CN103626860A - Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof - Google Patents
Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof Download PDFInfo
- Publication number
- CN103626860A CN103626860A CN201310647930.1A CN201310647930A CN103626860A CN 103626860 A CN103626860 A CN 103626860A CN 201310647930 A CN201310647930 A CN 201310647930A CN 103626860 A CN103626860 A CN 103626860A
- Authority
- CN
- China
- Prior art keywords
- lactococcus lactis
- recombinant
- allergen
- bacterial strain
- marah2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof. According to the invention, on the basis of retaining natural peanut allergen Arah2 protein immunogenicity, the allergenicity is lowered, codon optimization and modified mutation are performed on Arah2 so as to obtain an optimized gene mArah2, and recombinant expression vectors and recombinant lactococcus lactis strains aiming at mArah2 are built. By using the recombinant strains in the invention for rat immunization, peanut allergy can be effectively restrained, and the immune protection effect is remarkable. Therefore, the lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen have a great potential on the aspect of curing peanut allergy.
Description
[technical field]
The Recombinant Lactococcus lactis bacterial strain that the present invention relates to express hypoallergenic Peanut Allergen mArah2, its construction process and application, belong to technical field of bioengineering.
[background technology]
Peanut allergy is modal food anaphylaxis reaction, and sickness rate is higher, can cause serious even fatal clinical symptom.Peanut allergy is normally lifelong, the general difficult immunological tolerance that produces with age.At present, specific immunotherapy is comparatively effective peanut allergy methods for the treatment of.But traditional specific immunotherapy is mostly used anaphylactogen crude extract, extracted amount is little, purity is low.Utilizing the recombinant expressed allergen protein of gene engineering method is a kind of simple and feasible method.Tao Ailin etc. utilize intestinal bacteria successfully to prepare a kind of restructuring Peanut Allergen and mutant as expressive host in patent < < restructuring Peanut Allergen and mutant and its preparation method and application > >.But intestinal bacteria produce intracellular toxin, and its expression product needs subsequent purification, has all hindered large-scale promotion and the application of escherichia expression system.
Lactococcus lactis has been widely used in food, medicine and the field such as agriculture, is generally regarded as safe food-grade microorganisms.In recent years, the significant development of Lactococcus lactis molecule genetics research makes to utilize Lactococcus lactis expression exogenous antigen to prepare the focus that mucosal vaccine becomes research.The albumen that Lactococcus lactis is expressed can be directly oral together with thalline, and the foreign protein of its expression simultaneously can induce body to produce effective immunne response.
Peanut Allergen comprises the multiple glycosylated protein of molecular weight between between 0.7-100kDa, and Arah2 is one of component that in peanut, sensitization is the strongest, can be exceeded specific IgE identification in 90% peanut allergy patients serum.The people's such as Stanley J S, Chatel J M result of study shows; the main linear epitope of Arah2 is: aa9-18, aa39-48, aa47-56 and aa61-66(StanleyJS; etal.Identification and mutational analysis of the immunodominant IgE binding epitopes of the major peanut allergen Arah2.Arch Biochem Biophys; 1997,342 (2): 244-253; Chatel J M, et al.Isolation and characterization of two complete Arah2 isoforms cDNA.Int arch Allergy Immy, 2003,131 (1): 14-18).Wherein, first IgE is in conjunction with epi-position aa9-18 and CD4
+t Cell binding epi-position has coincidence (Prickett S R et al.Arah2 peptides containing dominant CD4
+t-cell epitopes:candidates for a peanut allergy therapeutic.J Allergy Clin Immun, 2011,127 (3): 608-615).Consider that natural anaphylactogen may bring out anaphylaxis in immunotherapy, the present invention carries out reasonably modifying sudden change by genetic engineering technique to optimizing rear peanut allergy protogene nArah2, retain its immunogenic its allergenicity that simultaneously reduces, obtaining the allergen gene mArah2 of low-allergen.
