CN102181437B - A gAd gene of porcine globular adiponectin and protein encoded by gAd gene and application - Google Patents

Abstract

The invention discloses a gAd gene of porcine globular adiponectin, a protein encoded by the gAd gene and application. A method comprises the following steps of: designing primers, namely P3 and P4 on the basis of a sequence of the gAd, adding six His labels at a terminal 5'of the gAd gene, cloning a gene fragment to a cloning host, namely Escherichia coli, identifying and amplifying a recombinant plasmid, performing electroporation on an expression host, namely Lactococcus lactis by using the plasmid, further screening to obtain a modified Lactococcus lactis strain which can efficiently express the gAd, preparing an antiserum specifically resisting the gAd, and determining that the gAd protein expressed in vitro has the reactogenicity. A lactic acid bacteria microecological preparation rich in the porcine globular adiponectin is prepared; and an important basis is laid for regulating fat metabolism and fat deposition of pigs by expressing adiponectin by recombinant Lactococcus lactisNZ9000.

Description

Pig adiponectin globular domain albumen gAd gene and encoded protein and application

Technical field

The invention belongs to gene engineering technology field, be specifically related to the expression of gAd albumen in the recombination lactic acid lactococcus spp of proteic gAd gene of pig adiponectin globular domain and coding thereof.

Background technology

Pig is the more animal of a kind of fatty deposits, and control label of pig fat deposition description, raising lean ratio can ensure that again the food safety of pork is the focus of domestic and international pig breeding and nutrient research always simultaneously.

Using " NAB-365Cl " to improve lean ratio constitutes a threat to the consumer health.For a long time, improve a pig lean ratio is to culture the target that the practitioner pursues always, because the high more economic benefit of raising pigs of lean ratio is just remarkable more.Therefore in order to reach the purpose that improves lean ratio, the many illegal use of raiser " NAB-365Cl " forbidden drugs of etc.ing, but " NAB-365Cl " residual food-safety problem that causes is to the very big threat of consumer health's formation.

On the other hand, along with improving constantly of standard of living, people are to charcuterie safety, and the requirement of meat such as mouthfeel, local flavor etc. is also improving.The lean meat that does not almost have fat has satisfied not human consumer's needs.Discover that when lipid content between the flesh of pig reached 2 %～3 %, the mouthfeel of the meat of pig was better in fact, the lean meat that contains fat between a certain amount of flesh has better meat.Therefore the investigator hopes to find influence pork fat and myofiber and deposits simultaneously the important physiological property material to animal and body harmless, with adjusting metabolism of fat and deposition.

(Adiponectin Ad) is wherein possible surrogate to adiponectin.Adiponectin is a kind of hormone of animal tallow emiocytosis, is the adipocyte-specific albumen that is negative correlation with fatty deposits.Adiponectin gets into blood circulation, plays a role through receptors bind, at liver, fat and Skelettmuskel regulation and control carbohydrate metabolism and fatty acid metabolism, influences that body tissue synthesizes utilization, insulin sensitivity, the lipid of sugar and energy balance etc.

Pig total length adiponectin albumen is made up of 243 amino acid, and it comprises four functional zone the primary sequence analysis: signal peptide, the non-helical functional zone of aminoterminal (N end), collagen Tumor-necrosis factor glycoproteins and the spherical district of carboxyl terminal (C end).The spherical district of C end is the key position of adiponectin protein biological activity.Adiponectin can be by protease cracking, and the protein fragments that contains carboxyl terminal globosity territory of the about 16.5kD of generation (globular adiponetin, gAd).GAd is its active structure domain, has this globosity territory of research report to act on separately and has stronger biological activity.

Therefore; How to seek suitable expression vector and expression method; Effectively, the spherical territory of safely expressed pig adiponectin, the external source adiponectin that acquisition can be directly utilized by animal, reaching the purpose of regulating a pig metabolism of fat and fatty deposits is the important topic that present this area is studied.

Summary of the invention

One of the object of the invention is the deficiency that overcomes the existing spherical territory of pig adiponectin utilisation technology, and the recombination and the proteins encoded in the spherical territory of a kind of pig adiponectin is provided.Another object of the present invention provides the expression vector of the recombination of expressing the spherical territory of said pig adiponectin.

The present invention also provides the expression method of said pig adiponectin globular domain albumen gAd gene and proteins encoded thereof.

The present invention provides a kind of gAd of containing Prokaryotic Expression carrier and the recombinant microorganism that utilizes this carrier to transform simultaneously.

