mutant (ms26) is isozygotied with from corn, combine 31(Z31) the pollinia recross of plant, cause number after generation, this ms26 allelotrope gradually infiltrates and is easy to the comprehensive 31(Z31 that transforms) corn germplasm.The converting material source obtaining consists of the embryo for ms26 separated (1:1 or 3:1), and it allows to be directly transformed into the ms26 background of isozygotying, and allows T ₀in plant, the hereditary supplemental of ms26 sudden change is tested.

The Agrobacterium infestation method adopting according to routine, corn sterile culture above-mentioned to the Recessive alleles ms26 that isozygotys is combined 31(Z31) Agrobacterium in the rataria of kind and the present embodiment described in 3 cultivates altogether, so that the T-DNA(in the 2 recombinant expression vector DBN100010 that build in the present embodiment is comprised to 5126:Ms26 fragment, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment, Ubi:PMI:Nos fragment) be transferred in maize chromosome group, obtained transgenic corn plant.

For agriculture bacillus mediated corn, transform, briefly, from corn, separated immature rataria, contacts rataria with agrobacterium suspension, and wherein Agrobacterium can be passed to the construct of described mediated plant fertility at least one cell (step 1: infect step) of one of rataria.In this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to culturing step) altogether.Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent having microbiotic but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the rataria of inoculation is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the substratum of selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.

The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.

5, with TaqMan, verify transgenic corn plant

Get the about 100mg of blade of transgenic corn plant-Ms26 as sample, with the DNeasyPlant Maxi Kit of Qiagen, extract its genomic dna, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Ms26-PG47 gene and PMI gene.In contrast with wild-type milpa, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects Ms26-PG47 gene and PMI gene copy number is as follows:

Step 251, get each 100mg of blade of transgenic corn plant-Ms26 and wild-type milpa, be ground into homogenate respectively in mortar with liquid nitrogen, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 252, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 253, with NanoDrop 2000(Thermo Scientifc) measure the genomic dna concentration of above-mentioned sample;

Step 254, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 255, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard substance, using the sample of wild-type milpa as negative contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Ms26-PG47 gene order:

Primer 5(MF2): TCACTCGGGATGACGATGG is as shown in SEQ ID NO:20 in sequence table;

Primer 6(MR2): TGCCACCAGACAGTGTCCG is as shown in SEQ ID NO:21 in sequence table;

Probe 3(MP2): CGCCACTGCAGGTCGACTCTAGAGGATC is as shown in SEQ ID NO:22 in sequence table;

Following primer and probe are used for detecting PMI gene order:

Primer 3(PF): GTATGGAAAATCCGTCCAGCC is as shown in SEQ ID NO:13 in sequence table;

Primer 4(PR): TGAACTGCTTTTCGGATGTGC is as shown in SEQ ID NO:14 in sequence table;

Probe 2(PP): CGATGGCCGAGCTGTGGATGG is as shown in SEQ ID NO:15 in sequence table;

PCR reaction system is:

Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l 1 * TE damping fluids, and at 4 ℃, be housed in amber test tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data.

Experimental result shows, the construct of described mediated plant fertility (comprising 5126:gMs26 fragment, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment, Ubi:PMI:Nos fragment) is own in being incorporated into the genome of detected milpa, and has obtained the transgenic corn plant-Ms26 of the described mediated plant fertility construct with single copy.

