CN103627782A - Myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like) - Google Patents
Myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like) Download PDFInfo
- Publication number
- CN103627782A CN103627782A CN201210304457.2A CN201210304457A CN103627782A CN 103627782 A CN103627782 A CN 103627782A CN 201210304457 A CN201210304457 A CN 201210304457A CN 103627782 A CN103627782 A CN 103627782A
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- myocardial infarction
- apoe
- ace
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like). The kit comprises a specific primer capable of detecting the genotype of three mononucleotide polymorphic sites such as epsilon 2, epsilon 3 and epsilon 4 (rs429358 and rs7412) in APOE gene, I/D (rs4646994) in ACE gene and C-572G (rs1800796) in IL-6 gene, a DNA sequencing primer, a PCR reaction assembly, a PCR product purification assembly, a DNA sequencing reaction assembly and the like. The kit provided by the invention is used for evaluating the occurrence risk grade of myocardial infarction from a gene level by detecting the genotype of the three mononucleotide polymorphic sites closely related to myocardial infarction occurrence, and guiding people to prevent from disease occurrence. The sampling method employs oral mucous membrane cell sampling which causes no pain and no invasion and avoids cross infection. The sequencing detection result is accurate and reliable, no imported special apparatus with expensive price needs purchasing, and the method is easy to popularize.
Description
Technical field
This project belongs to biology field, relate to medical science and biotechnology, be specifically related to a kind of myocardial infarction kit for detecting susceptibility genes, the risk class according to detected result from the morbidity of gene aspect assessment myocardial infarction, and instruct as the direction of prevention and treatment myocardial infarction.
Background technology
Myocardial infarction is a kind of acute and can cause the heart state of life danger.Its cause of disease is because the blood circulation of part cardiac muscle interrupts making the serious persistence acute ischemia of corresponding cardiac muscle appearance, thereby finally causes myocardial ischemia downright bad.Its clinical symptom has an intense pain after can showing as breastbone, uncomfortable, dizzy etc., and there is irregular pulse, shock and the phenomenon such as in heart failure, sometimes even can lose one's senses.In developing country, myocardial infarction is still one of maximum cause of death, and the mortality ratio occurring in latter a year is about 50%.Therefore develop a kind of convenient, efficient myocardial infarction susceptibility detection technique and will there is positive meaning for prevention and treatment myocardial infarction.There are some researches show that at present angiotensin-converting enzyme (ACE) and the isogenic single nucleotide polymorphism of apo E (ApoE) all have direct correlation with the susceptibility of myocardial infarction, in prevention and treatment myocardial infarction, there is certain predictive value.
Renin-angiotensin system plays a part very important in cardiovascular systems, and ACE is the important component of renin-angiotensin system, be responsible for angiotensin I to be converted into bioactive Angiotensin II, can affect the propagation of cardiac muscle and vascular smooth muscle cell.Exist (I) or the disappearance (D) of the Alu repeated sequence being comprised of 287 base pairs in ACE the 16th intron are called as insertion/deletion (I/D) polymorphism.The DD genotype of ACE can cause the Angiotensin II of higher level and cause irregular pulse.The DD genotype and the D gene frequency that in Chinese han population, have been found that myocardial infarction patient ACE gene are all significantly higher than normal people, are considered to an independent hazard factor of myocardial infarction.Also the DD homozygote frequency of finding in addition the concurrent person of myocardial infarction in diabetes B patient significantly increases, and thinks that this genotype is the risks and assumptions of myocardial infarction.
ApoE is the phosphorous lipoglycoprotein by 299 Amino acid profiles, is the important component part of plasma lipoprotein and participates in cholesterol metabolic directly.ApoE mainly contains ε 2, ε 3 and 4 three kinds of allelotrope of ε, the tri-kinds of different isomer of E2, E3 and E4 of encoding respectively.Much research shows that ApoE ε 4/ ε 3 genotype and ε 4 gene frequencies are all significantly higher than normal population in Patients With Myocardial Infarction.Therefore, ApoE ε 4 allelotrope are considered to the important genetic marker of myocardial infarction.Concrete mechanism of action as for 4 pairs of myocardial infarctions of ApoE ε it be unclear that, and tentatively thinks that blood lipid level causes owing to having changed.In myocardial infarction, ApoE ε 4 allelotrope and ACE gene D allelotrope have conspiracy relation.