The present invention provides the product or the purified recombinant adiponectin of the reorganization adiponectin that contains this recombinant microorganisms express simultaneously.

The object of the invention is achieved through following technical scheme:

The invention provides one group of new primer sequence, is to be used to increase the primer of recombination gAd in the spherical territory of pig adiponectin, has the nucleotide sequence shown in SEQ ID NO:5 and the SEQ ID NO:6:

Upstream primer P3:

5′GTCCTTAGGGCCCCATGGATCATCATCATCATCATCATGCCTATGTCT ACCG3′；

Downstream primer P4:

5′TGGAGCTCGTCATTCAATGTTGTG3′。

The present invention provides the recombination gAd in the spherical territory of a kind of pig adiponectin, has the nucleotide sequence shown in SEQ ID NO:1, gAd albumen shown in its coding SEQ ID NO:2.

A kind of lactococcus lactis ssp prokaryotic expression carrier of the gAd of containing gene is provided, has the nucleotide sequence shown in the SEQ ID NO:7.

The lactococcus lactis ssp that contains the recombinant prokaryotic expression vector conversion with nucleotide sequence shown in the SEQ ID NO:1 is provided.

The present invention provides the expression method of a kind of pig adiponectin globular domain albumen gAd gene and proteins encoded thereof simultaneously, it is characterized in that may further comprise the steps:

(1) obtains the Ad gene according to pork fat total tissue RNA clone;

(2) adopt primer P3 and P4, from the said Ad gene of step (1), clone the gAd gene, and introduce at the upper reaches of gAd gene through the pcr amplification method NcoI restriction enzyme site and 6 Histidines, introduce in downstream SacThe I restriction enzyme site prepares the gAd gene fragment;

(3) the said gAd gene fragment clone of step (2) is obtained recombinant plasmid to cloning host intestinal bacteria MC1061, through recombinant plasmid identify and amplification after, with this plasmid electric shock transform expressive host-lactococcus lactis ssp ( Lactococcus lactis) NZ9000;

(4) induce through Nisin, screening can efficiently express the strain of the proteic modification type of gAd lactococcus lactis ssp.

The said pcr amplification reaction condition of step (2) is: 94 ℃ of 5min, 94 ℃ of 40s, 54 ℃ of 30s, 72 ℃ of 30s, totally 30 circulations, last 72 ℃ of 7min.

Said 6 His are CATCATCATCATCATCAT.

The present invention is with pig adiponectin globular domain (globular Adiponectin; GAd) sequence is the basis; Add six His labels through PCR at 5 ' end of gAd gene; And with this gene fragment clone in cloning host intestinal bacteria MC1061, through recombinant plasmid identify and amplification after, with this plasmid electric shock transform expressive host-lactococcus lactis ssp ( Lactococcus lactis) NZ9000.Induce through Nisin, screening can efficiently express the strain of the proteic modification type of gAd lactococcus lactis ssp, and the antiserum(antisera) of preparation specific anti gAd detects adiponectin albumen through Western blotting again, confirms that the gAd albumen of vivoexpression has identical immunogenicity.For preparing a kind of lactobacillus micro-ecological preparation that is rich in pig adiponectin globular domain, lay the foundation through a recombination lactic acid lactococcus spp NZ9000 expression adiponectin adjusting pig metabolism of fat and fatty deposits.

Sum up, the present invention has following beneficial effect:

The present invention adopts lactococcus lactis ssp as expressive host, the safety of successful use lactococcus lactis ssp, probiotic bacterium function, and expressed proteins need not purifying; Direct feeding animals; Can bring into play on the one hand the effect of the probiotics of milk-acid bacteria, regulate and stable micro ecology of gastrointestinal tract environmental functional, suppress or kill pathogenic bacterium common in the gi tract; Reduce diarrhoea, can regulate the non-specific immune function and the animal intestinal microecological balance of animal gastrointestinal tract; Lactococcus lactis ssp provided by the invention on the other hand carries the gAd gene, and the gAd albumen of encoding has safety and improves lean ratio, reduces the characteristics of fatty deposits, and tool need not the proteic advantage of separation and purification, can be prepared as and regulate the metabolic probiotics of pork fat.