6, analyze transgenic corn plant

Transgenic corn plant-Ms26(T for plant configuration to the described mediated plant fertility construct with single copy in the present embodiment 5 ₀) assessed, for genetically modified propagation in pollen and blastular, analyze.Except the degree of male fertility, the male sterile milpa of isozygotying recessive at described transgenic corn plant-Ms26 and non-transgenic corn adjoining tree-ms26(ms26) between, do not observe other form different.Transgenic corn plant-the Ms26(T with the described mediated plant fertility construct of single copy ₀) be that part is male fertile, but not transgenic corns adjoining tree-ms26 is that holandry is sterile, this show Ms26 gene expression complementation the recessive ms26 male sterile phenotype of isozygotying.Also explanation: the expression of α-amylase gene carries genetically modified pollen granule by removal and caused part male sterile; While there is no α-amylase gene, Ms26 transgenosis can be recovered ms26 male sterile completely.By at described transgenic corn plant-Ms26(T ₀) and non-transgenic milpa-ms26 between controlled pollination, further determined α-amylase gene and kept the correct function of the recessive state of isozygotying of male sterile plants.Use from described transgenic corn plant-Ms26(T ₀) pollen granule non-transgenic corn adjoining tree-ms26 is pollinated.From the young fringe of described non-transgenic corn adjoining tree-ms26, gather in the crops immature embryo; respectively at MS substratum (MS salt 4.3g/L, MS vitamin b6 usp, sucrose 30g/L, agar 8g/L, pH5.8) and contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] cultivate 18 days in the MS substratum of-DL-high lactamine.100% embryo can germinate on MS substratum; and 100% embryo all can not contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] germinate on the MS substratum of-DL-high lactamine; this shows that described mediated plant fertility construct-Ms26 does not pass to offspring by pollen, as shown in table 5.From described non-transgenic corn adjoining tree-ms26, gather in the crops T ₁seed-ms26, plants described T ₁seed-ms26 is until grow up to T ₁plant-ms26,100% described T ₁plant-Ms26 can not produce pollen and selfing can not be solid, is holandry sterile plant, described transgenic corn plant-Ms26(T that this comprises mediated plant fertility construct-Ms26 described in showing ₀) can be for keeping the recessive state of isozygotying of male sterile plants, as shown in table 6.

In addition, use pollen from wild-type corn adjoining tree to described transgenic corn plant-Ms26(T ₀) pollination.From described transgenic corn plant-Ms26(T ₀) young fringe on gather in the crops immature embryo; respectively at MS substratum (MS salt 4.3g/L, MS vitamin b6 usp, sucrose 30g/L, agar 8g/L, pH5.8) and contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] cultivate 18 days in the MS substratum of-DL-high lactamine.100% embryo can germinate on MS substratum; but only have 50% embryo containing 3.0mg/L4-[hydroxyl (methyl) phosphono] germinate on the MS substratum of-DL-high lactamine; this show described mediated plant fertility construct-Ms26 by ovum to estimate that Frequency Transfer is to offspring, as shown in table 7.

In table 5, embryo by the transmission of transgene of pollen

In table 6, seed by the transmission of transgene of pollen

In table 7, embryo by the transmission of transgene of ovum

7, the breeding of maintenance line plant and evaluation

Make described transgenic corn plant-Ms26(T ₀) selfing.The male sterile milpa of isozygotying recessive from described ms26 is gathered in the crops selfing T ₁seed-Ms26, plants described selfing T ₁seed-Ms26 is until grow up to selfing T ₁plant-Ms26(V3 leaf phase), with 3.0mg/L 4-[hydroxyl (methyl) phosphono]-DL-high lactamine sprays described selfing T ₁plant-Ms26, determines according to the leaf degree of impairment of observing for the 10th day after V3 leaf phase herbicide treatment whether plant damages.As shown in table 8,50% described selfing T ₁plant-Ms26 there is no and demonstrates leaf damage, this show described mediated plant fertility construct-Ms26 by ovum to estimate that Frequency Transfer, to offspring, is accredited as the transgenic corn plant-Ms26(maintenance line plant that comprises described mediated plant fertility construct-Ms26).From the described transgenic corn plant that comprises described mediated plant fertility construct-Ms26-Ms26, gather in the crops seed, for breeding maintenance line plant.

Table 8, herbicide treatment transfer-gen plant selfing T ₁the result of plant

The 3rd embodiment, the recombinant expression vector DBN100011 rice transformation plant that comprises male fertility gene DPW, α-amylase gene and anti-herbicide gene PAT

1, build recombinant cloning vector DBN09-T, DBN10-T, DBN11-T, DBN12-T

Synthetic gDPW fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN09-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 5; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; GDPW is rice male fertility genome sequence (SEQ ID NO:23); MCS is multiple clone site).