Therefore, the present invention utilizes Lactococcus lactis (Lactococcus lactis) to express mArah2 albumen as host strain, to prepare peanut allergy oral vaccine, and evaluates its immune effect by mouse model.
[summary of the invention]
The technical problem to be solved in the present invention is to provide a kind of Peanut Allergen albumen mArah2 of low-allergen, the recombinant plasmid that comprises this protein coding gene, with this plasmid, transform lactococcal strain, wherein said bacterial strain can be Lactococcus lactis NZ9000, obtains Recombinant Lactococcus lactis bacterial strain L.lactis NZMH.
The invention still further relates to the vaccine that comprises described Recombinant Lactococcus lactis bacterial strain, described vaccine can be oral preparations, such as capsule, lozenge, pulvis or granule etc.
The invention still further relates to described recombinant plasmid or Recombinant Lactococcus lactis bacterial strain and can be used for treating the purposes in the Lactococcus lactis bacteria vaccine of peanut allergy in preparation.
In the present invention, the Peanut Allergen albumen mArah2 of low-allergen has reduced its allergenicity on the reservation immunogenic basis of original protein, can effectively avoid the anaphylaxis that natural anaphylactogen may bring out in immunotherapy, greatly reduces side effect.And by results of animal, show, the Lactococcus lactis recombinant bacterial strain of low-allergen can impel immune response to change from Th2 type to Th1 type, and peanut allergy is played to prophylactic effect.
Therefore the form that, mArah2 gene can recombinant plasmid vaccine is used for preventing and treating peanut allergy; Recombinant Lactococcus lactis bacterial strain L.lactis NZMH can be used as clinical prevention and the immunotherapy that a kind of novel low irritability vaccine is applied to peanut allergy.
The Lactococcus lactis Lactococcus lactis NZMH the present invention relates to, on September 18th, 2013, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.8219;
The Lactococcus lactis Lactococcus lactis NZNH the present invention relates to, on September 18th, 2013, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.8216.
[accompanying drawing explanation]
The Western blot that Fig. 1: nArah2 and mArah2 albumen are expressed in Lactococcus lactis analyzes; M, non-pre-dsred protein lower molecular weight standard; The His-nArah2 albumen that the 1st swimming lane is purifying; The 2nd swimming lane is L.lactis NZ; 3 and 4 swimming lanes are respectively L.lactis NZNH, L.lactis NZMH;
Fig. 2: experimentation on animals schema;
Fig. 3: the scoring of allergic symptom: symbol (△) represents that mouse is individual, and line segment represents mean value.Different letters (a-c) represent to have significant difference (p<0.05) between group;
Fig. 4: the impact of Recombinant Lactococcus lactis on mice serum specific antibody: the specific IgE(A of change of serum C PE), IgG1(B) and IgG2a(C) content with the OD value at 450nm place, represent.Symbol (▲, ●, ◆) representing that mouse is individual, line segment represents mean value.Different letters (a-d) represent to have significant difference (p<0.05) between group.
The impact of Fig. 5 Recombinant Lactococcus lactis on total IgE antibody and MCP-1 in mice serum: a: compare p<0.05 with negative control group; B: compare p<0.05 with model group.
[embodiment]
Carry out by the following examples further to set forth the present invention, the experimental technique of unreceipted actual conditions in lower routine embodiment, substantially all according to common molecular cloning handbook, carry out experimental implementation, if no special instructions, its concentration is mass percent concentration to all ingredients.
The acquisition of embodiment 1 low-allergen gene mArah2
(1) optimization of natural peanut allergen gene Arah2:
Erasure signal peptide sequence in the aminoacid sequence (genbank:AAN77576.1) of Arah2, in conjunction with the preferences of Lactococcus lactis codon, to Arah2 gene order, carry out codon optimized simultaneously, and subclone is to pUC57, the plasmid pUC57-nArah2(that obtains comprising natural anaphylactogen optimized gene nArah2 is synthesized by the raw work in Shanghai, and wherein pUC57 is commercialization plasmid).