Specifically, the present invention has the marked improvement property of three aspects:

(1) recombinant lactic acid bacteria probiotics provided by the invention can improve the intestinal microecology balance of pig, can directly be searched for food by animal as the fodder additives of pig;

(2) pig of different varieties, its fatty deposits capacity variance is very big, particularly the local excellent strain of China; Like blue pool pig, its meat and mouthfeel are good, but fatty deposits is high more a lot of than bacon hogs; The present invention can be applicable to relevant research and development product, and the pig adiponectin globular domain that it contains is from Animal nutrition and the metabolism of animal physiological angular adjustment pork fat; Improve the lean ratio of said article boar, reduce fatty deposits, thereby improve the culturing economic benefit of the local good pig kind of China;

(3) through application of the present invention, regulate a pig metabolism of fat, improve lean ratio; Safe and reliable, and easy to use, reduce production costs; Can reach the result of use of forbidden drugs such as " NAB-365Cls "; But overcome the hazardness of forbidden drugs such as " NAB-365Cls ", substitute products and technical support are provided, improved the security of meat-based food for fundamentally stopping " NAB-365Cl ".

Description of drawings

Fig. 1 recombinant expression vector pNZ8048-gAd warp NcoI, SacThe I double digestion is identified figure;

Fig. 2 is at the Blast of GenBank comparison figure;

The abduction delivering of Fig. 3 gAd gene of the present invention and purifying contain the proteic SDS-PAGE of gAd and analyze;

The proteic Western Blotting of Fig. 4 gAd of the present invention analysis;

Schema is cut and made up to the enzyme of Fig. 5 recombinant expression vector pNZ8048-gAd;

Fig. 6 gAd albumen is to the influence of mice serum glucose (PGL);

Fig. 7 gAd albumen is to the influence of blue pool porcine blood serum glucose (PGL);

Fig. 8 gAd albumen is to the influence of blue pool porcine blood serum free fatty acids (FFA);

Fig. 9 gAd albumen is to the influence of blue pool porcine blood serum triglyceride level (PTG);

The microscopy picture of Figure 10 recombination lactic acid lactococcus spp NZ9000-gAd bacterial strain.

Embodiment

Below in conjunction with accompanying drawing and specific embodiment further explain the present invention.The material that is adopted among the following embodiment, E.coliMC1061 is available from Zhejiang University, ( E.coliThe MC1061 associated description also can be referring to " the food grade lactococcus lactis ssp efficiently expresses PD and the research of animal efficacy experiment ", Chen Xing, the Capital University of Medical Sciences, 2006.); Restriction enzyme NcoI, SacI, T4 dna ligase are all available from precious biological (Dalian) company, lactococcus lactis ssp carrier pNZ8048 and lactococcus lactis ssp Lactococcus lactisNZ9000 ( L.LactisNZ9000) buy institute from Dutch NIZO; GM ₁₇Substratum is at the M available from Hai Bo company ₁₇Adding mass volume ratio in the substratum is the solution of 2.5% glucose; Measure serum glucose, serum triglyceride test kit available from Puli's Lay company, free serum lipid acid test kit builds up company available from Nanjing, and other materials, reagent etc. like no specified otherwise, are the reagent and the material that can obtain from commercial sources; Employed TP is ordinary method like no specified otherwise.

The modification of 1 pair of gAd gene of embodiment

Present embodiment adopts TAKARA total RNA extraction reagent box to extract blue pool pork fat total tissue RNA, with the apm 1 gene of GenBank issue (gene accession number: AY135647) be basis, clone through the PCR method and obtain adiponectin Ad gene, design primer sequence and be:

Upstream primer P1:5 ' GGCTCTGATTCCACACCTG3 ';

Downstream primer P2:5 ' CTCCTAATGACACTGAAGACCTC3 '.

Reaction conditions is: 94 ℃ of 3min, 94 ℃ of 40s, 49 ℃ of 30s, 72 ℃ of 40s, 30 circulations, last 72 ℃ of 7min.

The gene of pig adiponectin globular domain part is chosen with this sequences Design primer amplification gAd in the correct back of order-checking, 414 bases of intercepting globular domain, and introduce at the upper reaches NcoI restriction enzyme site and 6 Histidines, introduce in downstream SacThe I restriction enzyme site.The design of primers sequence is following:

Upstream primer P3:

5′GTCCTTAGGGCCCCATGGATCATCATCATCATCATCATGCCTATGTCT ACCG3′；

Downstream primer P4:

5′TGGAGCTCGTCATTCAATGTTGTG3′；

Reaction conditions is: 94 ℃ of 5min, 94 ℃ of 40s, 54 ℃ of 30s, 72 ℃ of 30s, totally 30 circulations, last 72 ℃ of 7min.