Then recombinant cloning vector DBN09-T is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN09-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl 10g/L, penbritin 100mg/L, adjusts pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by mass concentration, dries; Add 30 μ l containing Rnase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.

The plasmid extracting is cut after evaluation through BsaI enzyme, and positive colony is carried out to sequence verification, and result shows that gDPW fragment synthetic in recombinant cloning vector DBN09-T correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN09-T, synthetic PG47:Amylase:In2 fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, obtain recombinant cloning vector DBN10-T, wherein, PG47 is Pollen Maydis specificity promoter (SEQ ID NO:3), bt1 is corn Brittle-1 chloroplast transit peptides (SEQ IDNO:17), Amylase is the encoding sequence (SEQ ID NO:18) of corn α-amylase, and In2 is the terminator (SEQ ID NO:19) of corn In2-1 gene.BsaI enzyme cut with sequence verification recombinant cloning vector DBN10-T in synthetic PG47:Amylase:In2 fragment correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN09-T, synthetic Ubi:PAT:Nos fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN11-T, wherein, Ubi is corn Ubiquitin(ubiquitin) promotor (SEQ ID NO:6) of gene, the encoding sequence (SEQID NO:7) of the careless fourth phosphinothricin acetyl transferring enzyme that PAT is streptomycete, the terminator that Nos is rouge alkali synthetase (SEQ ID NO:8).BsaI enzyme cut with sequence verification recombinant cloning vector DBN11-T in synthetic Ubi:PAT:Nos fragment correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN09-T, synthetic Ubi:PMI:Nos fragment is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) upper, obtain recombinant cloning vector DBN12-T, wherein, Ubi is corn Ubiquitin(ubiquitin) promotor (SEQ ID NO:6) of gene, the encoding sequence that PMI is phosphomannose isomerase (SEQ ID NO:9), the terminator that Nos is rouge alkali synthetase (SEQ ID NO:8).BsaI enzyme cut with sequence verification recombinant cloning vector DBN12-T in synthetic Ubi:PMI:Nos fragment correctly insert.

2, build recombinant expression vector DBN100011

With restriction enzyme BsaI respectively enzyme cut recombinant cloning vector DBN09-T, DBN10-T, DBN11-T, DBN12-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), by the gDPW fragment cutting, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment and Ubi:PMI:Nos fragment are connected into expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, BsaI restriction enzyme site in expression vector DBNBC-01 is to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100011, it builds flow process (Kan: kanamycin gene as shown in Figure 6, RB: right margin, gDPW: rice male fertility genome sequence (SEQ ID NO:23), PG47: Pollen Maydis specificity promoter (SEQ ID NO:3), bt1: corn Brittle-1 chloroplast transit peptides (SEQ ID NO:17), Amylase: the encoding sequence of corn α-amylase (SEQ ID NO:18), In2: the terminator of corn In2-1 gene (SEQ ID NO:19), Ubi: the corn Ubiquitin(ubiquitin) promotor of gene (SEQID NO:6), PAT: the encoding sequence of the careless fourth phosphinothricin acetyl transferring enzyme of streptomycete (SEQ ID NO:7), Nos: the terminator of rouge alkali synthetase (SEQ ID NO:8), PMI: the encoding sequence of phosphomannose isomerase (SEQ ID NO:9), LB: left margin).

Recombinant expression vector DBN100011 is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat.No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100011), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme BsaI enzyme, and by the positive colony evaluation of checking order, result shows that recombinant expression vector DBN100011 is the construct of mediated plant fertility between BsaI site, and the construct of described mediated plant fertility comprises gDPW fragment, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment and Ubi:PMI:Nos fragment.