(2) modification of natural anaphylactogen optimized gene nArah2 sudden change:
Aa47-56 epitope is disconnected, and rearrange by the amino-acid sequence of 50-151-1-49, obtain the peanut allergy protogene mArah2 of low-allergen.Correlated series is as follows:
Natural gene order (genbank:AY158467.1) before optimizing, SEQ ID No.1.
Modify the optimized gene sequence (mArah2) after sudden change, SEQ ID No.2.
Natural acid sequence (genbank:AAN77576.1) before optimizing, SEQ ID No.3.
Modify the optimization aminoacid sequence after sudden change, SEQ ID No.4.
The rearrangement splicing of object fragment aa1-49, aa50-151: synthetic by the raw work in Shanghai with plasmid pUC57-nArah2(, wherein pUC57 is commercialization plasmid) be template, utilize respectively primer P1F:CAGGTGGTCGTGATCGTTA TCGTCAACAATGGGAATTAC/P1R:CCCTCGAGATCTTGTGATGGTGAATATG and primer P2F:CGCCATAT GCCATATTCTCCTTCACAAG/P2R:GTAATTCCCATTGTTGACG ATAACGATCACGACCACCTG amplification aa1-49 and aa50-151 fragment gene.Utilize 1% agarose gel electrophoresis to detect and reclaim respectively the PCR product of two gene fragments of purifying.Adopt gene splicing by overlap extension to splice object fragment aa1-49, aa50-151.Amplification system following (cumulative volume is 50 μ L): 10 * KOD plus buffer:5 μ L; DNTP:5 μ L; MgSO4:2 μ L; Template 1-49:2 μ L; Template 50-151:2 μ L; KOD enzyme: 0.5 μ L; DdH2O:31.5 μ L.After 5 circulations, add again each 1 μ L of upstream and downstream primer (P1R/P2F).The goal gene fragment called after mArah2 that splicing is completed and carrier pNZ8148(Mierau and Kleerebezem.10years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis.Appl Microbiol Biotechnol.2005,68 (6): the 705-717) ligation of spending the night after double digestion.
The preparation of embodiment 3 Recombinant Lactococcus lactis
Above-mentioned ligation product electric shock is transformed to L.lactis NZ9000(Kuipers et al.Quorum sensing-controlled gene expression in lactic acid bacteria.Journal of Biotechnology.1998,64 (1): 15-21) competent cell.Picking transformant carries out sequence verification, by the correct recombinant plasmid of order-checking and transformant respectively called after pNZ8148-mh2(build voluntarily) and L.lactis NZMH, the L.lactis NZ9000 bacterial strain of L.lactis NZ9000 and recombinant expressed nArah2 albumen is distinguished to called after L.lactis NZ and L.lactis NZNH.
Abduction delivering and the Western blot of embodiment 4 recombinant proteins in Lactococcus lactis detects analysis
(1) abduction delivering of recombinant protein in Lactococcus lactis:
The transformant list colony inoculation that picking checks order correct is GM17 liquid nutrient medium (the every liter of GM17 culture medium prescription: soy peptone 5g containing 10 μ g/mL paraxin (Cm) to 5mL, bacto peptone 5g, extractum carnis 5g, yeast powder 2.5g, glucose 5g, β-phospho-glycerol disodium 19g, vitamins C 0.5g, 1mol/LMgSO
41mL), 30 ℃ of overnight incubation; According to 2% inoculum size, transfer in the GM17 substratum that contains 10 μ g/mL Cm in 5mL, cultivate OD
600for 0.5-0.6; Adding nisin(Sigma, purchased from melodious bio tech ltd, Shanghai) to make its final concentration be 10ng/mL to inductor, and 30 ℃ are continued to cultivate after 6h, and in 4 ℃, the centrifugal 10min of 6000g collects thalline; After twice of PBS washing bacterial sediment, be resuspended in the PBS of 1/20 volume.Ultrasonication bacterium liquid is to translucent, and 4 ℃ with the centrifugal 20min of 12000g, collects supernatant liquor and carries out Western blot detection.