Wherein said 6 Histidines are the CATCATCATCATCATCAT in the upstream primer.

The gAd gene is connected to pMD18-T (buying from TAKARA company), and method of attachment is converted into intestinal bacteria Top10 (commercial) with reference to TAKARA Company products specification sheets, and method for transformation obtains pMD18-T-gAd with reference to Tiangen Company products specification sheets.

The structure of embodiment 2 pNZ8048-gAd prokaryotic expression plasmids

The gAd gene is inserted in the lactococcus lactis ssp expression vector through restriction enzyme and ligase enzyme.

Concrete operations are:

NcoI with SacI is double digestion pMD18-T-gAd and pNZ8048 prokaryotic expression plasmid respectively, and gel reclaims.16 ℃ of connections are spent the night, and are converted into the cloning host intestinal bacteria with the conventional chemical conversion method again E.coliMC1061,10 positive bacterium colonies are chosen in the chlorampenicol resistant screening, carry out pcr amplification respectively, use primer P3, P4 and previous reaction program and condition.Carry out recombinant plasmid again NcoI, SacThe I double digestion is identified, consults accompanying drawing 1, in the accompanying drawing 1, and M representation DNA marker, 1 and 2 represent pNZ8048-gAd NcoI with SacThe I enzyme is cut product, the pNZ8048-gAd plasmid that 3 representatives are not cut through enzyme.

The band of the about 443bp position shown in the accompanying drawing 1 promptly is the pNZ8048-gAd warp NcoI with SacThe product of I double digestion.Accord with expectation result's strain number is MC1061-gAd, is sent to Shanghai Ying Jun Bioisystech Co., Ltd and checks order, and the result is in the Blast of GenBank comparison, in full accord with report, and comparison figure sees shown in the accompanying drawing 2.

Embodiment 3 contains the preparation of the recombinant microorganism of gAd Prokaryotic Expression carrier

With identifying that the correct gAd expression plasmid that carries shocks by electricity, parameter is made as 2.5kV, 25aF, and 400 Ω are converted into L.LactisAmong the NZ9000.Picking list colony inoculation is to the GM that contains paraxin (5 μ g/ml) ₁₇In the liquid nutrient medium, leave standstill overnight cultures under 30 ℃.Next day, choose 10 positive bacterium colonies in the single bacterium colony that grows in this substratum, carry out pcr amplification respectively, use primer P3, P4 and previous reaction program and condition.Carry out recombinant plasmid again NcoI, SacThe I double digestion identifies, the dna fragmentation size that obtains and embodiment 2 obtain recombination lactic acid lactococcus spp NZ9000-gAd when consistent.The microscopy picture of said bacterial strain is asked for an interview accompanying drawing 10 .

The abduction delivering of embodiment 4 gAd genes and the purifying of expression product

With the positive bacterium colony of the reorganization NZ9000-gAd that obtains among the embodiment 3, be inoculated into the GM that contains paraxin (5 μ g/ml) ₁₇In the liquid nutrient medium, the inoculum size by 2% (volume percent) behind the 16h is inoculated into the GM that contains paraxin (5 μ g/ml) ₁₇In the liquid nutrient medium; Cultivate that to add Nisin (nisin) solution to its final concentration behind the 2.5h be 10ng/ml for 30 ℃, collect thalline after inducing 5h under 30 ℃, 13% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) is analyzed; Confirmation has the proteic expression of gAd, adopts Ni simultaneously ²⁺The method purifying protein of-NTA post affinity chromatography (buying from invitrogen company) is collected elutriant and is carried out the SDS-PAGE analysis, and the result consults accompanying drawing 3; M represents albumen marker; Thalline is not induced in 1 representative, and on behalf of 10ng/mL Nisin, 2 induce the back thalline, and 3 represent the gAd albumen behind the purifying; NZ9000-gAd shown in the accompanying drawing 3 after inducing has band clearly at about 17kD place, and simultaneously visible this protein purification effect is better.

The proteic sero-fast preparation of embodiment 5 gAd

Select 9 ages in week 4 of male BALB/c mouses.Process vaccine after the gAd albumen of making purification process mixed as antigen and equal-volume freund's adjuvant, take the mode of abdominal cavity multi-point injection to carry out immunity.The antiserum(antisera) that obtains after the immunity is used for Western blotting and analyzes.