3, recombinant expression vector DBN100011 transforms Agrobacterium

Oneself is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA through building correct recombinant expression vector DBN100011 by liquid nitrogen method; Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector DBN100011); Be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes; It is under 200rpm condition, to cultivate 2 hours in 28 ℃ of temperature, rotating speed that Agrobacterium LBA4404 after transforming is inoculated in LB test tube, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, after cutting with restriction enzyme BamHI and BglII enzyme, carry out enzyme and cut checking, result shows that recombinant expression vector DBN100011 structure is entirely true.

4, obtain transgenic rice plant

The Agrobacterium infestation method adopting according to routine, having of the sterile culture Agrobacterium described in 3 in the callus of japonica rice 9522 kind mutant (Shanghai Communications University collaborative project obtain) of Recessive alleles dpw and the present embodiment of isozygotying is cultivated altogether, so that the T-DNA(in the 2 recombinant expression vector DBN100011 that build in the present embodiment is comprised to gdpw fragment, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment, Ubi:PMI:Nos fragment) be transferred in rice chromosome group, obtained transgenic rice plant.

For agriculture bacillus mediated rice conversion, briefly, rice paddy seed is seeded in to inducing culture (N6 salt 3.1g/L, N6 vitamin b6 usp, casein food grade 300mg/L, maltose 30g/L, 2, 4-dichlorphenoxyacetic acid (2, 4-D) 2mg/L, plant gel 3g/L, pH5.8) on, from Mature Embryos of Rice, induce callus (step 1: callus of induce step), afterwards, preferred callus, with agrobacterium suspension, contact callus, wherein Agrobacterium can be passed to the construct of described mediated plant fertility at least one cell (step 2: infect step) on callus.In this step, callus preferably immerses agrobacterium suspension (OD660=0.3, infect substratum (N6 salt 3.1g/L, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in, to start, inoculate.Callus and Agrobacterium are cultivated one period (3 days) (step 3: be total to culturing step) altogether.Preferably, callus after infecting step at solid medium (N6 salt 3.1g/L, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation.After this common cultivation stage, there is " recovery " step.In " recovery " step, recovery media (N6 salt 3.1g/L, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, the selective agent (step 4: recovering step) of not adding vegetable transformant.Preferably, callus is cultivated on the solid medium of selective agent having microbiotic but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the callus of inoculation is containing the transformed calli (step 5: select step) of cultivating and selecting growing on the substratum of selective agent (seminose).Preferably, callus is having the screening solid medium of selective agent (N6 salt 3.1g/L, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 6: regeneration step), preferably, above cultivate with aftergrowth at solid medium (N6 division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.

The resistant calli that screening obtains is transferred to described N6 division culture medium (N6 salt 3.1g/L, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, seminose 5g/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L, pH5.8) upper, cultivate differentiation at 25 ℃.It is upper that seedling out of differentiation is transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8), is cultured to about 10cm at 25 ℃ high, moves to hot-house culture to solid.In greenhouse, cultivate every day at 28 ℃.

5, with TaqMan, verify transgenic rice plant

Get the about 100mg of blade of transgenic rice plant-DPW as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic dna, by Taqman fluorescence probe quantitative PCR method, detect the copy number of DPW-PG47 gene and PMI gene.In contrast with wild-type rice plant, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects DPW-PG47 gene and PMI gene copy number is as follows:

Step 351, get each 100mg of blade of transgenic rice plant-DPW and wild-type rice plant, be ground into homogenate respectively in mortar with liquid nitrogen, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 352, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 353, with NanoDrop 2000(Thermo Scientifc) measure the genomic dna concentration of above-mentioned sample;

Step 354, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 355, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard substance, using the sample of wild-type rice plant as negative contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting DPW-PG47 gene order:

Primer 7(DF): TCCTCCGTGTCACGTCAGG is as shown in SEQ ID NO:24 in sequence table;

Primer 8(DR): ATCCTCTAGAGTCGACCTGCAGG is as shown in SEQ IDNO:25 in sequence table;