In sum, the disease significant correlation embodying in myocardial infarction disease in view of ACE gene and ApoE gene, the high risk population that can come timely examination to go out easy trouble myocardial infarction by detecting these myocardial infarction generation genes involved mononucleotide loci gene types, thereby prevent targetedly and treat, this has very important meaning for the sickness rate that reduces myocardial infarction.
Summary of the invention
Based on the 2 ε 3 ε 4 (rs429358 of ε on APOE gene, rs7412), on I/D (rs4646994), IL-6 gene, 3 mononucleotide polymorphism site genotype of C-572G (rs1800796) can be used to assess myocardial infarction onset risk rank on ACE gene, the invention provides a kind of myocardial infarction gene noninvasive detection kit.
This test kit comprises:
Detect on APOE gene on ε 2 ε 3 ε 4 (rs429358, rs7412), ACE gene on I/D (rs4646994), IL-6 gene 3 genotypic Auele Specific Primers of mononucleotide polymorphism site of C-572G (rs1800796) to and DNA sequencing primer.
PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.).
PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.).
DNA sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).
Component and the content of test kit of the present invention comprise:
PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O 19.175ul.
PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O 3.875ul.
Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM DNA sequencing primer 1ul; 125mM EDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O 2ul.
This test kit detects for a person-portion, and the storage temperature of test kit is-20 ℃.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Unless otherwise defined, the same meaning that all specialties of using in literary composition and scientific words and one skilled in the art are familiar.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
The use of embodiment 1. detection kit.
1, extracting DNA profiling
Scraping person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.
2, pcr amplification reaction
Use the PCR reaction component in detection kit, wherein, contain following primer pair:
(1) APOE(ε 2 ε 3 ε 4) forward primer: 5'AAATCGGAACTGGAGGAACAA3'
APOE(ε 2 ε 3 ε 4) reverse primer: 5'TGCCCATCTCCTCCATCC3'
(2) ACE(I/D) forward primer: 5'CTGGGCAACAGAGTGAGACC3'
ACE(I/D) reverse primer: 5'ACCCAAGTGCCAGTGATGTT3'
(3) IL-6 (C-572G) forward primer: 5'CAGCAGCCAACCTCCTCTAA3'
IL-6 (C-572G) reverse primer: 5'CCAAGCCTGGGATTATGAAG3'.
The reaction system of pcr amplification is: 10 * PCR reaction buffer 2.5ml; The dNTP mixed solution 0.2ml of 25mM, 5U/ul Taq enzyme 0.125ml, DNA profiling 1ml (12-15ng left and right), each 0.25ml of 20uM forward primer reverse primer, ddH2O 19.175ml.
Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ extend for 1 minute, circulate 28 times, and last 72 ℃ extend more than 5 minutes.
3, pcr amplification product purifying
Use the PCR product purification assembly in detection kit, reaction system is cumulative volume 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.
On ABI2720 type pcr amplification instrument, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.
4, DNA sequencing reaction
Use the sequencing reaction assembly in detection kit, wherein, contain following DNA sequencing primer:
(1) APOE(ε 2 ε 3 ε 4) sequencing primer: 5'AAATCGGAACTGGAGGAACAA3'
(2) ACE(I/D) sequencing primer: 5'CTGGGCAACAGAGTGAGACC3'
(3) IL-6 (C-572G) sequencing primer: 5'CAGCAGCCAACCTCCTCTAA3'.
The system of reaction is cumulative volume 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uM DNA sequencing primer 1ul, deionized water 2ul.
On ABI2720 type pcr amplification instrument, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 circulations, 55 ℃ of 30s, 60 ℃ of 4min.