The proteic Western blotting of embodiment 6 gAd analyzes

Adopt the inventive method expressed proteins after SDS-PAGE separates; Be transferred on the nitrocellulose filter; Western blotting measures the target protein immunoreation, and first antibody is the anti-gAd antibody in mouse source of mouse source Anti-His antibody and embodiment 5 preparations, and SA is the sheep anti-mouse igg of horseradish peroxidase-labeled; Experimental result is consulted accompanying drawing 4; M represents albumen marker, and 1 to represent first antibody be the proteic Western blotting of gAd of mouse source Anti-His antibody, and 2 to represent first antibody be the proteic Western blotting of gAd of the anti-gAd antibody in mouse source of embodiment 5 preparations; NZ9000-gAd shown in the accompanying drawing 4 after inducing has band clearly at about 17kD place.

Embodiment 7 gAd albumen are to the influence of mice serum glucose

Select 9 ages in week 8 of female ICR mouse, respectively 4 of experimental group and control groups.The gAd albumen of purifying is handled through 0.9% normal saline dialysis more.Fasting 3h before the mouse experiment irritates stomach high glucose and high fat feed (giving by body weight 1%) afterwards.The high glucose and high fat feed formulation: 50% glucose solution and peanut oil volume ratio are 1:1.

Pick up counting after irritating stomach,

0min, 4 control group mice tail vein injection saline solution (dosage is 2 mL/kg),

4 experimental mice tail vein injections contain the proteic physiological salt soln of gAd (dosage is 50 mg/kg, calculates with protein content);

45min, the duplicate injection step.

105min, the duplicate injection step.

Each mouse is all got blood before irritating stomach, after irritating stomach, begins, and every 1h gets blood once, totally 4 times, measures serum glucose (PGL) content, the explanation of concrete operations reference reagent box.

The result sees accompanying drawing 6, and X-coordinate is the time in the accompanying drawing 6, unit be hour (Time, h), ordinate zou is serum glucose level (PGL), unit is mmol/L.With control group relatively, experimental mice PGL begins obvious reduction at 2h, behind 3h, reduces more obviously, the difference of 2h and 3h has remarkable meaning (P < 0.05), this shows that gAd albumen has the activity of accelerating carbohydrate metabolism, reduction PGL.

Embodiment 8 gAd albumen are to the influence of blue pool porcine blood serum glucose, free serum lipid acid, serum triglyceride

Choose 50 ages in days, 6 of the blue pool pigs of the about 15kg of body weight, each 3 of experimental group and control groups.The gAd albumen of purifying is handled through 0.9% normal saline dialysis more.Each blue pool pig is irritated stomach 50% glucose solution 40mL.

Pick up counting after irritating stomach,

0min, control group intravenous injection physiological salt soln (dosage is 2 mL/ heads),

The experimental group intravenous injection contains the proteic physiological salt soln of gAd (dosage is 500 mg/ heads, calculates with protein content);

45min, the duplicate injection step.

105min, the duplicate injection step.

Each blue pool pig is all got blood before irritating stomach, after irritating stomach, begins, and every 1h gets blood once, totally 4 times, measures serum glucose (PGL), free serum lipid acid (FFA), serum triglyceride (PTG) content, the explanation of concrete operations reference reagent box.Experimental result is seen accompanying drawing 7, accompanying drawing 8 and accompanying drawing 9.

Shown in accompanying drawing 7; Compare with control group; The blue pool pig PGL of experimental group begins obvious reduction at 2h; Two groups of difference has extremely significantly meaning (P < 0.01) when 2h, and two groups of difference has remarkable meaning (P < 0.05) when 3h, and this shows that gAd albumen has the activity of accelerating the pig blood sugar metabolism of the blue pool, reducing PGL.

Shown in accompanying drawing 8, with control group relatively, the blue pool pig FFA of experimental group begins obvious reduction at 2h, two groups of difference has remarkable meaning (P < 0.05) when 2h and 3h, this shows that gAd albumen has the activity of the blue pool pig FFA of reduction.

Shown in accompanying drawing 9, with control group relatively, the blue pool pig PTG of experimental group begins to reduce at 2h, two groups of difference has remarkable meaning (P < 0.05) when 3h, this shows that gAd albumen has the activity that reduces blue pool pig PTG.