Probe 4(DP): TCACCTCTCCTAGGAGCTGGTTCGAACTG is as shown in SEQ ID NO:26 in sequence table;

Following primer and probe are used for detecting PMI gene order:

Primer 3(PF): GTATGGAAAATCCGTCCAGCC is as shown in SEQ ID NO:13 in sequence table;

Primer 4(PR): TGAACTGCTTTTCGGATGTGC is as shown in SEQ ID NO:14 in sequence table;

Probe 2(PP): CGATGGCCGAGCTGTGGATGG is as shown in SEQ ID NO:15 in sequence table;

PCR reaction system is:

Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l 1 * TE damping fluids, and at 4 ℃, be housed in amber test tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data.

Experimental result shows, the construct of described mediated plant fertility (comprising gDPW fragment, PG47:Amylase:In2 fragment, Ubi:PAT:Nos fragment, Ubi:PMI:Nos fragment) is own in being incorporated into the genome of detected rice plant, and has obtained the transgenic rice plant-DPW of the described mediated plant fertility construct with single copy.

6, analyze transgenic rice plant

Transgenic rice plant-DPW(T for plant configuration to the described mediated plant fertility construct with single copy in the present embodiment 5 ₀) assessed, for genetically modified propagation in pollen and blastular, analyze.Except the degree of male fertility, the male sterile rice plant of isozygotying recessive at described transgenic rice plant-DPW and non-transgenic paddy rice adjoining tree-DPW(dpw) between, do not observe other form different.Transgenic rice plant-the DPW(T with the described mediated plant fertility construct of single copy ₀) be that part is male fertile, but not transgenic paddy rice adjoining tree-DPW is that holandry is sterile, this show DPW gene expression complementation the recessive dpw male sterile phenotype of isozygotying.Also explanation: the expression of α-amylase gene carries genetically modified pollen granule by removal and caused part male sterile; While there is no α-amylase gene, DPW transgenosis can be recovered dpw male sterile completely.By at described transgenic rice plant-DPW(T ₀) and non-transgenic rice plant-DPW between controlled pollination, further determined α-amylase gene and kept the correct function of the recessive state of isozygotying of male sterile plants.Use from described transgenic rice plant-DPW(T ₀) pollen granule non-transgenic paddy rice adjoining tree-DPW is pollinated.From described non-transgenic paddy rice adjoining tree-DPW, gather in the crops T ₁seed-DPW, uses described T ₁seed-DPW is callus induction respectively; and by described callus respectively at N6 substratum (N6 salt 3.1g/L, N6 vitamin b6 usp, maltose 30g/L, plant gel 3g/L, pH5.8) and contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] cultivate 18 days in the N6 substratum of-DL-high lactamine.100% callus can be germinateed on N6 substratum; and 100% callus all can not contain 3.0mg/L 4-[hydroxyl (methyl) phosphono] germinate on the N6 substratum of-DL-high lactamine; this shows that described mediated plant fertility construct-DPW does not pass to offspring by pollen, as shown in table 9.Plant described T ₁seed-DPW is until grow up to T ₁plant-DPW, 100% described T ₁plant-DPW can not produce pollen and selfing can not be solid, is holandry sterile plant, described transgenic rice plant-DPW(T that this comprises mediated plant fertility construct-DPW described in showing ₀) can be for keeping the recessive state of isozygotying of male sterile plants, as shown in table 10.

In addition, use pollen from wild-type paddy rice adjoining tree-DPW to described transgenic rice plant-DPW(T ₀) pollination.From described transgenic rice plant-DPW(T ₀) upper results T ₁seed-DPW ', uses described T ₁seed-DPW ' is callus induction respectively; and by described callus respectively at N6 substratum (N6 salt 3.1g/L, N6 vitamin b6 usp, maltose 30g/L, plant gel 3g/L, pH5.8) and contain 3.0mg/L4-[hydroxyl (methyl) phosphono] cultivate 18 days in the N6 substratum of-DL-high lactamine.100% callus can be germinateed on MS substratum; but only have 50% callus containing 3.0mg/L 4-[hydroxyl (methyl) phosphono] germinate on the MS substratum of-DL-high lactamine; this show described mediated plant fertility construct-DPW by ovum to estimate that Frequency Transfer is to offspring, as shown in table 11.

