CN109504702B - Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs7M construct and breeding application method thereof - Google Patents
Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs7M construct and breeding application method thereof Download PDFInfo
- Publication number
- CN109504702B CN109504702B CN201811450364.4A CN201811450364A CN109504702B CN 109504702 B CN109504702 B CN 109504702B CN 201811450364 A CN201811450364 A CN 201811450364A CN 109504702 B CN109504702 B CN 109504702B
- Authority
- CN
- China
- Prior art keywords
- seeds
- construct
- transgenic
- plant
- maize
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
- C12N15/8231—Male-specific, e.g. anther, tapetum, pollen
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Pregnancy & Childbirth (AREA)
- Reproductive Health (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a utilization systemp5126‑ZmMs7AndmCherrya technical system for creating a maize dominant genic male sterile line by using a gene construct and a method for carrying out maize cross breeding and seed production application by using the created maize dominant genic male sterile line. The construct is introduced into a maize callus cell, and transgenic maize dominant nuclear male sterile line seeds can be created: under normal light (white light or sunlight), the transgenic sterile line seeds and non-transgenic fertile seeds have no obvious difference, and the quality of the commodity is not influenced; under the green excitation light, the transgenic sterile line seeds show red fluorescence, and the non-transgenic fertile seeds show normal corn color and no fluorescence. The invention has essential difference with the invention patent of the corn recessive male sterility technology (namely a corn multi-control sterility technology system) which is applied and authorized by the team before, can be efficiently applied to corn sterile cross breeding and hybrid seed production, and has great agricultural production application value.
Description
Technical Field
The present invention relates generally to the fields of molecular biology and plant genetic engineering and crop breeding. In particular, the invention relates to a promoter for creating a maize dominant nuclear male sterile line and comprising a maize pollen specific promoterp5126Male flower development key geneZmMs7Fluorescent gene specifically expressed in seed coatmCherryThe construct, the recombinant vector containing the construct, and a host cell transformed by the construct or the recombinant vector, a transgenic corn plant cell and a preparation method of the transgenic corn plant, and a corn male sterile line seed produced by the construct and a cross breeding and seed production application method thereof.
Background
Heterosis is a phenomenon in which a hybrid is superior to its two parents in one or more traits. For example, the first generation of hybrid obtained by crossing different strains, varieties and even varieties shows stronger growth rate and metabolic function than the parents, thereby resulting in developed organs, increased body size and yield, or showing improved disease resistance, insect resistance, stress resistance, viability, reproductive capacity, viability and the like. This is a ubiquitous phenomenon in the biological world. The yield and quality of crops can be remarkably improved by utilizing the heterosis of plants.
Among the crops, there are self-pollinated crops and cross-pollinated crops. Self-pollination refers to the phenomenon that a plant pollen pollinates pistils of the same individual. In contrast, pollination of the pistil of one plant with pollen from the other plant is called cross-pollination. The stamens and pistils of rice are propagated in the same organ, usually in a self-pollinating manner. The key is to carry out cross breeding and heterosis utilization on rice and obtain a male sterile line. The discovery of the male sterile line opens a breakthrough for the success of breeding hybrid rice by applying the three lines (male sterile line, maintainer line and restorer line) in a matching way, thereby making great contribution to grain production in China and even in the world.
For cross-pollinated crops such as corn, because of the lack of good male sterility lines, the methods of artificial emasculation or mechanical emasculation are mainly adopted for crossbreeding and seed production. The methods have various defects, such as high cost, unstable purity, easy environmental influence and the like, and limit the application efficiency of the heterosis in the actual production of the corn.
The corn dominant nuclear male sterile material does not have the problem of emasculation, but is difficult to be applied to actual production due to the lack of an effective maintaining and propagating technology. The development of modern biotechnology creates conditions for the utilization of the maize dominant nuclear male sterile material. The invention aims to connect a dominant genic male sterile gene expression box, a fluorescent protein marker gene expression box and a herbicide resistance gene expression box in series to construct an efficient corn dominant genic male sterile genetic transformation vector, introduce the efficient corn dominant genic male sterile genetic transformation vector into a corn normal fertile inbred line material to obtain a corn dominant genic male sterile line and a maintainer line thereof, and can efficiently separate a red fluorescent transgenic dominant genic male sterile line and normal color fertile line seeds by a fluorescent color selection method, so that the problems of maintaining and propagating the corn dominant genic male sterile line are effectively solved, and efficient corn sterile cross breeding and hybrid seed production are realized.
ZmMs7Is a transcription factor related to the development of tapetum cells and microspore cell walls in the development process of maize pollen, and mutation of the transcription factor can cause abortion of male flowers. The team utilized in previous research workZmMs7The mutant gene and the sterile mutant material thereof develop a corn recessive male sterility technology, namely a corn multi-control sterility technology system, and apply and authorize related invention patents. The present invention found the wild type under the 5126 promoterZmMs7Can cause the maize to show a dominant sterile phenotypic character, has essential difference from the prior invention, and is applied to the maizeHas new application value in cross breeding and seed production.
Disclosure of Invention
The invention aims to provide a method based onp5126-ZmMs7AndmCherrya gene creating dominant genic male sterile corn carrier (construct) and its cross breeding and seed production application.
The dominant genic male sterile vector is a genetic transformation vector for creating dominant genic male sterile maize, which contains a plurality of functional elements (elements of 3 different types of expression cassettes) and the assembly and expression of the functional elements ensure that a transformed plant can be controllably used for the propagation and maintenance of a dominant genic male sterile line of the maize (through male sterility, seed coat color and herbicide resistance).
The expression cassette elements of 3 different types of the dominant genic male sterility vector comprise an expression cassette for controlling a male fertility gene of corn, a herbicide resistance gene expression cassette and a color marker gene expression cassette. (1) Specifically, the expression cassette of the male fertility gene of the corn sequentially comprises a male organ specific expression promoter, a fertility related gene and a terminator from upstream to downstream. Furthermore, the male fertility gene is maizeZmMs7A gene, wherein the promoter is a male organ-specific expression promoterp5126The promoter is a corn anther specific expression promoter; combining the twop5126-ZmMs7Transgenic maize can cause dominant genic sterility. (2) The color marker gene expression cassette is composed ofLtp2Promoter, red fluorescent proteinmCherryThe gene and the pin II terminator are connected in series in sequence to form the expression cassette. Wherein the content of the first and second substances,Ltp2the promoter is a promoter of a barley lipid transfer protein gene and is specifically expressed in the aleurone layer of seeds (Kalla et al, Plant J (1994) 6: 849-. (3) The expression cassette of the herbicide resistance gene is driven by 35S promoterBarThe expression cassette of the gene, the terminator is 35S terminator. Wherein the 35S promoter is derived from the enhancer region of the cauliflower mosaic virus genome (Franck et al, Cell (1980)21: 285-294).
The above-mentioned construct containing the polygene expression cassette was constructed sequentially with pCambia3301 (information: website: http:// www.snapgene.com/resources/plasmid _ files/plant _ vectors/pCAMBIA3301 /) from the pCambia series of vectors as a backbone.