SEQUENCE LISTING

< 110>Dongguan City Livestock Science Institute, Hu Wenfeng

< 120>expression and the application of pig adiponectin globular domain albumen gAd gene and proteins encoded thereof

<130>

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 438

<212> DNA

< 213>the recombination gAd sequence in the spherical territory of pig adiponectin

<220>

<221> CDS

<222> (1)..(438)

<400> 1

atg gat cat cat cat cat cat cat gcc tat gtc tac cgt tca gca ttc 48

Met Asp His His His His His His Ala Tyr Val Tyr Arg Ser Ala Phe

1 5 10 15

agt gtg ggc ctg gag act cgg gtc act gtc cct aac atg ccc att cgc 96

Ser Val Gly Leu Glu Thr Arg Val Thr Val Pro Asn Met Pro Ile Arg

20 25 30

ttt acc aag atc ttc tac aat cag caa aac cac tat gat gtc acc act 144

Phe Thr Lys Ile Phe Tyr Asn Gln Gln Asn His Tyr Asp Val Thr Thr

35 40 45

ggc aaa ttc cac tgc aac att cct ggg ctg tac tac ttc tcc ttc cac 192

Gly Lys Phe His Cys Asn Ile Pro Gly Leu Tyr Tyr Phe Ser Phe His

50 55 60

atc acg gtc tac ttg aag gat gtg aag gtc agc ctc tac aag aag gac 240

Ile Thr Val Tyr Leu Lys Asp Val Lys Val Ser Leu Tyr Lys Lys Asp

65 70 75 80

aag gct gta ctc ttc acc tac gac cag tac cag gac aag aat gtg gac 288

Lys Ala Val Leu Phe Thr Tyr Asp Gln Tyr Gln Asp Lys Asn Val Asp

85 90 95

cag gcc tct ggc tct gtg ctc ctc tat ctg gag aag ggg gac caa gtc 336

Gln Ala Ser Gly Ser Val Leu Leu Tyr Leu Glu Lys Gly Asp Gln Val

100 105 110

tgg ctc cag gca tac ggg gat gaa gag aat aat ggg gtc tat gct gac 384

Trp Leu Gln Ala Tyr Gly Asp Glu Glu Asn Asn Gly Val Tyr Ala Asp

115 120 125

aat gtc aat gac tcc atc ttc aca ggc ttc ctt ctc tac cac aac att 432

Asn Val Asn Asp Ser Ile Phe Thr Gly Phe Leu Leu Tyr His Asn Ile

130 135 140

gaa tga 438

Glu

145

<210> 2

<211> 145

<212> PRT

< 213>the recombination gAd sequence in the spherical territory of pig adiponectin

<400> 2

Met Asp His His His His His His Ala Tyr Val Tyr Arg Ser Ala Phe

1 5 10 15

Ser Val Gly Leu Glu Thr Arg Val Thr Val Pro Asn Met Pro Ile Arg

20 25 30

Phe Thr Lys Ile Phe Tyr Asn Gln Gln Asn His Tyr Asp Val Thr Thr

35 40 45

Gly Lys Phe His Cys Asn Ile Pro Gly Leu Tyr Tyr Phe Ser Phe His

50 55 60

Ile Thr Val Tyr Leu Lys Asp Val Lys Val Ser Leu Tyr Lys Lys Asp

65 70 75 80

Lys Ala Val Leu Phe Thr Tyr Asp Gln Tyr Gln Asp Lys Asn Val Asp

85 90 95

Gln Ala Ser Gly Ser Val Leu Leu Tyr Leu Glu Lys Gly Asp Gln Val

100 105 110

Trp Leu Gln Ala Tyr Gly Asp Glu Glu Asn Asn Gly Val Tyr Ala Asp

115 120 125

Asn Val Asn Asp Ser Ile Phe Thr Gly Phe Leu Leu Tyr His Asn Ile

130 135 140

Glu

145

<210> 3

<211> 19

<212> DNA

< 213>upstream primer P1 sequence

<400> 3

ggctctgatt ccacacctg 19

<210> 4

<211> 23

<212> DNA

< 213>downstream primer P2 sequence

<400> 4

ctcctaatga cactgaagac ctc 23

<210> 5

<211> 52

<212> DNA

< 213>upstream primer P3 sequence

<400> 5

gtccttaggg ccccatggat catcatcatc atcatcatgc ctatgtctac cg 52

<210> 6

<211> 24

<212> DNA

< 213>downstream primer P4 sequence

<400> 6

tggagctcgt cattcaatgt tgtg 24

<210> 7

<211> 3751

<212> DNA

< 213>the lactococcus lactis ssp prokaryotic expression carrier of recombination gAd