In table 9, embryo by the transmission of transgene of pollen

In table 10, seed by the transmission of transgene of pollen

In table 11, embryo by the transmission of transgene of ovum

7, the breeding of maintenance line plant and evaluation

Make described transgenic rice plant-DPW(T ₀) selfing.The male sterile rice plant of isozygotying recessive from described dpw is gathered in the crops selfing T ₁seed-DPW, plants described selfing T ₁seed-DPW is until grow up to selfing T ₁plant-DPW(V4 leaf phase), with 3.0mg/L 4-[hydroxyl (methyl) phosphono]-DL-high lactamine sprays described selfing T ₁plant-DPW, determines according to the leaf degree of impairment of observing for the 10th day after V4 leaf phase herbicide treatment whether plant damages.As shown in table 12,50% described selfing T ₁plant-DPW there is no and demonstrates leaf damage, this show described mediated plant fertility construct-DPW by ovum to estimate that Frequency Transfer, to offspring, is accredited as the transgenic rice plant-DPW(maintenance line plant that comprises described mediated plant fertility construct-DPW).From the described transgenic rice plant that comprises described mediated plant fertility construct-DPW-DPW, gather in the crops seed, for breeding maintenance line plant.

Table 12, herbicide treatment transfer-gen plant selfing T ₁the result of plant

In sum, the construct of mediated plant fertility of the present invention and application thereof are for keeping the method for the recessive state of isozygotying of male sterile plants, profitable, simple to operate, and the male sterile offspring that produced is thus not genetically modified; For producing seed bearing method from having the plant of female gamete and male gamete, evaluation is convenient, the efficiency of separation is high, effective simultaneously, is specially adapted to inconvenience and identifies at seed stage the situation that contains described construct.

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.

Claims (37)

1. a construct, is characterized in that, comprises:

(a) the first nucleotide sequence will recover the male fertility of plant when it is expressed;

(b) the second nucleotide sequence can suppress can educate in described plant formation or the function of male gamete when it is expressed;

(c) trinucleotide sequence can form and suppress or neutralizing effect weedicide when it is expressed.

2. construct according to claim 1, is characterized in that, described the first nucleotide sequence can be Ms26 nucleotide sequence, Ms45 nucleotide sequence, DPW nucleotide sequence, Ms3 nucleotide sequence or Ms22 nucleotide sequence.

3. construct according to claim 1 and 2, is characterized in that, described the first nucleotide sequence is effectively connected in tetranucleotide sequence, and described tetranucleotide sequence preference is in the expression of instructing androecy cell.

4. construct according to claim 3, is characterized in that, described tetranucleotide sequence only just has function when there is inductive substance or inductive condition.

5. construct according to claim 3, it is characterized in that, described tetranucleotide sequence can be 5126 male tissue regulating and controlling sequence, the male tissue regulating and controlling sequence of Ms26, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms45, DPW, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms3 or Ms22.

6. construct according to claim 1, is characterized in that, described the second nucleotide sequence can be nucleotide sequence, the nucleotide sequence of α-amylase gene or the nucleotide sequence of cytotoxin gene of DAM methylase gene.

7. according to the construct described in claim 1 or 6, it is characterized in that, described the second nucleotide sequence is effectively connected in pentanucleotide sequence, and described pentanucleotide sequence preference is in the expression of instructing male gamete.

8. construct according to claim 7, it is characterized in that, described pentanucleotide sequence can be for the regulating and controlling sequence of polygalacturonase 47 genes, the regulating and controlling sequence of the regulating and controlling sequence of Zm13 gene, pectin methyl esterase gene, the regulating and controlling sequence of the regulating and controlling sequence of caldesmon gene, actin depolymerizing factor gene or the regulating and controlling sequence of actin binding protein gene.