The invention also provides a method for creating the maize dominant genic male sterile plant and maintaining and propagating the maize dominant genic male sterile line by using the construct, wherein the method also comprises a method for identifying the maize sterile line and the seeds and plants of the maintainer line.
The breeding method for obtaining the male sterile line and the maintainer line provided by the invention is obtained by introducing a construct which causes dominant nuclear male sterility into a transformable maize inbred line which is a target plant.
The above method for introducing a target plant is to obtain a plant by introducing Agrobacterium into a plant cell, callus, tissue or organ.
The method for creating the dominant nuclear male sterile plant of the corn comprises the following steps: (1) providing a first plant, which is a maize inbred line material that can be used for genetic transformation, including but not limited to B104, heddle 31, HiII. (2) Creating a second plant, said second plant having the construct of claim 1 introduced into said first plant and said construct being present on only one of the homologous chromosomes of maize, i.e., said construct is hemizygous, said plant exhibiting dominant nuclear male sterility independent of its background genotype; where hemizygous (hemizygte) refers to a zygote having two identical sets of chromosomes but one or more genes are monovalent and present in only one set of chromosomes and the other set of chromosomes has no corresponding alleles, the zygote is called a hemizygous. (3) Fertilization of the second plant with the male gamete of the first plant is performed to maintain and produce 50% of the progeny of the second plant genotype (i.e., the construct is in a hemizygous state).
The method for propagating maize sterile and maintainer plants of the present invention comprises: producing 50% of sterile seeds containing the construct by cross-fertilization of the second plant of claim 4 with the first plant; 50% of normal fertile seed (maintainer) was produced.
The invention provides a method for identifying seeds or plants of a sterile line and a maintainer line, which comprises the following steps: observing the seeds generated after the second plant is subjected to outcrossing under green exciting light, wherein the seeds with red fluorescence are sterile lines, and the non-fluorescent seeds are fertile maintainer lines. And planting seeds generated after the second plant is subjected to outcrossing, growing the seeds into a plant to be identified, spraying a herbicide on the plant to be identified, wherein the maintainer line plant has damage symptoms or withers, and the sterile line has no damage symptoms or has lower damage symptom degree.
The invention also provides a technical method for carrying out high-efficiency hybrid breeding and hybrid seed production by using the dominant genic male sterile line of the corn.
The method for carrying out cross breeding by using the maize dominant genic male sterile line containing the construct comprises the following steps: (a) planting the maize transgenic dominant genic male sterile line seed containing the construct of claim 5, and other maize conventional inbred line seeds of different genetic backgrounds; (b) in the flowering and pollen-dispersing period of corn, the dominant genic male sterile line plant is used as a female parent, other conventional corn inbred lines are used as male parents to carry out artificial hybridization, and the obtained F1Hybrid seeds; (c) the F1The color of the hybrid seeds is not obviously different when the hybrid seeds are observed under normal light (namely the color of normal corn grains does not influence the appearance quality of corn products); but can be separated into 50% of red fluorescent seeds which are transgenic male sterile hybrid seeds and 50% of non-fluorescent seeds which are non-transgenic fertile hybrid seeds by observing through a fluorescent filter under a green excitation light source; (d) the F1On one hand, the hybrid can be used as a transgenic variety for direct mixing test and a hybrid combination ratio, and the fertile hybrid and the sterile hybrid can be pollinated freely without influencing the yield and the appearance quality of the commodity; alternatively, a 50% non-fluorescent, non-transgenic fertile hybrid can be selected for testing and quality control by a fluorescence color sorter.
A method for hybrid seed production by using the maize dominant genic male sterile line containing the construct. The method specifically comprises the following steps: (a) the dominant genic male sterile line is used as female parent, and through backcross transformation, directional improvement and creation of different heritageBackground-transmitted maize transgenic dominant genic male sterile female lines containing the constructs; (b) in a seed production field, the dominant genic male sterile female parent line seeds and the conventional male parent inbred line seeds are planted according to the row ratio of 5:1, free pollination is carried out, the male parent line is pulled out in the later period or harvested in advance, and F on the dominant genic male sterile female parent line is obtained1Hybrid seeds; (c) the F1The color of the seeds of the hybrid seeds is not obviously different when the hybrid seeds are observed under normal light (the appearance quality of the corn commodity is not influenced); but can be separated into 50% of red fluorescent seeds which are transgenic sterile hybrid seeds and 50% of non-fluorescent seeds which are non-transgenic fertile hybrid seeds by observing through a fluorescent filter under a green excitation light source; (d) the F1On one hand, the hybrid seeds can be directly mixed and planted as transgenic varieties, and the fertile hybrid seeds and the sterile hybrid seeds are freely pollinated without influencing the corn yield and the commodity appearance quality; on the other hand, the fluorescence color selector can be used for selecting non-transgenic fertile hybrids with 50 percent of non-fluorescence for popularization and application.
Drawings
FIG. 1 shows a T-DNA region map of a maize dominant genic male sterility vector p5126-ZmMs 7M. The size of the T-DNA was 7.5kb, and 3 expression cassettes were contained therein, and the herbicide resistance genes were identified from the left border to the right border of the T-DNABarExpression cassette of (1), Male sterile elementp5126-ZmMs7Expression cassette and color marker gene ofmCherryThe expression cassette of (1).
FIG. 2 shows the plasmid map of the maize dominant genic male sterility vector p5126-ZmMs 7M.
FIG. 3 shows tassels, florets and pollen of the p5126-ZmMs7M maize dominant male sterile line.
FIG. 4 shows the result of copy number analysis of independent transformation events of p5126-ZmMs7M maize dominant male sterile line.
FIG. 5 shows the segregation of ear color in maize dominant male sterile line of p5126-ZmMs7M transgenic event # 01.
FIG. 6 shows the creation of different p5126-ZmMs7M dominant genic male sterile lines. The 1 st to 2 th behavior transgenic sterile line has a spike phenotype under normal white light, the 3 rd to 4 th behavior transgenic sterile line has a spike phenotype under green excitation light, the 3 rd behavior is a spike phenotype under a domestic optical filter, and the 4 th behavior is a spike phenotype under an import optical filter.
FIG. 7 is a flow chart of the technology for creating the dominant genic male sterile line of maize and screening the fluorescent seeds by color selection by using p5126-ZmMs 7M.
FIG. 8 is the technical flow chart of the breeding of the p5126-ZmMs7M maize dominant genic male sterile line and the cross breeding and seed production application thereof.
Detailed Description
The following examples are intended to illustrate the invention without limiting its scope. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.