<400> 7

agatctagtc ttataactat actgacaata gaaacattaa caaatctaaa acagtcttaa 60

ttctatcttg agaaagtatt ggtaataata ttattgtcga taacgcgagc ataataaacg 120

gctctgatta aattctgaag tttgttagat acaatgattt cgttcgaagg aactacaaaa 180

taaattataa ggaggcactc accatggatc atcatcatca tcatcatgcc tatgtctacc 240

gttcagcatt cagtgtgggc ctggagactc gggtcactgt ccctaacatg cccattcgct 300

ttaccaagat cttctacaat cagcaaaacc actatgatgt caccactggc aaattccact 360

gcaacattcc tgggctgtac tacttctcct tccacatcac ggtctacttg aaggatgtga 420

aggtcagcct ctacaagaag gacaaggctg tactcttcac ctacgaccag taccaggaca 480

agaatgtgga ccaggcctct ggctctgtgc tcctctatct ggagaagggg gaccaagtct 540

ggctccaggc atacggggat gaagagaata atggggtcta tgctgacaat gtcaatgact 600

ccatcttcac aggcttcctt ctctaccaca acattgaatg acgagctcaa gctttctttg 660

aaccaaaatt agaaaaccaa ggcttgaaac gttcaattga aatggcaatt aaacaaatta 720

cagcacgtgt tgctttgatt gatagccaaa aagcagcagt tgataaagca attactgata 780

ttgctgaaaa attgtaattt ataaataaaa atcacctttt agaggtggtt tttttattta 840

taaattattc gtttgatttc gctttcgata gaacaatcaa agcgagaata aggaagataa 900

atcccataag ggcgggagca gaatgtccga gactaatgta aatttgtcca ccaattaaag 960

gaccgataac gcgagcttct cgagtgcata ttttcggcaa tcttctcaat gagatgctct 1020

tcagcatgtt caatgatgtc gattttttat taaaacgtct caaaatcgtt tctgagacgt 1080

tttagcgttt atttcgttta gttatcggca taatcgttaa aacaggcgtt atcgtagcgt 1140

aaaagccctt gagcgtagcg tgctttgcag cgaagatgtt gtctgttaga ttatgaaagc 1200

cgatgactga atgaaataat aagcgcagcg tccttctatt tcggttggag gaggctcaag 1260

ggagtttgag ggaatgaaat tccctcatgg gtttgatttt aaaaattgct tgcaattttg 1320

ccgagcggta gcgctggaaa atttttgaaa aaaatttgga atttggaaaa aaatgggggg 1380

aaaggaagcg aattttgctt ccgtactacg accccccatt aagtgccgag tgccaatttt 1440

tgtgccaaaa acgctctatc ccaactggct caagggtttg aggggttttt caatcgccaa 1500

cgaatcgcca acgttttcgc caacgttttt tataaatcta tatttaagta gctttattgt 1560

tgtttttatg attacaaagt gatacactaa ttttataaaa ttatttgatt ggagtttttt 1620

aaatggtgat ttcagaatcg aaaaaaagag ttatgatttc tctgacaaaa gagcaagata 1680

aaaaattaac agatatggcg aaacaaaaag gtttttcaaa atctgcggtt gcggcgttag 1740

ctatagaaga atatgcaaga aaggaatcag aacaaaaaaa ataagcgaaa gctcgcgttt 1800

ttagaaggat acgagttttc gctacttgtt tttgataagg taatatatca tggctattaa 1860

aaatactaaa gctagaaatt ttggattttt attatatcct gactcaattc ctaatgattg 1920

gaaagaaaaa ttagagagtt tgggcgtatc tatggctgtc agtcctttac acgatatgga 1980

cgaaaaaaaa gataaagata catggaatag tagtgatgtt atacgaaatg gaaagcacta 2040

taaaaaacca cactatcacg ttatatatat tgcacgaaat cctgtaacaa tagaaagcgt 2100

taggaacaag attaagcgaa aattggggaa tagttcagtt gctcatgttg agatacttga 2160

ttatatcaaa ggttcatatg aatatttgac tcatgaatca aaggacgcta ttgctaagaa 2220

taaacatata tacgacaaaa aagatatttt gaacattaat gattttgata ttgaccgcta 2280

tataacactt gatgaaagcc aaaaaagaga attgaagaat ttacttttag atatagtgga 2340

tgactataat ttggtaaata caaaagattt aatggctttt attcgcctta ggggagcgga 2400

gtttggaatt ttaaatacga atgatgtaaa agatattgtt tcaacaaact ctagcgcctt 2460

tagattatgg tttgagggca attatcagtg tggatataga gcaagttatg caaaggttct 2520

tgatgctgaa acgggggaaa taaaatgaca aacaaagaaa aagagttatt tgctgaaaat 2580

gaggaattaa aaaaagaaat taaggactta aaagagcgta ttgaaagata cagagaaatg 2640

gaagttgaat taagtacaac aatagattta ttgagaggag ggattattga ataaataaaa 2700

gcccccctga cgaaagtcga cggcaatagt tacccttatt atcaagataa gaaagaaaag 2760

gatttttcgc tacgctcaaa tcctttaaaa aaacacaaaa gaccacattt tttaatgtgg 2820

tctttattct tcaactaaag cacccattag ttcaacaaac gaaaattgga taaagtggga 2880