9. construct according to claim 1, is characterized in that, described trinucleotide sequence can be the nucleotide sequence of herbicide resistance gene.

10. construct according to claim 9, is characterized in that, described trinucleotide sequence can be for the nucleotide sequence of EPSPS gene, the nucleotide sequence of the nucleotide sequence of pat gene or BAR gene.

11. according to the construct described in claim 1,9 or 10, it is characterized in that, described trinucleotide sequence is effectively connected in regulating and controlling sequence, and described regulating and controlling sequence can be composing type regulating and controlling sequence or organizing specific type regulating and controlling sequence.

12. 1 kinds of recombinant vectorss that comprise construct described in claim 1.

13. 1 kinds of vegetable cells that comprise construct described in claim 1.

14. 1 kinds for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, comprises:

(a) provide the first plant, the Recessive alleles that isozygotys that described the first plant comprises male sterility gene, and described the first plant is male sterile;

(b) in the second plant, introduce construct claimed in claim 1, the Recessive alleles that isozygotys of the male sterility gene that the Recessive alleles that isozygotys that described the second plant comprises the male sterility gene comprising with described the first plant is identical; Described construct is the state of narrowing; In described construct, when being listed in while expressing in described the second plant, described the first nucleotides sequence will recover its male fertility; When described the second nucleotide sequence is expressed, can suppress can educate in described the second plant formation or the function of male gamete, thereby make to produce the educated male gamete that does not comprise described construct in described the second plant; When described trinucleotide sequence is expressed, can weedicide be formed and be suppressed or neutralizing effect;

(c) with the male gamete of described the second plant, make described the first plant fertilization, to produce, keep the isozygoty offspring of recessive state of described the first plant.

15. is according to claim 14 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described the first nucleotide sequence can be Ms26 nucleotide sequence, Ms45 nucleotide sequence, DPW nucleotide sequence, Ms3 nucleotide sequence or Ms22 nucleotide sequence.

16. according to described in claims 14 or 15 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described the first nucleotide sequence is effectively connected in tetranucleotide sequence, and described tetranucleotide sequence preference is in the expression of instructing androecy cell.

17. according to claim 16ly is characterized in that for keeping the method for the recessive state of isozygotying of male sterile plants, and described tetranucleotide sequence only just has function when there is inductive substance or inductive condition.

18. is according to claim 16 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described tetranucleotide sequence can be 5126 male tissue regulating and controlling sequence, the male tissue regulating and controlling sequence of Ms26, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms45, DPW, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms3 or Ms22.

19. is according to claim 14 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described the second nucleotide sequence can be nucleotide sequence, the nucleotide sequence of α-amylase gene or the nucleotide sequence of cytotoxin gene of DAM methylase gene.

20. according to described in claim 14 or 19 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described the second nucleotide sequence is effectively connected in pentanucleotide sequence, and described pentanucleotide sequence preference is in the expression of instructing male gamete.

21. is according to claim 20 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described pentanucleotide sequence can be for the regulating and controlling sequence of polygalacturonase 47 genes, the regulating and controlling sequence of the regulating and controlling sequence of Zm13 gene, pectin methyl esterase gene, the regulating and controlling sequence of the regulating and controlling sequence of caldesmon gene, actin depolymerizing factor gene or the regulating and controlling sequence of actin binding protein gene.

22. according to claim 14ly is characterized in that for keeping the method for the recessive state of isozygotying of male sterile plants, and described trinucleotide sequence can be the nucleotide sequence of herbicide resistance gene.

23. is according to claim 22 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described trinucleotide sequence can be for the nucleotide sequence of EPSPS gene, the nucleotide sequence of the nucleotide sequence of pat gene or BAR gene.

24. according to described in claim 14,22 or 23 for keeping the method for the recessive state of isozygotying of male sterile plants, it is characterized in that, described trinucleotide sequence is effectively connected in regulating and controlling sequence, and described regulating and controlling sequence can be composing type regulating and controlling sequence or organizing specific type regulating and controlling sequence.