Unless otherwise specified, enzyme reagents such as endonuclease used in the examples were purchased from Takara Shuzo (Dalian) Co., Ltd., and synthesis and sequencing of primers and genes were carried out by Biotechnology engineering (Shanghai) Co., Ltd. Other biochemical reagents are not specifically noted but are conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1: construction of dominant sterile vector p5126-ZmMs7M
1. Construction of pT5126-ZmMs7Ocs vector (expression cassette 5126 containing male flower fertility gene ZmMs 7: ZmMs7, SEQ ID NO. 1)
The maize inbred line B73 was used as a material, and genomic DNA was extracted using a plant genomic DNA extraction Kit (Kangji corporation) from the plantagen DNA Kit. The 5126 promoter fragment was amplified using the obtained genomic DNA as a template, using the following primers:
oligo 01: 5' -gaattcatctttctgatttcaaccat, (GAATTC for EcoRI cleavage site)
Oligo 02: 5' -gcggccgcggatgggccccgcaaagcaactttgatttg, (gggccC is ApaI restriction site, GCGGCCGC is NotI restriction site)
The amplified product is a 1.5 kb fragment5126The promoter was ligated into pEASY-T5 vector, and the obtained vector was named pT 5126.
Extracting RNA from maize inbred line B73, reverse transcription PCR amplificationIncreaseMs7Gene, 2.01kb was obtainedMs7A gene fragment. The primers used were as follows:
Oligo03： 5’- TAGGGCCCGGATCCATGGCTGCCAATAATAAGACGATG
Oligo04： 5’- GGCATGCCGGATCCCTAACAGCTCAAGGGAGGGA
the terminator Ocs fragment was amplified using the vector pCAMBIA2300-Ubi-Ocs stored in the laboratory of the company of the inventors as a template, using the following primers:
Oligo05： 5’- TAGGGATCCGGCATGCCCTGCTTTAATGAGATAT
Oligo06： 5’- TAGCGGCCGCTCAATCAGTAAATTGAACGGAGAATATT
will obtainMs7AndOcstaking 1: l mixing as a template, performing overlap PCR amplification by using primers oligo03 and oligo06 to obtainMs7AndOcsthe fused fragment Ms7-Ocs was digested with ApaI and NotI and then recovered with gel.
The plasmid pT5126 was digested with ApaI and NotI and recovered by gel electrophoresis. The two fragments were ligated to obtain pT5126-ZmMs7 Ocs.
The constructed pT5126-ZmMs7Ocs is taken as a template, and 5126-ZmMs7Ocs expression element fragments are amplified by using the following primers:
Oligo07： 5’-ACATGATTACGAATTCATCTTTCTGATTTCAACCATTACC
Oligo08：5’-AGTTCTAGAGAAGCTTTCAATCAGTAAATTGAACGGAGAA
the 5126-ZmMs7Ocs fragment (3.7 Kb, SEQ ID NO. 1) obtained by amplification is subjected to gel recovery and is used for constructing a p5126-ZmMs7M vector.
2. Construction of Gene containing fluorescent protein markermCherryIntermediate vector pCLC of expression cassette (Ltp 2: mCherry, SEQ ID NO. 2)
And (3) amplifying an Ltp2 fragment by using pMD18-Ltp2 as a template, wherein the primers are as follows:
oligo 09: 5' -caaagcttctctagaactagtggatctcgatgtgtag (AAGCTT is HindIII enzyme cutting site);
oligo 10: 5' -ctggtcaccagatcttactcggctacactcacac (GGTCACC is BstEII cleavage site).
The amplified product, Ltp2 fragment, and pCAMBIA3301 were digested with HindIII and BstEII, and recovered with a gel, followed by ligation to obtain pCLtp.
Plasmid pMD18-mCherry containsmCherryGene (synthesized by Shanghai Yingjun Biotechnology Co., Ltd.) and amplified using the plasmid as a templatemCherryFragments, the primers used were:
oligo 11: 5' -cggagatctatggtgagcaagggcgaggag (AGATCT is BglII cleavage site)
Oligo 12: 5' -cggagatcttacttgtacagctcgtccatg (AGATCT is BglII cleavage site)
Subjecting the amplification product tomCherryThe fragment is cut by BglII, plasmid pCLtp is cut by BglII and then dephosphorylated, and the pCLC is obtained after the gel is recovered and connected.
Construction of p5126-ZmMs7M vector
For the gene containing fluorescent protein marker constructed abovemCherryThe intermediate vector pCLC of the expression element was digested simultaneously with restriction enzymes HindIII and EcoRI, and the resulting vector backbone fragment (10.0 Kb) was recovered from the gel.
The carrier framework segment recovered by the glue is connected with 5126-ZmMs7Ocs through homologous recombination, and the transformant obtained through transformation is verified to be correct through PCR identification and sequencing verification. The constructed vector was named p5126-ZmMs 7M.
The p5126-ZmMs7M comprises 3 expression cassettes, as shown in FIG. 1, from the left border to the right border of T-DNA, the expression cassette for the herbicide resistance Gene Bar, the dominant sterility 5126-ZmMs7 expression cassette, and the color marker GenemCherryThe expression cassette of (1). The map of the p5126-ZmMs7M vector is shown in FIG. 2.
Example 2: application of dominant genic male sterile vector p5126-ZmMs7M
1. Obtaining dominant genic male sterile transgenic strain by agrobacterium-mediated corn genetic transformation
With reference to AN (Methods in Enzymology (1987)153:292-305), the dominant nuclear sterility vector p5126-ZmMs7M constructed by the invention is transformed into Agrobacterium EHA105(Hood et al, Transgenic Res (1993)2:208-218), the positive strain obtained by transformation is identified and selected for Agrobacterium-mediated genetic transformation, and the strain is deposited in China general microbiological culture Collection center (CGMCC), the classification suggested by the deposited strain is named as "Escherichia coli (Escherichia coli)", and the inventor names "p 5126Ms 7M"; and (4) storage address: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North; the preservation date is as follows: 9 month and 14 days 2018; the preservation number is: CGMCC NO. 16474.
The different transgenic events were obtained by Agrobacterium-mediated genetic transformation of maize (Frame et al, Plant Physiology (2002)129: 13-22), finally by field phenotype and I2KI pollen staining and identifying the male flower fertility phenotype.
The specific method comprises the following steps: 1-2. mu.g of plasmid was added to 100. mu.L of ice-solubilized Agrobacterium EHA105 competent cells and ice-cooled for 30 min. Placing in liquid nitrogen, rapidly freezing for 1 min, and transferring into 37 deg.C water bath for 5 min; rapidly ice-cooling for 2 min, adding 1000 μ L YEB liquid culture medium, culturing at 28 deg.C and 200 rpm for 2-4 hr, spreading on solid YEB plate containing 50 mg/L Rifampicin and 100mg/L Kanamycin (Kanamycin), and culturing for 2-3 days. After single colonies grow out, single colonies are picked and inoculated in YEB liquid culture medium containing corresponding antibiotics, and shake culture is carried out at 28 ℃ for overnight. And (3) extracting the plasmid by an alkaline cracking method. The plasmid is transformed into escherichia coli DH5 alpha competent cells to obtain monascus, the monascus is inoculated into an LB culture medium for culture, and then the plasmid is extracted. And verifying the authenticity of the obtained plasmid by an enzyme digestion or PCR method.
According to a conventionally adopted agrobacterium infection method, the immature embryo of the sterile-cultured corn HiII and the agrobacterium of the embodiment are co-cultured, so that the T-DNA (comprising 3 expression cassettes) in the dominant genic male sterile vector p5126-ZmMs7M constructed in the embodiment is transferred into a corn genome, and a transgenic corn plant is obtained.