(2) Western blot detects the expression of recombinant protein:
Using the sample of above-mentioned preparation with L.lactis NZ(as negative control) after 12%SDS-PAGE gel is separated, in ice bath current stabilization (150mA), shift 40min, make protein delivery to pvdf membrane (Millipore, purchased from middle Ke Ruitai bio tech ltd); Transfer film is through every liter of 10 * PBS buffer formulation: NaCl80g of PBST(, KCl2g, Na
2hPO
4.12H2O35.8g, KH
2pO
42g; Every liter of PBST buffer formulation: 10 * PBS100ml, distilled water 900ml, Tween-200.05%) after washing, with PBST(containing 5% skim-milk) room temperature sealing 2h; Primary antibodie (1:1000 extent of dilution) and transfer film are in 4 ℃ of night incubation; With anti-(1:1.0 * 10 of HRP mark goat-anti rabbit two
4extent of dilution, SouthernBiotech, purchased from melodious bio tech ltd, Shanghai) and transfer film incubated at room 1h; On transfer film, drip under nitrite ion (purchased from Kang Wei century bio tech ltd, Beijing) lucifuge condition and develop the color.Result by Fig. 1 is known: in negative control (swimming lane 2), have no band, positive control (swimming lane 1) His-nArah2 is expection 19kDa size, at swimming lane 3 and 4, also detect the band that is all 19kDa simultaneously, in the same size with expection, the corresponding nArah2 of difference and mArah2 albumen.
(1) thalline preparation:
The recombinant bacterial strain of incubated overnight is transferred to containing in the fresh GM17 liquid of 10 μ g/mL paraxin (Cm) according to the ratio of 1:50, and 30 ℃ are cultured to OD
600during about 0.5-0.6 left and right, add the nisin(Sigma of 10ng/mL, purchased from melodious bio tech ltd, Shanghai) induce.6000g after 30 ℃ of induction 6h, centrifugal 10min collects the thalline after induction.With after twice of aseptic PBS solution washing bacterial sediment, be resuspended in appropriate PBS solution, adjusting cell concentration is 1 * 10
10cFU.
(2) experimentation on animals program
Experimentation on animals flow process as shown in Figure 2; Adopt Balb/c mouse to set up peanut allergy model, to its gavage recombinant bacterium L.lactis NZNH and L.lactis NZMH, by observing the allergic symptom of mouse, measure total IgE, specific antibody and MCP-1 level in mice serum, thereby the effect of recombinant bacterium prevention mouse peanut allergy is assessed.Experimentation on animals program: 30 female Balb/c mouse in 4 week age (purchased from Shanghai Slac Experimental Animal Co., Ltd.) adaptability was fed after one week, was divided at random 5 groups, 6 every group.Whole experimentation on animals process is divided into three phases: (1) prevention stage: the bacterium liquid (2 * 10 after continuous gavage 0.2mL induction in 1-4,7-10 days
9cFU); (2) the sensitization stage: 17th, 22,28,34,40,46 days gavage 6mg Semen arachidis hypogaeae protein crude extracts (CPE) and 10 μ gCT; (3) excitation phase: after last gavage the 7th day, in the time of the 53rd day, gavage 12mg CPE excited.
If the 1st group is PBS control group, every mouse is at prevention and equal gavage 0.2mL PBS of sensitization stage.The 2nd group of positive comparison model group, at prevention stage gavage equivalent PBS, and at sensitization stage gavage CPE and CT.The 3rd group is experiment contrast group, at prevention stage gavage L.lactis NZ9000; 4th, 5 groups are experimental group, at prevention stage difference gavage recombinant bacterium L.lactis NZNH and L.lactis NZMH.3rd, 4 and 5 groups at sensitization all gavage CPE and CT in the stage.The mouse of all groups all excites at the 53rd day gavage CPE.