25. 1 kinds for producing seed bearing method from having the plant of female gamete and male gamete, it is characterized in that, comprises:

(a) to the 3rd plant of the Recessive alleles that isozygotys that comprises male sterility gene, introduce construct claimed in claim 1, described the 3rd plant is male sterile; In described construct, when being listed in while expressing in described the 3rd plant, described the first nucleotides sequence will recover its male fertility; When described the second nucleotide sequence is expressed, can suppress can educate formation or the function of male gamete in described the 3rd plant, thereby make to produce the educated male gamete that does not comprise described construct in described the 3rd plant; When described trinucleotide sequence is expressed, can weedicide be formed and be suppressed or neutralizing effect;

(b) make described the 3rd plant selfing;

(c) produce the seed that contains described construct.

26. according to claim 25ly is characterized in that for producing seed bearing method from having the plant of female gamete and male gamete, also comprise and identify the plant that contains described construct.

27. according to claim 26ly is characterized in that for producing seed bearing method from having the plant of female gamete and male gamete, and the plant that described evaluation contains described construct is specially:

Plant the seed producing after described the 3rd plant selfing;

Make described seed grow up to plant to be identified;

With plant to be identified described in herbicide spray, identify the plant contain described construct, described in contain described construct plant compare and there is the plant injury weakening with other plant that do not contain described construct.

28. according to described in claim 25,26 or 27 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described the first nucleotide sequence can be Ms26 nucleotide sequence, Ms45 nucleotide sequence, DPW nucleotide sequence, Ms3 nucleotide sequence or Ms22 nucleotide sequence.

29. according to described in claim 25,26,27 or 28 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described the first nucleotide sequence is effectively connected in tetranucleotide sequence, and described tetranucleotide sequence preference is in the expression of instructing androecy cell.

30. according to claim 29ly is characterized in that for keeping the method for the recessive state of isozygotying of male sterile plants, and described tetranucleotide sequence only just has function when there is inductive substance or inductive condition.

31. according to described in claim 29 or 30 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described tetranucleotide sequence can be 5126 male tissue regulating and controlling sequence, the male tissue regulating and controlling sequence of Ms26, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms45, DPW, the male tissue regulating and controlling sequence of the male tissue regulating and controlling sequence of Ms3 or Ms22.

32. according to described in claim 25,26 or 27 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described the second nucleotide sequence can be nucleotide sequence, the nucleotide sequence of α-amylase gene or the nucleotide sequence of cytotoxin gene of DAM methylase gene.

33. according to described in claim 25,26,27 or 32 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described the second nucleotide sequence is effectively connected in pentanucleotide sequence, and described pentanucleotide sequence preference is in the expression of instructing male gamete.

34. is according to claim 33 for producing seed bearing method from having the plant of female gamete and male gamete, it is characterized in that, described pentanucleotide sequence can be for the regulating and controlling sequence of polygalacturonase 47 genes, the regulating and controlling sequence of the regulating and controlling sequence of Zm13 gene, pectin methyl esterase gene, the regulating and controlling sequence of the regulating and controlling sequence of caldesmon gene, actin depolymerizing factor gene or the regulating and controlling sequence of actin binding protein gene.

35. according to described in claim 25,26 or 27 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described trinucleotide sequence can be the nucleotide sequence of herbicide resistance gene.

36. is according to claim 35 for producing seed bearing method from having the plant of female gamete and male gamete, it is characterized in that, described trinucleotide sequence can be for the nucleotide sequence of EPSPS gene, the nucleotide sequence of the nucleotide sequence of pat gene or BAR gene.

37. according to described in claim 25,26,27,35 or 36 for producing seed bearing method from thering is the plant of female gamete and male gamete, it is characterized in that, described trinucleotide sequence is effectively connected in regulating and controlling sequence, and described regulating and controlling sequence can be composing type regulating and controlling sequence or organizing specific type regulating and controlling sequence.

Images