tatttttaaa atatatattt atgttacagt aatattgact tttaaaaaag gattgattct 2940

aatgaagaaa gcagacaagt aagcctccta aattcacttt agataaaaat ttaggaggca 3000

tatcaaatga actttaataa aattgattta gacaattgga agagaaaaga gatatttaat 3060

cattatttga accaacaaac gacttttagt ataaccacag aaattgatat tagtgtttta 3120

taccgaaaca taaaacaaga aggatataaa ttttaccctg catttatttt cttagtgaca 3180

agggtgataa actcaaatac agcttttaga actggttaca atagcgacgg agagttaggt 3240

tattgggata agttagagcc actttataca atttttgatg gtgtatctaa aacattctct 3300

ggtatttgga ctcctgtaaa gaatgacttc aaagagtttt atgatttata cctttctgat 3360

gtagagaaat ataatggttc ggggaaattg tttcccaaaa cacctatacc tgaaaatgct 3420

ttttctcttt ctattattcc ttggacttca tttactgggt ttaacttaaa tatcaataat 3480

aatagtaatt accttctacc cattattaca gcaggaaaat tcattaataa aggtaattca 3540

atatatttac cgctatcttt acaggtacat cattctgttt gtgatggtta tcatgcagga 3600

ttgtttatga actctattca ggaattgtca gataggccta atgactggct tttataatat 3660

gagataatgc cgactgtact ttttacagtc ggttttctaa tgtcactaac ctgccccgtt 3720

agttgaagaa ggtttttata ttacagctcc a 3751

Claims (6)

1. the primer of the recombination in one group of spherical territory of pig adiponectin that is used to increase is characterized in that comprising upstream primer and downstream primer, and its nucleotide sequence is respectively shown in SEQ ID NO:5 and SEQ ID NO:6.

2. application rights requires the recombination in the spherical territory of pig adiponectin that 1 said primer amplification obtains, and its nucleotide sequence is shown in SEQ ID NO:1.

3. the recombination encoded protein in the spherical territory of the said pig adiponectin of claim 2, its aminoacid sequence is shown in SEQ ID NO:2.

4. the lactococcus lactis ssp prokaryotic expression carrier of the recombination in the spherical territory of the said pig adiponectin of claim 2, its nucleotide sequence is shown in SEQ ID NO:7.

5. the expression method of the recombination encoded protein modification type lactococcus lactis ssp strain in the spherical territory of pig adiponectin is characterized in that may further comprise the steps:

(1) obtains the Ad gene according to pork fat total tissue RNA clone;

(2) adopt upstream primer and and downstream primer, from the said Ad gene of step (1), clone the recombination in the spherical territory of pig adiponectin through the pcr amplification method, and introduce at the upper reaches of the recombination in the spherical territory of pig adiponectin NcoThe encoding sequence of I restriction enzyme site and 6 Histidines, introduce in downstream SacThe I restriction enzyme site prepares the recombination fragment in the spherical territory of pig adiponectin;

Said upstream primer and downstream primer, its nucleotide sequence are respectively shown in SEQ ID NO:5 and SEQ ID NO:6;

(3) obtain recombinant plasmid among recombination fragment cloning to the cloning host intestinal bacteria MC1061 with the spherical territory of the said pig adiponectin of step (2), through recombinant plasmid identify and amplification after, with this plasmid electric shock transform expressive host-lactococcus lactis ssp ( Lactococcus lactis) NZ9000;

(4) induce through Nisin, screening can efficiently express the modification type lactococcus lactis ssp strain of the recombination encoded protein in the spherical territory of pig adiponectin.

6. the lactococcal strain that transforms of the said lactococcus lactis ssp prokaryotic expression carrier of claim 4.

Images