Experimental result shows, by gavage Recombinant Lactococcus lactis L.lactis NZNH and L.lactis NZMH oral vaccine, the allergic symptom of peanut allergy mouse significantly alleviates, in mastocyte threshing and body, Th2 type immune response (serum IgE antibody) is obviously suppressed, and Th1 type specificity IgG2a antibody horizontal significantly increases; And compare with L.lactis NZNH, L.lactis NZMH is more remarkable to the restraining effect of mouse hypertrophy cell threshing, total IgE and specific IgE antibody secretion.These results show, low-allergen Recombinant Lactococcus lactis oral vaccine can more effectively suppress hypersensitive immune response, thus prevention peanut allergy.
As shown in Figure 3: after exciting, the mouse of PBS control group is without obvious allergic symptom.With respect to negative group, model group mouse allergic symptom is comparatively obvious, and 100% mouse has the behavior of frequent scratch nose and head after exciting, and occurs in addition oedema near the eyes, the symptoms such as diarrhoea.In probiotic group, all there is slight allergic symptom in mouse, and the behavior of frequent scratch nose and head is ubiquity also, but only has one or two mouse to occur symptom of diarrhea.Result shows, gavage L.lactis NZ9000 and Recombinant Lactococcus lactis all can slow down mouse peanut allergy symptom.
As shown in Figure 4, compare with negative group, in model group, CPE specific IgE and IgG1 anti-body contg significantly increase (P<0.05).Recombinant bacterium L.lactis NZNH and L.lactis NZMH all can reduce CPE specific IgE antibody significantly, but not remarkable on the impact of IgG1 antibody; And gavage L.lactis NZMH group-specific IgE level declines more remarkable compared with L.lactis NZNH group.Meanwhile, original strain L.lactis NZ9000 does not exert an influence to specific IgE and IgG1 antibody.Recombinant bacterium L.lactis NZNH and L.lactis NZMH all can induce and produce a large amount of Th1 type CPE specific IgG 2a antibody, with the significant difference of model group and negative group.
As shown in Figure 5, compare with model group, L.lactis NZNH and L.lactis NZMH organize total IgE and mastocyte threshing is all significantly inhibited, and the inhibition of L.lactis NZMH is more more remarkable than L.lactis NZNH.
Above result shows, recombinant bacterium L.lactis NZNH and L.lactis NZMH all can impel Th2 type reaction in Mice Body to change to Th1 type, regulate Th1/Th2 balance; But L.lactis NZMH is better than recombinant bacterium L.lactis NZNH for the immunoregulation effect of peanut allergy mouse, the effect of its prevention peanut allergy is more superior.
Although patent of the present invention with preferred embodiment openly as above, it is not in order to limit the present invention.Any person skilled in the art, without departing from the spirit and scope of the present invention, can do various changes and modification.Therefore protection scope of the present invention should be with being as the criterion that claims were defined.
Claims (10)
1. the Peanut Allergen albumen mArah2 of a low-allergen, it is characterized in that, it is that the aa47-56 epitope of natural A rah2 albumen is disconnected, and by the amino-acid sequence of 50-151-1-49, rearranges the low-allergen peanut allergy protogene mArah2 obtaining, as shown in SEQNo.2.
2. the recombinant plasmid of an encoding gene that comprises the low-allergen Peanut Allergen albumen mArah2 according to claim 1 that encodes.
3. the lactococcal strain that comprises recombinant plasmid according to claim 2.
4. lactococcal strain according to claim 3, it is characterized in that, described bacterial strain is to transform with the plasmid vector of the encoding gene of the Peanut Allergen mArah2 that comprises low-allergen the bacterial strain Lactococcus lactis NZMH obtaining after Lactococcus lactis NZ9000, on September 18th, 2013, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.8219.
5. the vaccine that comprises Recombinant Lactococcus lactis bacterial strain claimed in claim 4, is characterized in that, described vaccine is oral preparations.