For Agrobacterium-mediated transformation of maize, briefly, young embryos are isolated from maize and infected with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the construct mediating male fertility of the plant to the cells of the young embryos (step 1: the infection step). In this step, the young embryos are immersed in an Agrobacterium suspension (OD 660= 0.4-0.6, infection medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, Acetosyringone (AS) 40mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, pH 5.3)) to initiate inoculation. The young embryos are co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). The young embryos are cultured on a solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS) 100mg/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, pH 5.8) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cefamycin) is present in the recovery medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, pH 5.8) (step 3: recovery step). The young embryos are cultured on solid medium with antibiotics but no selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Subsequently, the immature embryos are cultured on selective solid medium with a selective agent (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2, 4-dichlorophenoxyacetic acid (2, 4-D) 1mg/L, agar 8g/L, pH 5.8) resulting in selective growth of the transformed cells (step 4: selection step). Then, the callus was cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant into a plant (step 5: regeneration step).
The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salts 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8), and cultured and differentiated at 25 ℃. Transferring the differentiated plantlets to the MS rooting medium (MS salt is 2.15g/L, MS g, vitamin, casein is 300mg/L, sucrose is 30g/L, indole-3-acetic acid is 1mg/L, agar is 8g/L, and pH is 5.8), culturing at 25 ℃ to a height of about 10cm, and transferring to a greenhouse for culturing to be fruitful. In the greenhouse, the culture was carried out at 28 ℃ for 16 hours and at 20 ℃ for 8 hours each day.
For the identification of the male flower phenotype of p5126-ZmMs7M transgenic plants, the method has the advantages ofIn vivo, transgenic plants were first phenotypically observed for male flower fertility (fig. 3). Relative to wild-type fertile plant B73 (i.e., wild-type fertile plant)ZmMs7Wild type), the male flower of the transgenic plant is sterile, the small flower is shrunken, and the anther is small but not exposed, which is similar to the way thatms7-6007Phenotype of the mutant. Further by pollen I2KI staining experiments found: the wild pollen is round and full, the pollen grains are full of starch, and the pollen grains are blue-black after being dyed; the pollen grains of the p5126-ZmMs7M transgenic plants are irregular, and the transgenic plants are transparent yellow after being dyed because the transgenic plants do not contain starch; whilems7-6007The mutant appeared to be free of pollen grains. Thus, the dominant nuclear male sterility of p5126-ZmMs7M transgenic plants is of the type of infectious-abortive sterility, unlikems7-6007Recessive sterile mutant (pollen-free sterile).
Identification of copy numbers of different lines of dominant genic male sterile transgenic maize by Real-time PCR
Taking the transgenic corn plant (T) with positive DNA level and RNA level detection0) About 100mg of the leaf was used as a sample, genomic DNA was extracted with a plant genomic DNA extraction Kit of PlantGen DNA Kit, and the genomic DNA was detected by Taqman probe fluorescent quantitative PCR methodBarGenes andIVRcopy number of the gene. Meanwhile, wild corn plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.
Detection ofBARGenes andIVRthe specific method of gene copy number is as follows: taking transgenic corn plantZmMs7And leaves of wild type corn plants, each 100mg, were ground in a mortar with liquid nitrogen to homogenate, 3 replicates were taken for each sample; extracting the genomic DNA of the sample by using a plant genomic DNA extraction Kit of a PlantGen DNA Kit, and referring to the product specification of the specific method; measuring the concentration of the genome DNA of the sample by using a Quawell Q5000 ultramicro ultraviolet spectrophotometer; adjusting the concentration of the genomic DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 ng/ul to 100 ng/ul; identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, and taking the sample of a wild corn plantTaking the product as a negative control, taking the average value of 3 replicates of each sample; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:
the following primers and probes were used to detect the BAR gene sequence:
Oligo21：5’- TCACTCGGGATGACGATGG ；
Oligo22：5’- TGCCACCAGACAGTGTCCG ；
probe 1: 5 ' -ccgagccgcaggaaccgcaggag (fluorophore 5 ' 6-FAM; quencher 3 ' TAMRA);
the following primers and probes were used to detect IVR gene sequences:
Oligo23：5’- TGGCGGACGACGACTTGT ；
Oligo24：5’- AAAGTTTGGAGGCTGCCGT ；
probe 2: 5 ' -CGAGCAGACCGCCGTGTACTTCTACC (fluorophore 5 ' CY5; quencher 3 ' BHQ-2);
the PCR reaction system is as follows:
the PCR reaction conditions are as follows:
data were analyzed using SDS2.3 software (Applied Biosystems).
Experimental results showed that the construct mediating dominant genic sterility of plants, comprising the complete T-DNA region, had integrated into the genome of the maize plants tested and that transgenic maize plants with low copies of the dominant genic sterility construct were obtained (fig. 4).
Example of ear color separation in maize dominant genic male sterile line
The resulting low copy transgenic maize dominant genic male sterile transformation event can be maintained and propagated by crossing and backcrossing with different maize backbone lines (e.g., zheng 58, etc.). Specifically, the dominant genic male sterile maize plant (T)0) As a masterHybridizing with conventional fertile line (Zheng 58, etc.), and harvesting hybridized T1Seed generation (T)1). As shown in fig. 5, under normal light, all the seeds are yellow or white, and the difference is not obvious; under green excitation light, 50% of the hybridized T1Seed (T)1) Showing red fluorescence, namely, showing the transgenic dominant genic male sterile line seeds (expressed by S); another 50% of the hybrid T1Seed (T)1) The epidermis has no red fluorescence (dark brown), and the epidermis is non-transgenic fertile maintainer seeds (expressed by M).
The S and M seeds were planted until they reached the 3-leaf stage, and the S and M plants were sprayed with 3mg/L herbicide, and whether the plants were damaged or not was determined based on the leaf damage observed on the 5 th day after the herbicide treatment. Experiments showed that the S plants showed essentially no leaf damage, while the M plants showed significant leaf damage.
The above fluorescence observations and herbicide resistance results indicate that the mediating plant dominant genic male sterility construct is transmitted to the progeny by female gamete mode at a frequency of about 50%, i.e., S is a transgenic maize plant (sterile line plant) containing the mediating plant dominant genic male sterility construct, and M is a fertile plant (maintainer line plant) not containing the construct.
Creation, screening and cross breeding of different p5126-ZmMs7M dominant genic male sterile lines and seed production application
The low copy p5126-ZmMs7M maize dominant genic male sterility transformation event can be introduced into the genetic background of different maize stem lines (e.g. Zheng 58, etc.) by traditional backcross transformation methods. For example, p5126-ZmMs7M maize dominant genic male sterile lines with new genetic background can be created by crossing and backcrossing different transgenic events (p 5126-ZmMs7M-02, p5126-ZmMs7M-03, p5126-ZmMs7M-04, FIG. 6) with conventional inbred lines (e.g., Zheng 58, etc.), respectively, and the technical flow is shown in FIG. 7. Under normal white light, all the seed colors are yellow or white, and the difference is not obvious; under green excitation light, 50% of the hybridized T1The seeds show red fluorescence, namely the seeds of the transgenic dominant genic male sterile line; another 50% of the hybrid T1The seed epidermis has no red fluorescence (showing dark brown color), and the seed is the non-transgenic fertile maintainer line seed. The transgenic sterile line seeds and the non-transgenic maintainer line seeds can be efficiently screened by a fluorescent color sorter.