After reaction finishes, add 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, under room temperature, precipitate 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min, removes supernatant liquor gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min, removes supernatant liquor gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.
5, gene type assay
The those skilled in the art that are familiar with DNA sequencing technology can determine by identification DNA sequencing collection of illustrative plates the genotype in the SNP site of detecting.
The service that embodiment 2. prevents myocardial infarction gene noninvasive to detect for crowd.
1. sample and extracting DNA
By hospital laboratory doctor, instruct person under inspection to use oral cavity sampling wiper to carry out mouth epithelial cells sampling, adopt phenol chloroform method to carry out the DNA extracting of mouth epithelial cells.
2. genotype detection
Use test kit provided by the invention, to the 2 ε 3 ε 4 (rs429358 of ε on the APOE gene of person under inspection's genomic dna, rs7412), on I/D (rs4646994), IL-6 gene, 3 mononucleotide polymorphism sites of C-572G (rs1800796) carry out respectively DNA sequencing on ACE gene, determine the genotype in these 3 SNPs sites.
3. myocardial infarction high risk population risk-assessment
By to the genotypic analysis of person under inspection SNPs, provide risk of myocardial infarction analysis and assessment report.In report, describe on person under inspection APOE gene on ε 2 ε 3 ε 4 (rs429358, rs7412), ACE gene 3 SNP locus genes of C-572G (rs1800796) on I/D (rs4646994), IL-6 gene in detail and detect information and genetic risk assessment result.In addition, according to person under inspection's risk class, and to person under inspection, describe and understand myocardial infarction gene noninvasive examining report list by doctor in detail.
Claims (7)
1. an examination myocardial infarction high risk population gene noninvasive detection kit, it is characterized in that: detect on APOE gene on ε 2 ε 3 ε 4 (rs429358, rs7412), ACE gene 3 the genotypic Auele Specific Primers of mononucleotide polymorphism site of C-572G (rs1800796) on I/D (rs4646994), IL-6 gene and DNA sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH
2o etc.
2. test kit according to claim 1, it is characterized in that: described Auele Specific Primer is to referring to the 2 ε 3 ε 4 (rs429358 for ε on APOE gene, rs7412), 3 mononucleotide polymorphism sites of C-572G (rs1800796) on I/D (rs4646994), IL-6 gene on ACE gene, can specific amplification go out to comprise the primer pair of the DNA fragmentation in these 3 SNPs sites.
3. test kit according to claim 1, it is characterized in that: described DNA sequencing primer is for the 2 ε 3 ε 4 (rs429358 of ε on APOE gene, rs7412), 3 mononucleotide polymorphism sites of C-572G (rs1800796) and designing on I/D (rs4646994), IL-6 gene on ACE gene, can go out by DNA sequencing technology specific detection the DNA sequencing primer of above-mentioned 3 SNPs loci gene types.
4. according to the test kit shown in claim 1, it is characterized in that, 3 pairs of contained specific primer sequences are as follows:
(1) APOE(ε 2 ε 3 ε 4) forward primer: 5'AAATCGGAACTGGAGGAACAA3'
APOE(ε 2 ε 3 ε 4) reverse primer: 5'TGCCCATCTCCTCCATCC3'
(2) ACE(I/D) forward primer: 5'CTGGGCAACAGAGTGAGACC3'
ACE(I/D) reverse primer: 5'ACCCAAGTGCCAGTGATGTT3'
(3) IL-6 (C-572G) forward primer: 5'CAGCAGCCAACCTCCTCTAA3'
IL-6 (C-572G) reverse primer: 5'CCAAGCCTGGGATTATGAAG3'.
5. test kit according to claim 1, is characterized in that, 3 contained DNA sequencing primer sequences are as follows:
(1) APOE(ε 2 ε 3 ε 4) sequencing primer: 5'AAATCGGAACTGGAGGAACAA3'
(2) ACE(I/D) sequencing primer: 5'CTGGGCAACAGAGTGAGACC3'
(3) IL-6 (C-572G) sequencing primer: 5'CAGCAGCCAACCTCCTCTAA3'.