6. the vaccine that comprises Recombinant Lactococcus lactis bacterial strain according to claim 5, is characterized in that, described oral preparations is capsule, lozenge, pulvis or granule.
7. the Recombinant Lactococcus lactis bacterial strain described in recombinant plasmid claimed in claim 2 or claim 3-4 any one can be used for treating the purposes in the Lactococcus lactis bacteria vaccine of peanut allergy in preparation.
8. a method of preparing Recombinant Lactococcus lactis bacterial strain claimed in claim 3, is characterized in that described method comprises the steps:
A) the natural gene sequence of Peanut Allergen Arah2 is carried out codon optimized and modified the peanut allergy protogene mArah2 that sudden change obtains low-allergen;
B) build recombinant expression plasmid;
C) utilizing recombinant expression plasmid to transform the Lactococcus lactis row filter of going forward side by side identifies and obtains Recombinant Lactococcus lactis bacterial strain.
9. the method for preparing Recombinant Lactococcus lactis bacterial strain according to claim 8, it is characterized in that step a), b) in build recombinant expression plasmid and comprise and take plasmid pUC57-nArah2 as template, utilize respectively primer P1F:CAGGTGG TCGTGATCGTTATCGTCAACAATGGGAATTAC/P1R:CCCTCGAGATCTTGTGA TGGTGAATATG and primer P2F:CGCCATAT GCCATATTCTCCTTCACAAG/P2R:GTA ATTCCCATTGTTGACGATAACGATCACGACCACCTG amplification aa1-49 and aa50-151 fragment gene; Utilize 1% agarose gel electrophoresis to detect and reclaim respectively the PCR product of two gene fragments of purifying; Adopt gene splicing by overlap extension to splice object fragment aa1-49, aa50-151, and the step of the ligation of spending the night after the goal gene fragment mArah2 that splicing is completed and carrier pNZ8148 double digestion.
10. the method for preparing Recombinant Lactococcus lactis bacterial strain according to claim 8, is characterized in that the method for transformation in step c) is that electricity transforms.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310647930.1A CN103626860A (en) | 2013-12-04 | 2013-12-04 | Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310647930.1A CN103626860A (en) | 2013-12-04 | 2013-12-04 | Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103626860A true CN103626860A (en) | 2014-03-12 |
Family
ID=50208337
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310647930.1A Pending CN103626860A (en) | 2013-12-04 | 2013-12-04 | Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103626860A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107916244A (en) * | 2017-06-20 | 2018-04-17 | 江西嘉博生物工程有限公司 | A kind of construction method of Recombinant Lactococcus lactis for expressing lysostaphin gene and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1045700B1 (en) * | 1998-01-16 | 2004-11-10 | The Johns Hopkins University | Oral delivery of nucleic acid vaccines by particulate complexes |
| CN102584966A (en) * | 2011-11-14 | 2012-07-18 | 广州医学院第二附属医院 | Recombinant peanut allergen and mutant and preparation method and application of recombinant peanut allergen and mutant |
-
2013
- 2013-12-04 CN CN201310647930.1A patent/CN103626860A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1045700B1 (en) * | 1998-01-16 | 2004-11-10 | The Johns Hopkins University | Oral delivery of nucleic acid vaccines by particulate complexes |
| CN102584966A (en) * | 2011-11-14 | 2012-07-18 | 广州医学院第二附属医院 | Recombinant peanut allergen and mutant and preparation method and application of recombinant peanut allergen and mutant |
Non-Patent Citations (6)
| Title |
|---|
| K ADEL-PATIENT ET AL: "Oral administration of recombinant Lactococcus latis expressing bovine β-lactoglobulin partially prevents mice from sensitization", 《CLIN EXP ALLERGY》 * |
| LI WEI ET AL: "Prevention and treatment of poly-lysine modified Arah2 DNA vaccine on Arah2 protein induced allergy", 《JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY》 * |