The dominant genic male sterile line of the maize containing the construct can be used for carrying out cross breeding with high efficiency, and the technical flow is shown as figure 8. Planting corn transgenic dominant genic male sterile line seed containing the construct and other corn conventional selfing line seeds, and performing artificial hybridization by using the dominant genic male sterile line plant as a female parent and other corn conventional selfing lines as male parents in the flowering and pollen scattering periods of corn to obtain F1And (4) hybridizing. The F1The color of the seeds of the hybrid seeds is not obviously different when the hybrid seeds are observed under normal light (the appearance quality of the corn commodity is not influenced); under the excitation light source of green, the red fluorescent seeds are separated into 50% of red fluorescent seeds as transgenic sterile hybrid seeds and 50% of non-fluorescent seeds as non-transgenic fertile hybrid seeds through the observation of a fluorescent filter. The F1On one hand, the hybrid can be used as a transgenic variety for direct mixing test and a hybrid combination ratio, and the fertile hybrid and the sterile hybrid can be pollinated freely without influencing the yield and the appearance quality of the commodity; alternatively, non-transgenic fertile hybrids that are 50% non-fluorescent can be selected for testing by a fluorescent color sorter.
The maize dominant genic male sterile line containing the construct can be used for high-efficiency hybrid seed production. Through backcross transformation, the maize transgenic dominant genic male sterile female parent line containing the construct with different genetic backgrounds is directionally improved and created. In a seed production field, the dominant genic male sterile female parent line seeds and the conventional male parent inbred line seeds are planted according to the row ratio of 5:1, free pollination is carried out, the male parent line is pulled out in the later period or harvested in advance, and F on the dominant genic male sterile female parent line is obtained1And (4) hybridizing. The F1The color of the hybrid seeds is not obviously different when the hybrid seeds are observed under white light (the appearance quality of corn products is not influenced); under the excitation light source of green, the red fluorescent seeds are separated into 50% of red fluorescent seeds as transgenic sterile hybrid seeds and 50% of non-fluorescent seeds as non-transgenic fertile hybrid seeds through the observation of a fluorescent filter. The F1The hybrid species may be, on the one handThe hybrid is directly mixed and planted as a transgenic variety, and fertile hybrid and sterile hybrid are pollinated freely, so that the corn yield and the commodity appearance quality are not influenced; on the other hand, the fluorescence color selector can be used for selecting non-transgenic fertile hybrids with 50 percent of non-fluorescence for popularization and application.
Related references:
1. universal yuan, wu qiao, zhou shi, xie ke li jinping, granted patents: a ZmMs7 gene sequence for controlling male fertility of corn and a coding protein thereof, and the application number is as follows: 201410338212.0
2. Universal yuan, xie ke, wu qiao wei, li jin xian, anzhili, zhang dan feng, xiao zhong hua, liu caucasian, granted patent: a multi-control sterile expression vector constructed based on Ms7 gene and a method for maintaining and propagating maize recessive genic male sterile line, which has the following application numbers: 201510301333.2
3.Zhang, D., Wu, S., An, X., Xie, K., Dong, Z., Zhou, Y., Xu, L.,Fang, W., Liu, S., Liu, S., et al. (2018). Construction of a multicontrolsterility system for a maize male-sterile line and hybrid seed productionbased on the ZmMs7 gene encoding a PHD-finger transcription factor. PlantBiotechnol J 16, 459-471.
4.Allen, R.L. and Lonsdale, D.M. (1993). Molecular characterizationof one of the maize polygalacturonase gene family members which are expressedduring late pollen development. Plant J. 3, 261-271.
5.Brooks, J. E., R. M. Blumenthal, and T. R. Gingeras. (1983). Theisolation and characterization of the Escherichia coli DNA adenine methylase(dam) gene. Nucleic Acids Res. 11, 837-851.
6.An, G., Mitra, A., Choi, H.K., Costa, M.A., An, K., Thornburg, .W.,Ryan, C.A. (1989), Functional analysis of the 3′ control region of the potatowound-inducible proteinase inhibitor II gene. Plant Cell 1, 115-122.
7.Franck A, Guilley H, Jonard G, Richards K, Hirth L. (1980).Nucleotide sequence of cauliflower mosaic virus DNA. Cell 21, 285-294.
8.Kalla, R., Shimamoto, K., Potter, R., Nielsen, P.S., Linnestad, C.,and Olsen, O.A. (1994). The promoter of the barley aleurone-specific geneencoding a putative 7 kDa lipid transfer protein confers aleurone cell-specific expression in transgenic rice. Plant J. 6, 849-860.
9.An, G. (1987). Binary Ti vectors for plant transformation andpromoter analysis. Meth Enzymol.153, 29-305.
10.Hood, E.E., Gelvin, S.B., Melchers, S., Hoekema, A. (1993). NewAgrobacterium helper plasmids for gene transfer to plants. TransgenicResearch 2:208-218.