6. test kit according to claim 1, is characterized in that the component of test kit and content comprise:
(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, 20uM Auele Specific Primer pair, every each 0.25ul of primer, ddH
2o 19.175ul;
(2) PCR product purification system: 1 U/ul SAP enzyme 0.75ul, 10 U/ul ExoI enzyme 0.375ul, ddH
2o 3.875ul;
(3) sequencing reaction system: 25% BigDye mix1ul, 3.2uM DNA sequencing primer 1ul, 125mM EDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH
2o 2ul.
7. this test kit detects application for a person-portion, and the storage temperature of test kit is-20 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210304457.2A CN103627782A (en) | 2012-08-24 | 2012-08-24 | Myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210304457.2A CN103627782A (en) | 2012-08-24 | 2012-08-24 | Myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103627782A true CN103627782A (en) | 2014-03-12 |
Family
ID=50209230
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210304457.2A Pending CN103627782A (en) | 2012-08-24 | 2012-08-24 | Myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103627782A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018356A (en) * | 2016-11-01 | 2018-05-11 | 广州康昕瑞基因健康科技有限公司 | ACE gene detecting kits and detection method |
-
2012
- 2012-08-24 CN CN201210304457.2A patent/CN103627782A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018356A (en) * | 2016-11-01 | 2018-05-11 | 广州康昕瑞基因健康科技有限公司 | ACE gene detecting kits and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673915A (en) | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit | |
| Qrafli et al. | The CYP7A1 gene rs3808607 variant is associated with susceptibility of tuberculosis in Moroccan population | |
| CN104152557B (en) | The diagnostic kit of gene pleiomorphism variant sites earlier evaluations mammary cancer risk | |
| Barta et al. | Analysis of mutations in the plasma cholinesterase gene of patients with a history of prolonged neuromuscular block during anesthesia | |
| CN103468781A (en) | Coronary artery heart disease susceptibility gene non-invasive detection kit | |
| CN103627782A (en) | Myocardial infarction susceptibility gene noninvasive detection kit (IL-6 gene and the like) | |
| CN103468784A (en) | Atrial fibrillation susceptibility gene non-invasive detection kit | |
| CN103374624A (en) | Noninvasive detection kit for calcium phosphorus metabolism regulating power genes | |
| CN101353704B (en) | Method and reagent kit for detecting psoriasis predisposing genes, and LCE predisposing genes | |
| CN102605082A (en) | Detection kit for systemic lupus erythematosus | |
| CN103468782A (en) | Essential hypertension gene noninvasive detection kit | |
| CN103468789A (en) | Noninvasive test kit of thyroid cancer susceptibility genes | |
| CN102373285A (en) | Noninvasive gene assay kit for female gestational hypertension | |
| CN103540649A (en) | Deep venous thrombosis susceptible gene detection kit (MTHFR and other genes) | |
| CN102586468A (en) | Noninvasive detection kit for susceptibility gene of bladder cancer | |
| CN102586430A (en) | Noninvasive detection kit for liver cancer susceptibility genes | |
| CN103374621A (en) | Non-invasive detection kit for susceptibility gene of chronic lymphocytic leukemia | |
| CN103627783A (en) | Gout susceptibility gene noninvasive detection kit (APOE gene and the like) | |
| CN103710425A (en) | Susceptible noninvasive detection kit for hypertension (genes like GNB3) | |
| CN103540647A (en) | Cerebral hemorrhage susceptible noninvasive detection kit (AGTR1 and other genes) | |
| CN103540645A (en) | Dilated cardiomyopathy susceptible detection kit (CTLA4 and other genes) | |
| CN103374620A (en) | Kit for detecting stomach cancer inheritance risk | |
| CN103374622A (en) | Noninvasive detection kit for Hashimoto's thyroiditis genes | |
| CN103710424A (en) | Gene noninvasive detection kit for Graves disease (genes like TSHR) | |
| CN102703581A (en) | Colorectal cancer susceptibility gene noninvasive detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140312 |