| NINA KING ET AL: "Allergenic characteristics of a modified peanut allergen", 《MOL NUTR FOOD RES》 * |
| 刘艳春等: "乳酸乳球菌载体疫苗", 《生命的化学》 * |
| 易海涛等: "经合理的序列重组制备花生主要过敏原Arah2低致敏衍生物", 《中国生物工程杂志》 * |
| 胡纯秋等: "花生过敏原Arah2.02二级结构和B细胞抗原表位预测", 《食品科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107916244A (en) * | 2017-06-20 | 2018-04-17 | 江西嘉博生物工程有限公司 | A kind of construction method of Recombinant Lactococcus lactis for expressing lysostaphin gene and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Clements et al. | Oral immunization of mice with attenuated Salmonella enteritidis containing a recombinant plasmid which codes for production of the B subunit of heat-labile Escherichia coli enterotoxin | |
| Bermúdez-Humarán | Lactococcus lactis as a live vector for mucosal delivery of therapeutic proteins | |
| KR101178415B1 (en) | Attenuated Salmonella mutants transformed with adhesin gene of pathogenic Escherichia coli in pigs and Vaccine composition comprising thereof for protection and treatment against pathogenic Escherichia coli and Salmonella in pigs | |
| CN104844712B (en) | Streptococcus pneumoniae protein antigen and its preparation method and application | |
| CN102276730B (en) | Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof | |
| Zhang et al. | Expression of hepatitis B virus surface antigen determinants in Lactococcus lactis for oral vaccination | |
| CN104593397A (en) | Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea | |
| CN115725002B (en) | Coli specific antigen fusion protein and recombinant lactococcus lactis thereof | |
| Zhang et al. | Construction of a recombinant Lactococcus lactis strain expressing a fusion protein of Omp22 and HpaA from Helicobacter pylori for oral vaccine development | |
| CN103304642A (en) | Porcine rotavirus delta VP8* subunit recombinant protein and applications thereof | |
| KR101151004B1 (en) | Vaccine composition for protection and treatment against pathogenic Escherichia coli and Salmonella in cattle by administration of attenuated Salmonella expressing adhesin gene of pathogenic Escherichia coli and vaccination method thereof | |
| US5595901A (en) | Method for obtaining protective active and inactive adenylate cyclase from Bordetella parapertussis | |
| EP0003692A2 (en) | E. Coli enterotoxin vaccine for veterinary & human use and process for its preparation | |
| CN103626860A (en) | Lactococcus lactis recombinant bacteria for expressing hypoallergenic peanut allergen, and application thereof | |
| CN103739682A (en) | Protein with immunogenicity on cervical cancer and application thereof | |
| CN105664148B (en) | A kind of gene engineered subunit polyvalent vaccine and its preparation method and application | |
| CN103007267A (en) | Recombined enterotoxin (namely, fimbriae composite polyvalent vaccine) for resisting diarrhea of piglets and preparation method for recombined enterotoxin (namely, fimbriae composite polyvalent vaccine) | |
| Shin et al. | Generation of transgenic corn-derived Actinobacillus pleuropneumoniae ApxIIA fused with the cholera toxin B subunit as a vaccine candidate | |
| CN116554346A (en) | Preparation and application of tandem sheep-derived escherichia coli virulence gene fusion protein | |
| Elleman et al. | Expression of the pilin gene from Bacteroides nodosus in Escherichia coli | |
| US20230265131A1 (en) | Amuc-1100 polypeptide variants for effecting immune signalling and/or affecting intestinal barrier function and/or modulating metabolic status | |
| CN102266551B (en) | Interleukin-4 therapeutic vaccine for treating immune related diseases of humans or animals | |
| CN103642746A (en) | Recombinant lactococcus lactis for intracellular expression of peanut allergen and application thereof | |
| CN102181437B (en) | A gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application | |
| CN103614331A (en) | Preparation method and application of recombinant lactococcus lactis capable of displaying peanut allergen on surface |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140312 |