11.Frame, B.R., Shou, H., Chikwamba, R., Zhang, Z., Xiang, C, Fonger,T., Pegg, S-E., Li, B., Nettleton, D., Pei, P., Wang, K. (2002)Agrobacterium-mediated transformation of maize embryos using a standardbinary vector system. Plant Physiology 129: 13-22
Sequence listing
<110> Beijing Chujiali Hua Koch Co., Ltd
<120> creation of maize dominant nuclear male sterile line by utilizing p5126-ZmMs7M construction body and breeding and seed production application method thereof
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>3713
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atctttctga tttcaaccat taccgatgaa tttctatttg gattagttca ttttcgtctt 60
ccctgtctga tcctgttttc gacaattctg atcccgaatc cgtttttgaa ttaaaatata 120
aaaaataaaa acaagaaatg gtttatctcg gtcaatttcg tttttcgcga ggaacatatt 180
cggtgtacat gagcctttgg tgcacatgaa ctaacaaagt tcacaaaaaa ttctgaaaaa 240
aaatcataca tattctttgc atcgctactc ctattatata taaaatttca tgttcaaatt 300
tgttatattt tagctgtaat aaaaagagta tttttagccg attttctaat ttaaacttgt 360
cagaagttgt ctttttttat tacaactaag tttaatgaat ttgaacttga aacatgtata 420
taattagagt aagatgaaaa gaatatgtat ggattttttc aaaaaaattg taaacctttt 480
ttagttcatg tgcaccatat gtgaatcaaa ggttcatata caccggatat gtttcctttt 540
tcacgaacct aatctggcct agccagtatg ttgtggactt ggctcctaag tgtgaacctg 600
gcagtgatgg gcaacaaagc aggcatgcct tatgtgtgat gaataattga cacatgtacc 660
gagaggtttg gggttttttt gtattgcata gcaaaacatg gtgaaattct tagggtattt 720
ttgagattac atttagggca tgtttgtttc ccttcatttt gaggaattgg aatctaacta 780
ataaattagg ctattttttt agaatgtgac attcccaact ttctaaagtg tacatataag 840
tctatcttaa ataatttata gggtggaaga tgtaaattga ttatatagat ttataagctt 900
cttttctaat gtaaaattta aagctcactc ttctacttgc ttctctataa cataatatag 960
tttataacta cctctctcat atgatttaga ataatataca aatatattac ataaaaaata 1020
tattaattga attagtgttg tctaatttat aattattaga atgtaattca attccaacga 1080
aacaacgggg ccttaggttt aatatcttcc ttacactgcg aaaatgttgt tacacttgcc 1140
aaaaaaaatc aatcgcatat ttaccttaca aggacatatt ttagcaaaat gctatagaca 1200
tgaatccaac gtaatcaata gagtgagatt tactggtaaa ctaccaattg ctcatctgct 1260
cggtaccaac cagcctttcc tattaccatg cacatgttgc ctctcaactg cagcatcttt 1320
caagccgtga gcagacatgt tgcagatcga agtaaggtat atatgtgcat agtctcctaa 1380
ttcttcatct tcaacctcta gctgattgat ctctggtatt taccactctt tccttccttc 1440
cttccttcaa ttctaaatac cacaaatcaa agttgctttg cggggcccgg atccatggct 1500
gccaataata agacgatggt ggtcagcctg gggagctcgc ggcggcggaa gcgcggcgag 1560
atgctgttcc ggttcgagtc cttctgccag cccggctacc ccgctccgct cgccggcggg 1620
ggcgccttca gggacaacgt cagggcgctg ctcggcctcg cgcacctgga ggccggcgcg 1680
catggcgaga ccaagtgctg gtctttccag ctcgagctgc accgccaccc gcccaccgtc 1740
gtcaggctct tcgtcgtcga ggaagtggtc gacacgtcgc cgcagcgcca gtgccacctc 1800
tgccgtcacg tcggttgggg tcggcatctg atctgcagca agcggttcca cttcgtgctg 1860
cccaagaggg agttgtcagt ggaagctgac ggcctgcact acgggatcaa ccacagcccg 1920
gagaaaccgt ccaaaggcac ggcgacctcc aggggccacc tgctgcacgg cgtggtgcac 1980
ctcaacggct tcggccacct cgttgccctg cacggcttcg agggcggctc cgaattcgtc 2040
gccggcgagc agatcatgga cctctgggat cgcatatgct cctctctgaa cgtcaggaag 2100
gtgagcctcg tcgacacggc gaggaagggg cacatggagc tgcggctgct gcacggcgtt 2160
gcgtacggcg acacgtggtt cgggcggtgg ggctacaggt tcggccggcc cagctacggc 2220
gtcgcgctac cgtcctacca gcagtcgctg cacgcgctcc agtcggtacc tctctgcgtg 2280
ctcgtgccgc acctgtcgtg cttcagccag gacctccccg tggtggtgac caagtaccag 2340
gccatcagcg gccacaagct gctcaacctc ggcgacctcc tccgcttcat gctcgagctg 2400
cggacgcgcc tcccggcgac ctccgtcacc gccatggact accgcggcat catgtcggag 2460
gcctcgtgcc ggtggtcggc caagcgcgtg gacatggcgg cccgcgccgt ggtggacgct 2520
ctccgccgca ccgagccgcc cgcgcggtgg gtcacgcggc aggaggtgcg cgacgcggcg 2580
cgcgcctaca tcggcgacac gggcctcctc gacttcgtgc tcaagtccct gggcaaccac 2640
atcgtcggca actacgtcgt gcgacgcgcg atgaacccgg tgaccaaggt gctcgagtac 2700
tgcctggagg acgtgtccag cgtgctcccg gcggtgggcg gcgtgccgag caacggcggc 2760
ggcaagatga gggtccggtt ccagctcacg cgggcgcagc tcatgaggga cctgatgcac 2820
ctgtaccgcc acgtgctgaa ggagccgagc caggcgctca ccaccggcgc cttcggcgcg 2880
atccccgtgg cggcgcggat ggtcttggac accaagcact tcgtcaaaga ttaccacgaa 2940
ggtttcgctc cgatcaacag tgttggagtt gggcacgtcc acatgaacct gtgttgcacg 3000
ctgcttctga agaacggggg tccggagctg gtggcgccgt acgagacggt caccctgccg 3060
gcgcatgcaa cggtgggcga gctcaaatgg gaggtgcaga ggctgttcag tgagatgtac 3120
ctcggcctaa ggaccttcac ggccgagtcc gtcgccgggg tcggcgtcag ccaggacgct 3180
tgcccggtgc tcgggctcat cgacgtggga agcgtcgtgg tgatcgaagg atcagtcgtc 3240
gagcagcagc agctggcgga tgaaagcgta catacaggga gcgaggccgc gtctgtgagc 3300
gagggaggcg gcgacagcga gagggtcgtg gactgcgcgt gcggagcgga tgacgacgac 3360
ggggagcgca tggcgtgctg cgacatctgc gaggcgtggc agcacacccg gtgcgcgggg 3420
atcaaggaca ccgacgacgc cccgcacgtc ttcgtctgca accgctgcga caacgacgtt 3480
ctgtcattcc ctcccttgag ctgttaggga tccggcatgc cctgctttaa tgagatatgc 3540
gagacgccta tgatcgcatg atatttgctt tcaattctgt tgtgcacgtt gtaaaaaacc 3600
tgagcatgtg tagctcagat ccttaccgcc ggtttcggtt cattctaatg aatatatcac 3660
ccgttactat cgtattttta tgaataatat tctccgttca atttactgat tga 3713
<210>2
<211>1856
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ctctagaact agtggatctc gatgtgtagt ctacgagaag ggttaaccgt ctcttcgtga 60
gaataaccgt ggcctaaaaa taagccgatg aggataaata aaatgtggtg gtacagtact 120
tcaagaggtt tactcatcaa gaggatgctt ttccgatgag ctctagtagt acatcggacc 180
tcacatacct ccattgtggt gaaatatttt gtgctcattt agtgatgggt aaattttgtt 240
tatgtcactc taggttttga catttcagtt ttgccactct taggttttga caaataattt 300
ccattccgcg gcaaaagcaa aacaatttta ttttactttt accactctta gctttcacaa 360
tgtatcacaa atgccactct agaaattctg tttatgccac agaatgtgaa aaaaaacact 420
cacttatttg aagccaaggt gttcatggca tggaaatgtg acataaagta acgttcgtgt 480
ataagaaaaa attgtactcc tcgtaacaag agacggaaac atcatgagac aatcgcgttt 540
ggaaggcttt gcatcacctt tggatgatgc gcatgaatgg agtcgtctgc ttgctagcct 600
tcgcctaccg cccactgagt ccgggcggca actaccatcg gcgaacgacc cagctgacct 660
ctaccgaccg gacttgaatg cgctaccttc gtcagcgacg atggccgcgt acgctggcga 720
cgtgcccccg catgcatggc ggcacatggc gagctcagac cgtgcgtggc tggctacaaa 780
tacgtacccc gtgagtgccc tagctagaaa cttacacctg caactgcgag agcgagcgtg 840
tgagtgtagc cgagtaagat ctatggtgag caagggcgag gaggataaca tggccatcat 900
caaggagttc atgcgcttca aggtgcacat ggagggctcc gtgaacggcc acgagttcga 960
gatcgagggc gagggcgagg gccgccccta cgagggcacc cagaccgcca agctgaaggt 1020
gaccaagggt ggccccctgc ccttcgcctg ggacatcctg tcccctcagt tcatgtacgg 1080
ctccaaggcc tacgtgaagc accccgccga catccccgac tacttgaagc tgtccttccc 1140
cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac 1200
ccaggactcc tccctgcagg acggcgagtt catctacaag gtgaagctgc gcggcaccaa 1260
cttcccctcc gacggccccg taatgcagaa gaagaccatg ggctgggagg cctcctccga 1320
gcggatgtac cccgaggacg gcgccctgaa gggcgagatc aagcagaggc tgaagctgaa 1380
ggacggcggc cactacgacg ctgaggtcaa gaccacctac aaggccaaga agcccgtgca 1440
gctgcccggc gcctacaacg tcaacatcaa gttggacatc acctcccaca acgaggacta 1500
caccatcgtg gaacagtacg aacgcgccga gggccgccac tccaccggcg gcatggacga 1560
gctgtacaag taagatctgg tgaccagctc gaatttcccc gatcgttcaa acatttggca 1620
ataaagtttc ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct 1680
gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg 1740
ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata 1800
gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atcggg 1856
<210>3
<211>1454
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tgagactttt caacaaaggg taatatcggg aaacctcctc ggattccatt gcccagctat 60
ctgtcacttc atcaaaagga cagtagaaaa ggaaggtggc acctacaaat gccatcattg 120
cgataaagga aaggctatcg ttcaagatgc ctctgccgac agtggtccca aagatggacc 180
cccacccacg aggagcatcg tggaaaaaga agacgttcca accacgtctt caaagcaagt 240
ggattgatgt gaacatggtg gagcacgaca ctctcgtcta ctccaagaat atcaaagata 300
cagtctcaga agaccaaagg gctattgaga cttttcaaca aagggtaata tcgggaaacc 360
tcctcggatt ccattgccca gctatctgtc acttcatcaa aaggacagta gaaaaggaag 420
gtggcaccta caaatgccat cattgcgata aaggaaaggc tatcgttcaa gatgcctctg 480
ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg 540
ttccaaccac gtcttcaaag caagtggatt gatgtgatat ctccactgac gtaagggatg 600
acgcacaatc ccactatcct tcgcaagacc cttcctctat ataaggaagt tcatttcatt 660
tggagaggac acgctgaaat caccagtctc tctctacaaa tctatctctc tcgagtctac 720
catgagccca gaacgacgcc cggccgacat ccgccgtgcc accgaggcgg acatgccggc 780
ggtctgcacc atcgtcaacc actacatcga gacaagcacg gtcaacttcc gtaccgagcc 840
gcaggaaccg caggagtgga cggacgacct cgtccgtctg cgggagcgct atccctggct 900
cgtcgccgag gtggacggcg aggtcgccgg catcgcctac gcgggcccct ggaaggcacg 960
caacgcctac gactggacgg ccgagtcgac cgtgtacgtc tccccccgcc accagcggac 1020
gggactgggc tccacgctct acacccacct gctgaagtcc ctggaggcac agggcttcaa 1080
gagcgtggtc gctgtcatcg ggctgcccaa cgacccgagc gtgcgcatgc acgaggcgct 1140
cggatatgcc ccccgcggca tgctgcgggc ggccggcttc aagcacggga actggcatga 1200
cgtgggtttc tggcagctgg acttcagcct gccggtaccg ccccgtccgg tcctgcccgt 1260
caccgagatt tgactcgagt ttctccataa taatgtgtga gtagttccca gataagggaa 1320
ttagggttcc tatagggttt cgctcatgtg ttgagcatat aagaaaccct tagtatgtat 1380
ttgtatttgt aaaatacttc tatcaataaa atttctaatt cctaaaacca aaatccagta 1440
ctaaaatcca gatc 1454
Claims (7)
1. A dominant nuclear male sterility construct that mediates male fertility in maize comprising three types of gene expression cassettes: (a) the first expression cassette is a gene expression cassette causing dominant nuclear male sterility of corn, and the expression cassette is formed by a corn 5126 promoter specifically expressed by pollen and a male flower development geneZmMs7The gene is operatively connected with a terminator of an agrobacterium octopine synthase gene, and the sequence of the gene is shown as SEQ ID NO. 1; (b) the second expression cassette is an expression cassette for marking the color of the corn seed coat, and the expression cassette is composed of an Ltp2 promoter specifically expressed by the corn seed coat, a corn seed coat color marking gene-red fluorescent genemCherryIs operably connected with a nopaline synthetase gene terminator, and the sequence of the nopaline synthetase gene terminator is shown as SEQ ID NO. 2; (c) the third expression cassette is herbicide resistance gene expression cassette, which is formed by connecting cauliflower mosaic virus 35S promoter, herbicide resistance gene and cauliflower mosaic virus 35S polyA terminator in operation, and the sequence is shown in SEQ ID NO. 3.
2. A method for creating a maize dominant genic male sterile plant comprising the construct of claim 1, the method comprising: (a) providing a first plant; (b) creating a second plant, said second plant having the construct of claim 1 introduced into said first plant and said construct being present on only one of the homologous chromosomes of maize, i.e., said construct is hemizygous, said plant exhibiting dominant nuclear male sterility independent of its background genotype; (c) fertilizing said second plant with the male gamete of said first plant to maintain and produce 50% of the progeny of said second plant genotype.
3. A method for propagating dominant male sterile maize seed containing the construct of claim 1, comprising: (a) heterozygotic for the second plant of claim 2 as the female parent by the first plant of claim 2 as the male parent; (b) producing 50% of the seeds containing the construct as transgenic dominant nuclear male sterile line seeds; (c) 50% non-transgenic normal fertile maintainer seed is produced.
4. The method according to claim 2, further comprising a method of identifying plants having the construct, wherein the method of identifying plants having the construct is in particular: (a) planting 50% of red fluorescent transgenic dominant male sterile seeds containing the construct that result from cross-pollination of the first plant with the second plant of claim 2; (b) growing the seed into a plant to be identified; (c) spraying the plants to be identified with an herbicide, the plants having the construct having no symptoms of plant damage or having a lesser degree of symptoms of damage than the plants not having the construct.
5. The method according to claim 3, further comprising a method of identifying seeds having the construct, characterized in that the method of identifying seeds having the construct is in particular: the method of claim 2, wherein the seeds produced by cross-pollination of the second plant with the first plant are observed under normal light and are all normal color seeds, and under green excitation light and through a red fluorescence filter, 50% of the seeds with red fluorescence are the transgenic dominant genic male sterile line seeds containing the construct.
6. A method of cross breeding using a dominant male sterile maize line containing the construct of claim 1, the method comprising: (a) planting the maize transgenic dominant male sterile line seed containing the construct of claim 3, and other maize conventional inbred line seeds of different genetic backgrounds; (b) in the flowering and pollen scattering periods of the corn, the dominant genic male sterile line plant is used as a female parent,using other conventional maize inbred lines as male parents to carry out artificial hybridization to obtain F1Hybrid seeds; (c) observing the F under normal light1The color of the hybrid seeds is not obviously different, namely the color of normal corn grains, and the appearance quality of corn commodities is not influenced; but can be separated into 50% of red fluorescent seeds which are transgenic male sterile hybrid seeds and 50% of non-fluorescent seeds which are non-transgenic fertile hybrid seeds by observing through a red fluorescent filter under a green excitation light source; (d) the F1On one hand, the hybrid can be used as a transgenic variety for direct mixing test and a hybrid combination ratio, and the fertile hybrid and the sterile hybrid can be pollinated freely without influencing the yield and the appearance quality of the commodity; alternatively, a non-transgenic fertile hybrid with 50% no red fluorescence can be selected for testing and quality control by a color sorter.
7. A method for hybrid seed production by using the dominant genic male sterile line of the corn containing the construct of claim 1, which is characterized by comprising the following steps: (a) the dominant genic male sterile line is used as a female parent, and the maize transgenic dominant genic male sterile female parent line containing the construct with different genetic backgrounds is directionally improved and created through backcross transformation; (b) in a seed production field, the dominant genic male sterile female parent line seeds and the conventional male parent inbred line seeds are planted according to the row ratio of 5:1, free pollination is carried out, the male parent line is pulled out in the later period or harvested in advance, and F on the dominant genic male sterile female parent line is obtained1Hybrid seeds; (c) observing the F under normal light1The color of the hybrid seeds is not obviously different, the appearance quality of the corn commodity is not influenced, but the hybrid seeds can be separated into 50 percent of red fluorescent seeds which are transgenic male sterile hybrid seeds and 50 percent of non-fluorescent seeds which are non-transgenic fertile hybrid seeds by observing through a red fluorescent filter under a green excitation light source; (d) the F1On one hand, the hybrid seeds can be directly mixed and planted as transgenic varieties, and the fertile hybrid seeds and the sterile hybrid seeds are freely pollinated without influencing the yield and the appearance quality of the corn; on the other hand, the non-transgenic fertile hybrid with 50% of no red fluorescence can be selected for popularization and application through a color selector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811450364.4A CN109504702B (en) | 2018-11-30 | 2018-11-30 | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs7M construct and breeding application method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811450364.4A CN109504702B (en) | 2018-11-30 | 2018-11-30 | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs7M construct and breeding application method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109504702A CN109504702A (en) | 2019-03-22 |
| CN109504702B true CN109504702B (en) | 2020-09-29 |
Family
ID=65749589
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811450364.4A Active CN109504702B (en) | 2018-11-30 | 2018-11-30 | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs7M construct and breeding application method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109504702B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002206A (en) * | 2015-06-04 | 2015-10-28 | 北京首佳利华科技有限公司 | Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines |
| CN105274118A (en) * | 2014-07-16 | 2016-01-27 | 北京首佳利华科技有限公司 | ZmMs7 gene sequence for controlling male fertility in maize and coding protein |
-
2018
- 2018-11-30 CN CN201811450364.4A patent/CN109504702B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274118A (en) * | 2014-07-16 | 2016-01-27 | 北京首佳利华科技有限公司 | ZmMs7 gene sequence for controlling male fertility in maize and coding protein |
| CN105002206A (en) * | 2015-06-04 | 2015-10-28 | 北京首佳利华科技有限公司 | Multi-control sterility expression vector constructed on basis of Ms7 gene and method for using multi-control sterility expression vector for keeping and reproducing corn recessive genic male sterile lines |
Non-Patent Citations (2)
| Title |
|---|
| ABNOＲMAL POLLEN VACUOLATION1 ( APV1 ) is required for male fertility by contributing to anther cuticle and pollen exine formation in maize;Somaratne等;《Plant J》;20170131;第90卷(第1期);全文 * |
| 玉米核雄性不育的分子机制研究与应用分析;柳双双等;《中国生物工程杂志》;20171215;第38卷(第1期);第101页表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109504702A (en) | 2019-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9816106B2 (en) | Methods and compositions for selective regulation of protein expression | |
| CN105018475B (en) | Multi-control infertility vector constructed on basis of Ms1 gene and used for mediation of male fertility of corn, and application thereof | |
| CN109868273B (en) | Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof | |
| WO2017121411A1 (en) | Plant male fertility-related protein, and coding gene and application thereof | |
| WO2020248969A1 (en) | Male sterility maintainer line plant and use thereof | |
| WO2015035951A1 (en) | Use of genic male sterility gene and mutation thereof in hybridization | |
| WO2019219046A1 (en) | Method for rapidly and efficiently obtaining non-transgenic, gene-targeted mutated plant and use thereof | |
| CN105002206B (en) | A kind of many controls sterile expression vector gene constructed based on Ms7 and its method for holding and propagating corn recessive gms line | |
| US20130024985A1 (en) | Male and female sterility lines used to make hybrids in genetically modified plants | |
| AU2019460919B2 (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method therefor | |
| JP2004512007A (en) | Methods and compositions for reducing or eliminating transgene transmission | |
| Xia et al. | A method for mechanized hybrid rice seed production using female sterile rice | |
| WO2016054236A1 (en) | In situ embryo rescue and recovery of non-genetically modified hybrids from wide crosses | |
| CN110881367A (en) | Corn event Ttrans-4 and methods of use thereof | |
| CN111511916A (en) | Flowering phase regulation gene CMP1 and related vector and application thereof | |
| CN105039316B (en) | Method for maintaining and breeding maze male sterile line constructed on basis of Ms30 gene | |
| CN109504703B (en) | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs1D construct and breeding application method thereof | |
| US20220275383A1 (en) | Sterile genes and related constructs and applications thereof | |
| CN114946639B (en) | Application of two wheat induction lines in identification of wheat haploid embryo and grain | |
| CN105579583B (en) | The breeding of Female sterile clone and cross-breeding technology | |
| US20050120416A1 (en) | Novel method for the production of hybrid maize seeds | |
| CN109504702B (en) | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs7M construct and breeding application method thereof | |
| CN112680460B (en) | Male sterile gene ZmTGA9 and application thereof in creating male sterile line of corn | |
| CN112430684B (en) | Nucleic acid sequence for detecting rice plant H23 and detection method thereof | |
| CN109504701B (en) | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs1M construct and breeding application method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |