CN103555678B - The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified - Google Patents

The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified Download PDF

Info

Publication number
CN103555678B
CN103555678B CN201310326978.2A CN201310326978A CN103555678B CN 103555678 B CN103555678 B CN 103555678B CN 201310326978 A CN201310326978 A CN 201310326978A CN 103555678 B CN103555678 B CN 103555678B
Authority
CN
China
Prior art keywords
aav
seq
sequence
albumen
capsid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CN201310326978.2A
Other languages
Chinese (zh)
Other versions
CN103555678A (en
Inventor
G·高
J·M·威尔森
M·阿尔维拉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27502639&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CN103555678(B) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Priority claimed from CN028270592A external-priority patent/CN101426935B/en
Publication of CN103555678A publication Critical patent/CN103555678A/en
Application granted granted Critical
Publication of CN103555678B publication Critical patent/CN103555678B/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/01—DNA viruses
    • C07K14/015—Parvoviridae, e.g. feline panleukopenia virus, human parvovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A61K38/4846—Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/864—Parvoviral vectors, e.g. parvovirus, densovirus
    • C12N15/8645—Adeno-associated virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21022—Coagulation factor IXa (3.4.21.22)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151—Methods of production or purification of viral material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151—Methods of production or purification of viral material
    • C12N2750/14152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14161—Methods of inactivation or attenuation
    • C12N2750/14162—Methods of inactivation or attenuation by genetic engineering
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171—Demonstrated in vivo effect
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/90—Vector systems having a special element relevant for transcription from vertebrates avian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Abstract

The invention provides the detection from the DNA of tissue or cell derived sample and the method for classification AAV sequences.Present invention also offers the AAV sequences identified with this method and the carrier with these sequence constructs.

Description

Detection and/or identification adeno-associated virus (AAV) sequence and separation are identified new The method of sequence
The application is the divisional application of PCT international applications No. 02827059.2 application for a patent for invention of National Phase in China.It is former The Application No. PCT/US02/33629 of PCT international applications, international filing date are on November 12nd, 2002.
Technical field
The invention provides the detection from the DNA of tissue or cell derived sample and the method for classification AAV sequences.The present invention Additionally provide the AAV sequences identified with this method and the carrier with these sequence constructs.
Background technology
Adeno-associated virus (AVV) is a member of parvovirus family, is a small nonencapsulated icosahedron, its Genome is 4.7kb-6kb single-stranded linear DNA molecule.Dependovirus is classified as when AVV starts, because this virus is conduct Pollutant in the adenopathy strain of purifying and be found.AVV life cycle includes incubation period and infection period, in incubation period Interior, AVV genomes are incorporated into host chromosome in a manner of locus specificity after infection, in infection period, along with gland The infection of virus or herpes simplex virus, the viral genome of integration are then recovered, replicated and be packaged into infective disease Malicious particle.AVV because of it there is non-pathogenic, extensive host range to include the spies such as Unseparated Cell and site-specific integration Levy and turn into the gene transfer vehicle of a very attractive.
It has recently been demonstrated that AVV carriers are a preferable gene therapy tools.Up to the present, there are 6 not The AVV of homologous serotype is separated and is accredited in vivo from people or non-human primate (NHP).Wherein, the type of human serum 2 is first Gene transfer vehicle is first developed to, has been widely used in carrying out gene transfer examination in different target tissues and animal model Test.Clinical test using some human diseases of the vehicle treatment in AVV2 sources is also in process, including capsule fiber Change and hemophilia B.We are desirable to the carrier in the AAV sources for gene transfer.
The content of the invention
One aspect of the present invention is related to the latent and integration spy according to the AVV in the case where lacking helper virus coinfection Property, using bioinformatic analysis, PCR amplifications and clone technology from various people sources and non-human primate (NHP) tissue Cell DNA in detection and identification AVV sequences new method.
Another aspect of the present invention relates to the use of the separation side of the AVV sequences detected by the above method of the present invention Method.Present invention additionally comprises the method for preparing carrier using these new AVV serotypes, gene order only according to capsid and The structure can of rep/cap gene junctions carries out the research of serology and gene transfer with these carriers.
Another aspect of the present invention relates to the use of reagent described in the invention, as universal primer it is right/probe and fixed Measure the research that real-time PCR carries out serology, epidemiology, bio distribution and communication mode.
Another aspect of the present invention relates to the use of RACE and other molecular engineerings and divided from the cell DNA of separate sources From the method for complete and infectious the genome of new AVV serotypes.
The invention further relates to the helper adenovirus using separate sources to recover new AVV serum from people or NHP cell lines The method of type genome.
Another aspect of the present invention is related to new AVV serotypes, the carrier containing the serotype and utilizes the serotype Method.
From the following detailed description to invention it should be readily understood that the aspects of the invention and other in terms of.
Brief description of the drawings
Fig. 1 describes at least to encode the comparison of the nucleotide sequence of AAV cap albumen.These figures list comprising ITR, The full length sequence of the following new A AV serotypes of rep region and capsid district：[the SEQ ID NO of new A AV serotypes 7:1], and with AAV1 [the SEQ IN NO of preceding report:6], AAV2 [SEQ ID NO:7] and AAV3 [SEQ ID NO:8].New A AV serotypes AAV8[SEQ ID NO:4] and AAV9 [SEQ ID NO:5] be the application submitted jointly theme.This is involved in comparing Other new clones of the invention include 42-2 [SEQ ID NO:9], 42-8 [SEQ ID NO:27], 42-15 [SEQ ID NO:28], 42-5b [SEQ ID NO:29], 42-1b [SEQ ID NO:30]；42-13[SEQ ID NO:31], 42-3a [SEQ ID NO:32], 42-4 [SEQ ID NO:33], 42-5a [SEQ ID NO:34], 42-10 [SEQ ID NO:35], 42-3b [SEQ ID NO:36], 42-11 [SEQ ID NO:37], 42-6b [SEQ ID NO:38], 43-1 [SEQ ID NO:39], 43- 5[SEQ ID NO:40], 43-12 [SEQ ID NO:41], 43-20 [SEQ ID NO:42], 43-21 [SEQ ID NO:43], 43-23[SEQ ID NO:44], 43-25 [SEQ ID NO:45], 44.1 [SEQ ID NO:47], 44.5 [SEQ ID NO: 47], 223.10 [SEQ ID NO:48], 223.2 [SEQ ID NO:49], 223.4 [SEQ ID NO:50], 223.5 [SEQ ID NO:51], 223.6 [SEQ ID NO:52], 223.7 [SEQ ID NO:53], A3.4 [SEQ ID NO:54], A3.5 [SEQ ID NO:55], A3.7 [SEQ ID NO:56], A3.3 [SEQ ID NO:57], 42.12 [SEQ ID NO:58], 44.2 [SEQ ID NO:59].AAV10[SEQ ID NO:117], AAV11 [SEQ ID NO:118] and AAV12 [SEQ ID NO:119] feature Regional sequence is also listed in figure.Key signature in AAV genome structures is also identified in figure.The space stain of fracture Represent.AAV1[SEQ ID NO:6] representation same with the sequence with reporting in the past 3'ITR.TRS represents end and entered Change site.It should be noted that AAV7 is the unique AAV by the use of GTG as VP3 initiation codons reported.
[the SEQ ID NO of AAV serotypes 1 reported in the past are shown in Fig. 2:64], AAV2 [SEQ ID NO:70], AAV3[SEQ ID NO:71], AAV4 [SEQ ID NO:63], AAV5 [SEQ ID NO:, and AAV6 [SEQ ID NO 114]: 65] and the present invention new A AV sequences vp1 capsid proteins amino acid sequence comparison, new A AV sequences of the invention Including:C1[SEQ ID NO:60], C2 [SEQ ID NO:61], C5 [SEQ ID NO:62], A3-3 [SEQ ID NO:66], A3-7[SEQ ID NO:67], A3-4 [SEQ ID NO:68], A3-5 [SEQ ID NO:69], 3.3b [SEQ ID NO:62], 223.4[SEQ ID NO:73], 223-5 [SEQ ID NO:74], 223-10 [SEQ ID NO:75], 223-2 [SEQ ID NO: 76], 223-7 [SEQ ID NO:77], 223-6 [SEQ ID NO:78], 44-1 [SEQ ID NO:79], 44-5 [SEQ ID NO:80], 44-2 [SEQ ID NO:81], 42-15 [SEQ ID NO:84], 42-8 [SEQ ID NO:85], 42-13 [SEQ ID NO:86], 42-3A [SEQ ID NO:87], 42-4 [SEQ ID NO:88], 42-5A [SEQ ID NO:89], 42-1B [SEQ ID NO:90], 42-5B [SEQ ID NO:91], 43-1 [SEQ ID NO:92], 43-12 [SEQ ID NO:93], 43-5 [SEQ ID NO:94], 43-21 [SEQ ID NO:96], 43-25 [SEQ ID NO:97], 43-20 [SEQ ID NO:99], 24.1 [SEQ ID NO:101], 42.2 [SEQ ID NO:102], 7.2 [SEQ ID NO:103], 27.3 [SEQ ID NO:104], 16.3[SEQ ID NO:105], 42.10 [SEQ ID NO:106], 42-3B [SEQ ID NO:107], 42-11 [SEQ ID NO:108], F1 [SEQ ID NO:109], F5 [SEQ ID NO:110], F3 [SEQ ID NO:111], 42-6B [SEQ ID NO:112], 42-12 [SEQ ID NO:113].New serotype AAV8 [SEQ ID NO:95] and AAV9 [SEQ ID NO:100] It is the theme of this patent application submitted jointly.
AAV7rep albumen [SEQ ID NO are shown in Fig. 3:3] amino acid sequence.
Embodiment
In the present invention, inventor is found that a kind of method can lack helper virus using adeno-associated virus (AVV) Have in the case of coinfection and be incorporated into cell DNA through nucleus and reach the ability of latent infection.This method utilizes polymerization Technology based on PCR (PCR) can be from people and non-human primate origin's or other sources tissue DNA Interior detection, identification and/or separation AVV sequences.In addition, this method be further adapted for detecting, identify and/or separate as described below its The virus and non-viral sequence that he integrates.
The invention further relates to the nucleotide sequence that the method using the present invention is identified.One of which adeno-associated virus is one New serotype, herein referred to as serotype 7 (AVV7).Other new adeno-associated virus serotypes involved by this paper include AAV10, AVV11 and AVV12.Other new A VV serotypes identified using the method for the present invention are also included within this specification In.Referring to accompanying drawing and listed sequence, it has been incorporated by reference herein.
The invention further relates to the fragment of these AAV sequences.Wherein especially interesting AAV fragments are cap albumen, including Vp1, vp2, vp3 and hypervariable region, rep albumen, including rep78, rep68, rep52 and rep40, and encode these albumen Sequence.These fragments all can be used in various carrier systems and host cell.This fragment can be used alone, can also It is used in combination with the element of other AAV sequences or fragment or other AAV or non-AAV virus sequences.It is particularly preferred at one In embodiment, carrier contains AAV cap and/or the rep sequences of the present invention.
As described herein, nucleotide sequence is to use any public or business Multiple Sequence Alignment program such as " come what is compared, these programs can be downloaded Clustal W " from the server of internet.In addition, also use Vector NTI Program.The homogeneity of nucleotide sequence can also be calculated using many algorithms known in the art, including on those The sequence in program described by face.In addition, polynucleotide sequence also can use Fasta to be compared, this is the versions of GCG 6.1 In a program.Optimal overlapping region between the sequence that inquired about and the sequence retrieved can be compared simultaneously by Fasta Calculate the percentage of its sequence identity.For example, the percentage of homogeneity can utilize Fasta soft between two nucleotide sequences Part, determined with reference to the default parameters (font size 6, rating matrix is using the NOPAM factors) provided in the versions of GCG 6.1, this Text has been incorporated by reference.Amino acid sequence can also be handled with similar program, such as " Clustal X " programs.In general, The setting of these programs is all acquiescence, but those skilled in the art can also change these settings if necessary.Separately Outside, those skilled in the art can also use other algorithms or computer program, as long as these programs can be such as with reference to algorithm With the homogeneity or comparison nucleotide sequence that sequence is calculated as program.
Term " substantially homologous " or it is " basically identical " be used to refer to when nucleic acid or nucleic acid fragment in a nucleotide sequence fit After inserting or deleting some nucleotides compared with another nucleotide sequence, its nucleotide sequence homology at least accounts for being compared 95% to the 99% of sequence.It must compare its full length sequence, its open reading frame when claiming two sequence homologies or at least contain The appropriate nucleic acid fragment of 15 nucleotides.The example of appropriate nucleic acid fragment is described herein.
Term " substantially homologous " " basically identical " is used to refer in an amino acid fragment when amino acid or its fragment Appropriate to insert or delete after some amino acid compared with another amino acid fragment, its amino acid sequence identity at least accounts for institute 95% to the 99% of comparative sequences.Must compare when claiming two sequence homologies its full length sequence, its protein such as cap albumen, Rep albumen, or the Suitable fragments at least containing 8 amino acid, the preferably fragment containing 15 amino acid.The example of Suitable fragments It is described herein.
Term " highly conserved " refers at least 80% sequence identity, and preferably at least 90% sequence is same Property, the more preferably sequence identity more than 97%.Those skilled in the art can be easily ripe by this area institute The algorithm and computer program known determines the homogeneity of sequence.
Term " Percent sequence identity " " unanimously " is used to refer to work as during nucleotide sequence to compare two sequences together Pair when its nucleotide residue be the same.The length that sequence identity compares can exceed the total length of genome, gene code sequence The total length of row, or the fragment at least about containing 500-5000 nucleotides.But it is also possible to the homogeneity between comparing small fragment, Such as containing about the fragment of 9 nucleotides, generally containing at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 Individual or more nucleotides.Equally, " Percent sequence identity " can be used for determining amino acid sequence, determine full-length proteins The homogeneity of matter or its fragment.Suitable fragment at least about contains 8 amino acid, can also be for up to 700 amino acid.Suitable piece The example of section is also described herein.
AAV sequences and its fragment can be used for preparing rAAV, can also be used as antisense transfer vector, gene therapy vector or vaccine Carrier.The invention further relates to nucleic acid molecules, gene transfer vector and containing the present invention AAV sequences host cell.
As described herein, the carrier of the invention containing AAV capsid proteins of the present invention is especially suitable in utilization AAV serotypes derived vectors and the effect of other viral vectors are eliminated with antibody.The rAAV carriers of the present invention are particularly suitable for The gene therapy that rAAV is injected and repeated again.
These and other embodiments and advantage of the present invention are explained below in much greater detail.Such as this specification and right Described in claim, term " containing " refers to that other portions can also be included with " comprising " and other similar words Point, element, entirety, step etc..It is opposite, term " Consists of " and its similar word refer to not include other parts, Element, entirety, step etc..
I. method of the invention
A. molecule clone technology detection sequence is passed through
The method that one aspect of the present invention is related to detection and/or identification sample target nucleic acid sequence.This method is especially suitable The virus sequence being incorporated into detection on cell chromosome, such as adeno-associated virus (AAV) and retrovirus.This specification with AAV is reference, is illustrated using it as example.But can also be easily according to this specification, those skilled in the art Utilize retrovirus (such as feline leukaemia virus ((FeLV), HTLVI and HTLVII) and slow virus (such as human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anaemia virus and foamy virus) Etc. implementing the present invention.It is incorporated into host cell chromosome or is not incorporated into addition, the method for the present invention can be additionally used in detection Other viruses or non-viral sequence in host cell chromosome.
Sample described herein can be any sample containing nucleic acid, such as tissue, tissue culture, cell, cell training Support thing and biofluid, including and be not limited to urine and blood.These nucleotide sequences can be the DNA of plasmid origin Or RNA, the n DNA or RNA in any source, including bacterium, yeast, virus and higher etc. biology such as plant or Animal.DNA or RNA extraction can use any method well-known to those skilled in the art, as what Sambrook write " divides Son clone:Laboratory manual " (Molecular Cloning:A Laboratory Manual) (New York:Cold spring harbor laboratory) Described method.The source of sample and the method for extracting nucleic acid are not to the limitation made by the present invention.In addition, this hair Bright method is used directly for the sample containing DNA or the nucleic acid of (or extraction) is obtained from the sample.
The method of the present invention expands the sample containing DNA using PCR (PCR), and used first group is drawn Thing is that the area of the double-strandednucleic acid sequence first is specific, therefore can obtain extension increasing sequence.
As described herein, each region is all based at least two serotypes (i.e. AAV) or Strain (i.e. slow virus) Nucleotide sequence comparison and determine, wherein the sequence 5' end heights contained by each area are guarded, center section is excellent Select variable but be not essential, 3' ends be also it is highly conserved, these sequence preservatives or it is variable be relative at least two For the sequence of the AAV serotypes of comparison.Nucleotides highly conserved 5' and/or 3' at least there are about 9, preferably at least There are 18 base-pairs.For variable region, it is not necessary to have conservative sequence, these sequences can be relatively conservative, that is, compare To serotype or Strain between have less than 90%, 80% or 70% homogeneity.
Each area can cross over the length of about 100bp to 10kb base-pairs, it is particularly preferred that one of them is claimed Region is characterized, Ji Gai areas have enough uniquenesses, can be used for identifying the extension increasing sequence in target tissue source.For example, one In individual embodiment, the firstth area is about 250bp fragment, can be differentiated with any of AAV sequences, and the sequence is The amplification region identified through positivity in AAV sources.Moreover, the various sequences in the area all have enough uniquenesses, available for reflecting Determine the serotype in extension increasing sequence institute source.After (and being detected) is amplified, sequence can use conventional Restriction Enzyme incision technology Identification, by with AAV1, AAV2, AAV3, AAV4, AAV5 or AAV6 or AAV7, AAV10, AAV11, AAV12 or other any warps The restriction map in the new serotype Nei Gai areas that the present invention identifies compares can and identifies the sequence.Above-mentioned serotype is all The present invention is identified and is related to.
According to approach described herein, those skilled in the art can easily identify that other are integrated in virus This area, and be easy to detect and identify these sequences.Therefore, a pair of preferable universal primers should be designed in highly conserved End, the area that this group of primer can be used for selected in amplification sample.This aspect of the present invention can be used for design detection target sequence (such as AAV) whether there is and identify the diagnostic kit of AAV serotypes, and criterion used can include described herein Or the restriction map of serotype isolated using techniques described herein.For example, the Rapid identification of PCR primer Or the determination of Molecular serotype can relatively be completed by digestion PCR primer and with restriction map.
Therefore, in one embodiment, AAV " characteristic area " may span across [the SEQ ID NO of AAV 1:6] pact Respective regions on 2800 to 3200 regions, and AAV 2, AAV3, AAV4, AAV5 and AAV6.Preferable region is about 250bp, positioned at [the SEQ ID NO of AAV 1:6] 2886 to 3143rd area, and [the SEQ ID NO of AAV 2:7], AAV3 [SEQ ID NO:8] and the respective regions in other AAV serotypes.See Fig. 1.For the AAV in quick detection sample, primer used is This feature regiospecificity.But the present invention is not limited in those to match completely with this paper AAV characteristic areas identified Sequence, those skilled in the art can be changed to this area, make the piece of point shorter than characteristic area or long point Section.
PCR primer is synthesized with method well-known to those skilled in the art.Each pair PCR primer is all by 5' primers and 3' Primer forms, and sees Sambrook etc., has quoted herein.Term " primer " refers to an oligonucleotide fragment, under suitable condition, Complementary primer extension product starts to synthesize in the point with nucleic acid chains.But it is also possible to using double-chain primer, as long as prolonging in preparation It is processed to be allowed to separate can before stretching product.Primer contains about 15 to 25 or more nucleotides, and preferably at least 18 Individual nucleotides.It is but shorter as 7 to 15 nucleotides can also use in some cases.
Primer will select chains different from the particular sequence to be expanded sequence complementary enough, and can also be respective with it Chain hybridization.Therefore, primer sequence and the precise sequence of wanted amplification region is needed not be.For example, can be by one section of incomplementarity Nucleotide fragments be connected to the 5' ends of primer, but remaining primer portion will be with the chain complete complementary.In addition, incomplementarity Base or longer sequence can be dispersed in primer, can be therewith as long as primer sequence is complementary enough with the sequence to be expanded Hybridization, the chain can carry out the extension products can of synthetic primer as template.
According to the present invention, the PCR primer of characteristic area is to be based on two or more aligned sequences (i.e. two or more AAV Serotype) high conservative region and design.The sequence of primer can be changed in 5' ends or centre, be not necessarily to and The AAV serotype complete complementaries of two or more comparisons.But the 3' ends of primer will at least have the nucleotides of more than 5 to be With two or more AAV serotype complete complementaries compared, the base-pair complete complementary of preferably more than 9, it is more preferably 18 base-pair complete complementaries.So, the 3' ends of primer are made up of at least five nucleotides consistent with aligned sequences 100%. But it is also possible to add the nucleotides of 1,2 or multiple denaturation in the 3' ends of primer.
For example, the primer pair of AAV characteristic areas is designed based on the following special area in AAV capsids.5' primers are Based on AAV2 [SEQ ID NO:7] nt 2867-2891,5'-GGTAATTCCTCCGGAAATTGGCATT3', are shown in Fig. 1.3' draws Thing is to be based on AAV2 [SEQ ID NO:7] nt 2867-2891,5'-GACTCATCAACAACAACTGG GGATTC-3'.But It is that those skilled in the art can be based on AAV 1, AAV3, AAV4, AAV5, AAV6 respective regions, or based on AAV7, The information that is there is provided of other AAV of AAV10, AAV11, AAV12 or the present invention designs primer pair.Furthermore it is also possible to utilize this Method known to art personnel designs other primer pairs to expand this characteristic area.
B. the separation of target sequence
As described herein, the first primer pair of the invention is used for the spy that specifically amplification target sequence is AAV serotypes Region is levied, in order to detect the target sequence.If also need to detect other sequences, i.e. if necessary to identify a new blood Clear type, then characteristic area needs to extend, and so, the present invention also needs to one or more additional primer pairs.These primer pairs Suitable design is into the second unique primer of the 5' primers comprising the first primer pair or 3' primers and the primer pair, so, the primer 5' areas or 3' areas to characteristic area can be amplified, the 5' ends or 3' termini-complementaries of the sequence and characteristic area.For example, the One primer pair is made up of with expansion region 5' primer P1 and 3' primers P2.For the 3' ends in extended characteristics region, second Primer pair should be made up of primer P1 and 3' primer P4, the sequence that the primer pair can with expansion region and downstream.In order to prolong The 5' ends of characteristic area are stretched, three-primer is corresponding to be made up of 5' primers P5 and primer P2, and the primer pair can be with expansion area Domain and its sequence of upstream.If desired, these extension steps can repeat (or carrying out simultaneously).Therefore, from these amplification steps The product obtained in rapid engages the independent sequence for just having obtained required length with the product obtained by conventional steps.
Second and three-primer pair be used to expand high conservative region in aligned sequences together with the primer pair of characteristic area. Term " second " used herein or " the 3rd " primer pair are not offered as these primers and are added to reaction only to facilitate description Order in mixture or for amplification.The region that second primer pair is expanded is by selection, is so come once amplifying The 3' termini-complementaries of its 5' ends can and characteristic area hybridize afterwards.Equally, three-primer is also to pass through to the region expanded Selection is crossed, so the 5' termini-complementaries of its 3' ends can and characteristic area hybridize Yi Dan amplified.It can also set Other primer pairs are counted out, the region that these primer pairs are expanded can be with second or three-primer pair and following primer pair The 5' ends of amplified production or the hybridization of 3' termini-complementaries.
If for example, using AAV as target sequence, the first primer pair (P1 and P2) is used for the expansion region from sample. In one preferred embodiment, characteristic area is located within AAV capsids.Second primer pair (P1 and P4) is used for characteristic area The region that 3' ends are extended to before AAV sequences 3'ITR, i.e., amplify the whole 3' ends of capsid containing AAV by anchor of characteristic area Product.In one embodiment, P4 primers are located at AAV2 [SEQ ID NO:7] nt 4435-4462, and other AAV In the corresponding sequence of serotype.As a result about 1.6kb product is obtained, the product contains 0.25kb characteristic area.3rd Primer pair (P3 and P2) is used for the 3' ends that the 5' ends of characteristic area are extended to AAV sequence rep genes, i.e., with characteristic area The product of the whole 5' ends of capsid containing AAV is amplified for anchor.In one embodiment, P3 primers are located at AAV2 [SEQ ID NO:7] nt 1384-1409, and in the corresponding sequence of other AAV serotypes.As a result about 1.7kb product is obtained, The product contains 0.25kb characteristic area.In addition, the 4th primer pair is used for the extension products of the whole 5' ends of capsid containing AAV Further extend to comprising rep sequences.In one embodiment, P5 primers are located at AAV2 [SEQ ID NO:7] nt 108- On 133, and the corresponding sequence of other AAV serotypes, shared with P2 primers.
It is that anchor or mark connect various extension products using characteristic area after completing the desired number of extension step Pick up just to have obtained a complete sequence.In one embodiment described herein, at least containing a complete AAV The AAV sequences of cap genes are amplified out, naturally it is also possible to amplify bigger sequence, this will be walked according to the amplification carried out It is how much rapid.
The method that extension products are assembled into used in a complete AAV sequence is well-known to those skilled in the art. For example, with DraIII digest amplification products, can be cracked on the DraIII sites of characteristic area, obtain one it is restricted Endonuclease bamhi, by this fragment with dividing product to be connected from newly containing complete AAV cap genes.But other can also be utilized suitable Technology extension products are assembled into a complete sequence, see Sambrook etc., quoted herein.
Except multi-step extension method described above, another embodiment of the invention is directly to amplify one Individual 3.1kb fragment, the fragment contain the cap sequences of total length.In order to directly expand 3.1kb's from NHP tissues or blood DNA Total length cap fragments are, it is necessary to identify that other two high conservative regions are large stretch of in order to expand this with PCR method in AAV genomes Section.A primer in conserved region is located at the centre (AV1ns of rep genes:5'GCTGCGTCAACTGGACCAATGAGAAC 3', SEQ ID NO:6 nt), another primer is located at (AV2cas in another conserved region of cap downstream of gene:5' CGCAGAGACCAAAGTTCAACTGAAACGA 3', SEQ ID NO:7), and this combination can amplify the genes of cap containing total length AAV sequences.In general, after amplification is completed, product can reach more than 99.9 through cloning and being sequenced its accuracy rate.Profit With this method, inventor at least isolates 50 capsid clones and identified therewith.Wherein 37 Clone Origins are in macaque (rh.1-rh.37), 6 Clone Origins are in stump-tailed macaque (cy.1-cy.6), and 2 Clone Origins are in baboon (bb.1 and bb.2), 5 Clone Origin is in chimpanzee (ch.1-ch.5).These are cloned in also identifying elsewhere for specification, together with its source Species and the animal tissue that novel sequences be present.
C. new A AV other method is separated
Another aspect of the present invention is related to the other method that new A AV is separated from cell.This method includes apparatus There is the carrier infection cell of AAV helper viral functions；Separate the infection clone containing AAV；Separate AAV sequencing；And will separation AAV sequences compared with known AAV serotypes, if the AAV and the known AAV serotypes sequence that separate are had any different Illustrate new A AV be present.
In one embodiment, the carrier with miscellaneous function provides the basic function of adenovirus, including such as E1a, E1b, E2a, E4ORF6.In one embodiment, miscellaneous function is provided by adenovirus.Adenovirus can be wild type, Can be people source can also be inhuman source, preferably non-human primate (NHP) source.The DNA of various adenovirus Sequence can be found from Genbank, including Ad5 types [Genbank accession number M73260].Adenoviral sequence can be from known What obtained in the adenovirus of type, such as serotype 2,3,4,7,12 and 40, in addition to the people source class that any present invention is identified Type [is shown in Horwitz, referenced above].Likewise, it is known that the adenovirus that can infect non-human animal (such as chimpanzee) can also be used for Build the carrier of the present invention.See United States Patent (USP) No.6,083,716.In addition to wild-type adenovirus, having must miscellaneous function Recombinant virus or non-virus carrier (such as plasmid, episome) can also be used.These recombinant viruses be it is known in the art, It can be prepared by the method delivered.See United States Patent (USP) No.5,871,982 and 6,251,677, which describe a kind of heterozygosis Ad/AAV virus.Selection to Adenovirus type not imply that the limitation to following invention.Protected from American Type Culture Various adenopathy strains can be obtained by hiding institute (American Type Culture Collection, Manassas, Virginia), It can also be obtained in addition from various commercial undertakings or research institution.Moreover, the sequence of many this Strain can be from various Inquired in database, such as PubMed and GenBank.
In addition, infectious AAV can use genomeWalker technology (Siebert etc., 1995, Nucleic Acid Research, 23:1087-1088, Friezner-Degen etc., 1986, J.Biol.Chem.261:6972-6985, BD Biosciences Clontech, Palo Alto, CA) separation.GenomeWalker technology is particularly suitable for being identified and isolated from and this hair The adjacent sequence of novel sequences that bright method is identified.For example, this technology can be used for the reverse end of separation new A AV serotypes Repetitive sequence (ITR) is held, it is according to the capsid and/or rep sequences for being exactly the new A AV identified with the method for the present invention.The skill Art can also be used for the separation sequence adjacent with other AAV or non-AAV sequences of the invention being identified and isolated from.See the He of embodiment 3 4。
The method of the present invention can be used for various epidemiological studies, biodistribution research, pass through AAV carriers or other integration The carrier of viral source carries out the detection of gene therapy.Therefore, these methods can be used for preparing pre-packaged kit and being easy to face Bed doctor, researcher and epidemiologist use.
II. diagnostic kit
Another aspect of the present invention be related to detection sample in whether known or unknown adeno-associated virus (AAV). This kit includes first pair of 5' and 3'PCR primer of AAV nucleic acid sequence identity regiospecificities.In addition, the kit is also First pair of 5' and 3'PCR primer of 3.1kb fragments specifics can be included, the fragment contains the total length AAV clothing identified herein Shell nucleotide sequence (i.e. AV1ns and AV2cas primers).Kit can also optionally add two couples described herein or multipair 5' With 3' primers, and PCR probes.These primer and probes can be used for the characteristic area for expanding every kind of AAV serotypes according to the present invention Domain, such as use quantifying PCR method.
The invention further relates to for identifying the AAV serotypes detected with method of the invention, and/or by new serotype It is distinguished with known serotype.This kit also includes one or more restriction enzymes, the standard of AAV serotypes For " restricted enzyme cutting analysis of mark ", and/or the reagent of the AAV serotypes detected by other determinations.
In addition, the present invention kit also comprising specification, feminine gender and/or positive control, container, sample dilution and Buffer solution, mark compare the table of comparisons, disposable glove, it is anti-pollution explanation, sample-adding rod or container, sample preparation test tube and Other any desired reagents, such as medium, washing reagent and concentrated reagent.These reagents can select from reagent described herein Select, liquid can select from the reagent of routine.In a preferred embodiment, washing reagent is isotonic salting liquid, be can be used for Buffered physiologic pH, such as phosphate-buffered salt (PBS)；Elution reagent is the PBS of the NaCl containing 0.4M, and concentrated reagent and equipment.Example Such as, those skilled in the art, which both know about, can use reagent such as polyethylene glycols (PEG) or NH4SO4, equipment such as filter. For example, the filter containing 100K films can concentrate rAAV.
The kit of the present invention can be used for realizing approach described herein, it can also be used to bio distribution, epidemiology, new Research of the type AAV viruses in people and NHP communication modes.
Therefore, method of the invention and kit can be used for the detection of target virus sequence, be identified and isolated from.This method and examination Agent box is especially suitable for detecting, being identified and isolated from AAV sequences, including new AAV serotypes.
In a noticeable embodiment, inventor is promoted to clone's AAV sequences using the method for the present invention Analysis, as a result show provirus sequence between the cloned sequence in different animals source have heterogeneous, all sequence all with Known 6 AAV serotypes are different, and its region of variability is concentrated mainly on the hypervariable region of capsid protein.It is shocking that AAV sequences Dispersiveness it is particularly evident in the clone separated from the single organization of stump-tailed macaque such as lymph node.This heterogeneity Best illustration be in animal individual AAV sequences exist it is obvious evolve, be probably partly due to a limited number of coinfection parent Homologous recombination occurs between this virus.The sequence evolution of wide-scale distribution virus can in these research explanation natural A AV courses of infection The formation of a group quasispecies can be result in, this quasispecies is mutually different in the comparison of capsid hypervariable region.This is first DNA The example that rapid molecular is evolved occurs for virus, and this mode is previously considered to only occur in RNA virus.
This document describes the new A AV serotypes and its feature that several methods with the present invention are identified.
III. new A AV serotypes
A. nucleotide sequence
This document describes the nucleotide sequence for the new A AV serotypes identified with the method for the present invention.See SEQ ID NO: 1,9-59, and 117-120, it has been incorporated by reference herein.Also reference can be made to sequence listed in Fig. 1 and table.
New serotype AAV7 full length sequence, including AAV 5'ITR, capsid, rep, and AAV 3'ITR are shown in SEQ ID NO:In 1.
For other new AAV serotypes of the present invention, this document describes the about 3.1kb that the method according to the present invention separates Fragment.The fragment contains the sequence of encoding full leng capsid protein and all or part of sequence of coding rep albumen.These sequences Including following identified clone.
For other new AAV serotypes, this document describes the characteristic area of encoding capsid protein.For example, this hair The sequence that bright AAV10 nucleotide sequences contain shown by Fig. 1 [is shown in SEQ ID NO:117,255bp length].The AAV11 of the present invention The sequence that nucleotide sequence contains shown by Fig. 1 [is shown in SEQ ID NO:118,258bp length].The AAV12 nucleotide sequences of the present invention Contain the sequence shown by Fig. 1 and [see SEQ ID NO:119,255bp length].Using approach described herein, AAV10, AAV11 and AAV12 sequences can be easily accredited, and for numerous purposes, such as AAV7 and described herein other are new Various purposes used in serotype.
Non-human primates (NHP) AAV nucleotide sequences of the present invention, the AAV serum that former document is reported is shown in Fig. 1 [the SEQ ID NO of type AAV 1:6]、AAV2[SEQ ID NO:7] and AAV3 [SEQ ID NO:8] therewith compare.These are new Type NHP sequences include sequence listed in table 1 below, and the sequence is identified by colony counts.
Table 1
The capsid fragment of two chimpanzee adenoviruses is inserted into AAV rep carriers and has obtained a new NHP clone. This new clone A3.1 is also referred to as Ch.5 [SEQ ID NO:20].In addition, present invention additionally comprises two people's AAV sequences, divide It is not referred to as H6 [SEQ ID NO:25] and H2 [SEQ ID NO:26].
The AAV nucleotide sequences of the present invention also include and listed sequence, sequence [SEQ ID NO in Fig. 1:1,9-59,117- 120] sequence, sequence [SEQ ID NO listed by complementary chain and Fig. 1:1,9-59,117-120] and its corresponding RNA of complementary strand And cDNA.The nucleotide sequence of the present invention also includes sequence, sequence [SEQ ID NO listed by Fig. 1:1,9-59,117-120] and its mutually The sequence mended the natural mutator-strain of chain and modified through genetic engineering.These modifications include mark known in the art, methyl Change and substitute one or more natural nucleotides with denatured nucleotide.
The present invention nucleotide sequence also include with Fig. 1 listed by sequence, sequence [SEQ ID NO:1,9-59,117-120] tool There is the sequence of the homogeneity or homology more than 85%, preferably at least about 90%, more preferably at least about 95% are best It is at least about 98%-99% homogeneity or homology.These terms define herein.
Present invention additionally comprises the fragment for the new A AV sequences identified with approach described herein.Suitable fragment is at least There is the length of 15 nucleotides, and there is biological significance comprising function fragment, the i.e. fragment.In an embodiment In, these fragments are novel sequences listed by Fig. 1, sequence [SEQ ID NO:1,9-59,117-120], its complementary strand and its complementation CDNA and RNA fragment.
Suitable fragment is the fragment that those are located on AAV1, AAV2 or AAV7.But utilize comparison described herein Method (is compared, default setting) with Clustal W programs, or the similarity method compared with other new serotypes, the skill of this area Art personnel can be readily determined the initiation codon and terminator codon of purpose fragment.
Suitable fragment includes the sequence of coding AAV three variable proteins (vp) of capsid, and there is different montages to dash forward for they Become：Vp1 [the i.e. nt 825to 3049 of AAV7, SEQ ID NO:1]；Vp2 [i.e. nt 1234-3049, the SEQ ID NO of AAV7: 1]；And vp3 [i.e. nt 1434-3049, the SEQ ID NO of AAV7:1].It is worth noting that AAV7 has unusual rise Beginning codon.In addition to several house-keeping genes, seldom report DNA virus had this initiation codon in the past.Other AAV blood Clear type vp1, vp2 and vp3 initiation codon are believed and in this way, the feature makes it produce vp1, vp2 and vp3 egg in the cell White ratio is respectively 10%:10%:80%, so as to effectively be assembled into virion.But even if research shows there is this Individual rare GTG initiation codon AAV7 virions also can be assembled effectively.So, inventor contemplates whether other can be changed AAV serotypes vp3 initiation codon makes it contain this rare GTG initiation codon, so as to improve packaging efficiency, changes disease The structure of malicious particle and/or the position for changing other AAV serotype surface antigens epitopes (i.e. neutralizing antibody epitope).Initiation codon Son can be changed by the method for routine, such as direct site mutation method.Therefore, the present invention includes engineered any selected Serotypes A AV virions, wherein being changed into GTG vp3 and/or along with vp1 and/or vp2 containing initiation codon.
AAV other Suitable fragments include fragment [the i.e. AAV7 nt468- of the initiation codon of capsid protein containing AAV 3090, SEQ ID NO:1；AAV7 nt 725to 3090, SEQ ID NO:1, and the respective area of other AAV serotypes Domain].Other fragments of AAV7 and other new As AV serotypes identified with approach described herein include those codings rep The sequence of albumen, including rep 78 [i.e. AAV7 initiation codon 334 in Fig. 1], [the AAV7 startings in Fig. 1 of rep 68 Codon nt 334], rep 52 [AAV7 initiation codon 1006 in Fig. 1] and rep 40 [AAV7 initiation codon in Fig. 1 Son 1006].Other fragments interested also have AAV 5' inverted terminal repeat sequences ITR [AAV7 nt 1-107 in Fig. 1]； AAV 3'ITR [AAV7 nt 4704-4721 in Fig. 1], P19 sequences, AAV P40 sequences, rep binding sites and end point Distinguish site (TRS).Other suitable fragments will be apparent to the person skilled in the art.Other new blood of the invention Respective regions in clear type by reference to Fig. 1 or utilize conventional comparison method and can after sequence control described herein It is readily determined.
In including figure and in sequence table in addition to listed nucleotide sequence, present invention additionally comprises for expressing the present invention The amino acid sequence of AAV serotypes, the nucleic acid molecules of proteins and peptides and sequence.Therefore, it is following new to include coding by the present invention The nucleotide sequence of type AAV amino acid sequences：C1[SEQ ID NO:60], C2 [SEQ ID NO:61], C5 [SEQ ID NO:62], A3-3[SEQ ID NO:66], A3-7 [SEQ ID NO:67], A3-4 [SEQ ID NO:68], A3-5 [SEQ ID NO:69], 3.3b[SEQ ID NO:62], 223.4 [SEQ ID NO:73], 223-5 [SEQ ID NO:74], 223-10 [SEQ ID NO: 75], 223-2 [SEQ ID NO:76], 223-7 [SEQ ID NO:77], 223-6 [SEQ ID NO:78], 44-1 [SEQ ID NO:79], 44-5 [SEQ ID NO:80], 44-2 [SEQ ID NO:81], 42-15 [SEQ ID NO:84], 42-8 [SEQ ID NO:85], 42-13 [SEQ ID NO:86], 42-3A [SEQ ID NO:87], 42-4 [SEQ ID NO:88], 42-5A [SEQ ID NO:89], 42-1B [SEQ ID NO:90], 42-5B [SEQ ID NO:91], 43-1 [SEQ ID NO:92], 43-12 [SEQ ID NO:93], 43-5 [SEQ ID NO:94], 43-21 [SEQ ID NO:96], 43-25 [SEQ ID NO:97], 43- 20[SEQ ID NO:99], 24.1 [SEQ ID NO:101], 42.2 [SEQ ID NO:102], 7.2 [SEQ ID NO:103], 27.3[SEQ ID NO:104], 16.3 [SEQ ID NO:105], 42.10 [SEQ ID NO:106], 42-3B [SEQ ID NO: 107], 42-11 [SEQ ID NO:108], F1 [SEQ ID NO:109], F5 [SEQ ID NO:110], F3 [SEQ ID NO: 111], 42-6B [SEQ ID NO:, and/or 42-12 [SEQ ID NO 112]:113], and using these sequences and/or its The artificial AAV serotypes that unique fragment prepares.
As described herein, artificial AAV serotypes include but not limited to the AAV with non-natural capsid protein.This people Work clothes shell can be prepared with any suitable method, be added using the new A AV sequences (i.e. the fragment of vp1 capsid proteins) of the present invention Upper heterologous sequence, these heterologous sequences can come from other AAV serotypes (known or new), same AAV serotypes not Continuous part, non-AAV viruses or non-viral sequence.Artificial AAV serotypes are possible and are not limited to chimeric AAV capsids, again Group AAV capsids or " artificial " AAV capsids.
B.AAV amino acid sequences, proteins and peptides.
The protein and its fragment coded by new A AV serotype nucleotide sequences identified the present invention relates to this paper, its Include AAV7 [AAV7 nt 825-3049, SEQ ID NO:1] and other new serotypes described herein.Therefore, this hair The capsid protein of bright new serotype includes：H6[SEQ ID NO:25], H2 [SEQ ID NO:26], 42-2 [SEQ ID NO: 9], 42-8 [SEQ ID NO:27], 42-15 [SEQ ID NO:28], 42-5b [SEQ ID NO:29], 42-1b [SEQ ID NO:30]；42-13[SEQ ID NO:31], 42-3a [SEQ ID NO:32], 42-4 [SEQ ID NO:33], 42-5a [SEQ ID NO:34], 42-10 [SEQ ID NO:35], 42-3b [SEQ ID NO:36], 42-11 [SEQ ID NO:37], 42-6b [SEQ ID NO:38], 43-1 [SEQ ID NO:39], 43-5 [SEQ ID NO:40], 43-12 [SEQ ID NO:41], 43- 20[SEQ ID NO:42], 43-21 [SEQ ID NO:43], 43-23 [SEQ ID NO:44], 43-25 [SEQ ID NO:45], 44.1[SEQ ID NO:47], 44.5 [SEQ ID NO:47], 223.10 [SEQ ID NO:48], 223.2 [SEQ ID NO: 49], 223.4 [SEQ ID NO:50], 223.5 [SEQ ID NO:51], 223.6 [SEQ ID NO:52], 223.7 [SEQ ID NO:53], A3.4 [SEQ ID NO:54], A3.5 [SEQ ID NO:55], A3.7 [SEQ ID NO:56], A3.3 [SEQ ID NO:57], 42.12 [SEQ ID NO:, and 44.2 [SEQ ID NO 58]:59], conventional technique can be utilized from above-mentioned list Clone in open reading frame prepare.
Present invention additionally comprises AAV serotypes prepared by the sequence of the new A AV serotypes using the present invention, preparation method bag Include synthetic technology, recombinant technique and other technologies well-known to those skilled in the art.The present invention is not limited to the present invention's New A AV amino acid sequences, peptide and protein expressed by new A AV nucleotide sequences, also include with known in the art Amino acid sequence, the peptide and protein of other method preparation, such as chemical synthesising technology, other synthetic technologys or other method. For example, any one in one sequence：C1[SEQ ID NO:60], C2 [SEQ ID NO:61], C5 [SEQ ID NO:62], A3-3[SEQ ID NO:66], A3-7 [SEQ ID NO:67], A3-4 [SEQ ID NO:68], A3-5 [SEQ ID NO:69], 3.3b[SEQ ID NO:62], 223.4 [SEQ ID NO:73], 223-5 [SEQ ID NO:74], 223-10 [SEQ ID NO: 75], 223-2 [SEQ ID NO:76], 223-7 [SEQ ID NO:77], 223-6 [SEQ ID NO:78], 44-1 [SEQ ID NO:79], 44-5 [SEQ ID NO:80], 44-2 [SEQ ID NO:81], 42-15 [SEQ ID NO:84], 42-8 [SEQ ID NO:85], 42-13 [SEQ ID NO:86], 42-3A [SEQ ID NO:87], 42-4 [SEQ ID NO:88], 42-5A [SEQ ID NO:89], 42-1B [SEQ ID NO:90], 42-5B [SEQ ID NO:91], 43-1 [SEQ ID NO:92], 43-12 [SEQ ID NO:93], 43-5 [SEQ ID NO:94], 43-21 [SEQ ID NO:96], 43-25 [SEQ ID NO:97], 43- 20[SEQ ID NO:99], 24.1 [SEQ ID NO:101], 42.2 [SEQ ID NO:102], 7.2 [SEQ ID NO:103], 27.3[SEQ ID NO:104], 16.3 [SEQ ID NO:105], 42.10 [SEQ ID NO:106], 42-3B [SEQ ID NO: 107], 42-11 [SEQ ID NO:108], F1 [SEQ ID NO:109], F5 [SEQ ID NO:110], F3 [SEQ ID NO: 111], 42-6B [SEQ ID NO:, and/or 42-12 [SEQ ID NO 112]:113], can be easily using various technologies Prepare.
Suitable technology of preparing is well-known to those skilled in the art.See Sambrook etc., molecular cloning:Laboratory hand Volume, Cold Spring Harbor Publications (Cold SpringHarbor, NY).In addition, polypeptide can also be synthesized with well known solid-phase peptide synthesis (Merrifield, J.Am.Chem.Soc., 85:2149(1962)；Stewart and Young, Solid phase peptide synthesis (Solid Phase Peptide Synthesis) (Freeman, San Francisco, 1969), 27-62 pages).These methods and other suitable systems Preparation Method is well-known to those skilled in the art, is not limitation of the present invention.
Particularly preferred protein includes the nucleotide sequence coded AAV capsid proteins identified by the above method.This hair The sequence of bright many capsid proteins is listed in Fig. 2 and/or SEQ ID NO of sequence table:In 2 and 60-115, work has been included herein For reference.AAV capsids are made up of three kinds of protein, vp1, vp2 and vp3, and they are selective splice mutation strains.In these figures Listed full length sequence is vp1 sequence.Based on AAV7 capsids [SEQ ID NO:2] numbering, vp2 sequence is across AAV7's Amino acid/11 38-737, vp3 sequence cross over AAV7 amino acid 203-737.According to this information, those skilled in the art The position of vp2 and vp3 in other new serotypes of the present invention can be readily determined.
Other optimization proteins and fragment of capsid protein include constant region between two hypervariable regions (HPV) and variable The sequence of area and HPV areas in itself.12 hypervariable regions are detected using a kind of algorithm of sequence discrete areas on analysis AAV2 (HVR), wherein 5 with previously described variable region have overlapping or one part [Chiorini etc., J.Virol, 73: 1309-19(1999)；Rutledge etc., J.Virol., 72:309-319].Utilize this algorithm and/or ratio described herein To method, it may be determined that the HVR of new A AV serotypes.For example, vp1 [the SEQ ID NO for AAV2:70] for, HVR's Position is as follows：HVR1, aa 146-152；HVR2, aa 182-186；HVR3, aa 262-264；HVR4, aa 381-383； HVR5, aa 450-474；HVR6, aa 490-495；HVR7, aa500-504；HVR8, aa 514-522；HVR9, aa 534- 555；HVR10, aa 581-594；HVR11, aa 658-667；And HVR12, aa 705-719.Calculated according to by conventional method The comparison method and novel sequences described herein [seeing Fig. 2] gone out, HVR can be readily determined in the new of the present invention Position in AAV serotypes.For example, according to Fig. 2, positions of the HVR on AAV7 can be readily determined, HVR1 is located at aa 146-152；HVR2 is located at aa182-187；HVR3 is located at aa 263-266, and HVR4 is located at aa 383-385, and HVR5 is located at aa 451-475；HVR6 is located at aa 491-496；HVR7 is located at aa 501-505；HVR8 is located at aa 513-521；HVR9 is located at aa 533-554；HVR10 is located at aa 583-596；HVR11 is located at aa 660-669；HVR12 is located at aa 707-721.According to herein The information provided, the HVR of other new As AV serotypes are also easily determined.
In addition, the expression of amino acids box with homogeneity is also identified in capsid.These expression cassettes highly significant, because For them can be utilized to build artificial serotypes, for example with the HVR1 expression cassettes of One serotype substitute another serotype HVR1 expression cassettes.The homogeneity of these expression cassettes has display in Fig. 1 HVR2.See Fig. 2.If compare other side with Clustal X Method, then this method have one be located at sequence under scale, originate in first residue, and be identified as 1.Line on scale is used to mark Remember highly conserved region.Used three kinds of characters (*,:), " * " represents single completely conservative position；“:" represented " strong " group that all risk insurance is kept, " " represent completely conservative " weak " group.Have in Gonnet Pam250 matrixes whole Positive packet.The fraction organized by force is more than 0.5, and weak group of fraction is less than 0.5.
In addition, other suitable fragments of AAV capsids include AAV2 [SEQ ID NO:70] aa 24-42, the aa 25- on 28；aa 81-85；aa133-165；aa 134-165；aa 137-143；aa 154-156；aa 194-208；aa 261-274； aa 262-274；aa 171-173；aa 413-417；aa 449-478；aa 494-525；aa 534-571；aa 581-601； aa 660-671；aa 709-723.Other preferably fragments include aa 1-184, the aa 199-259 on AAV7；aa 274- 446；aa 603-659；aa 670-706；aa 724-736；aa 185-198；aa 260-273；aa 447-477；aa 495- 602；aa 660-669；And aa 707-723.According to AAV7 [SEQ ID NO:2] numbering, other preferable regions may be used also One group that following fragment is contained with copper plate：aa 185-198；aa 260-273；aa 447-477；aa 495-602；aa 660- 669；And aa 707-723.Using default setting Clustal X programs or default setting it is other business or public Software is compared, the sequence compared according to this paper, the respective flap that can be readily determined in the new A AV capsids of the present invention Section.
Other preferable protein are AAV rep albumen [AAV7SEQ ID NO:3 aa 1-623] and its function fragment, Including SEQ ID NO:3 aa 1-171, aa 172-372, aa 373-444, aa 445-623.Preferable this fragment is tool There is at least eight amino acid length.See Fig. 3.Utilize techniques described herein and technology known in the art, it may be determined that Zone similarity on other new As AV albumen of the present invention.Alternatively, it is also possible to use the fragment of other required length.These Fragment can be prepared by recombination method or other suitable methods such as chemical synthesis process.
Sequence, albumen or the fragment of the present invention can be prepared by any suitable method, including recombination method, chemistry close Into method or other synthetic methods.These preparation methods are all well-known to those skilled in the art, are not represented to the present invention Limitation.
IV. the preparation of the rAAV with new A AV capsids
The present invention includes the AAV serotypes for the new wild type identified by the method for the present invention, these wild types AAV blood The sequence of clear type does not contain DNA possessed by natural viral and/or cellular component.Another aspect of the present invention relates to the use of this The new A AV sequences of invention, including its fragment are prepared for heterologous gene or other nucleotide sequences to be imported into target cell Molecule.
The molecule of the present invention contains the new A AV serotype sequences of the present invention, and host can be directed to including any Intracellular Genetic elements (carrier), such as naked DNA, plasmid, bacteriophage, transposons, clay, episome, non-viral transfer vector Interior albumen (i.e. lipid carrier), virus etc., these molecules can shift the sequence entrained by it.Carrier can be by any suitable Method transduction, including transfection, electroporation, liposome transfer, film fusion, high-tension DNA coating particle, virus infection and original Raw matter fusion.The method of any embodiment for implementing the present invention is all that the technical staff institute in nucleic acid manipulation technology field is ripe Know, including technique for gene engineering, recombineering and synthetic technology, Sambrook etc., molecular cloning:Laboratory manual, Cold Spring Harbor Publications, Cold SpringHarbor, NY.
In one embodiment, carrier of the invention contains sequence (the i.e. capsid for encoding new A AV capsids of the present invention AAV7 capsids, AAV 44-2 (rh.10), AAV10 capsids, AAV11 capsids, AAV12 capsids), or these one or more AAV clothing The fragment of shell.In addition, carrier can also contain capsid protein and its fragment.
The carrier of the present invention can also contain the sequence of coding AAV rep albumen.This rep sequences, which may come from, to be had The same AAV serotypes of rep sequences.In addition, the rep sequences contained by the carrier of the present invention can also originate from cap sequences Different AAV serotypes.In one embodiment, rep and cap sequences be it is different expression source (i.e. different carriers, or One host cell and a carrier).In another embodiment, the expression source phase of these rep sequences and cap sequences Together.In this embodiment, rep sequences can fuse formation one with the cap sequences of different AAV serotypes in a framework Individual chimeric AAV carriers.In addition, the carrier of the present invention can also contain a mini gene, this mini gene includes a screening Gene, AAV 5'ITR and AAV 3'ITR are located at its both sides.
Therefore, in one embodiment, carrier described herein contains the nucleotide sequence of coding complete AAV capsid, The capsid can come from single AAV serotypes (i.e. AAV7 or other new A AV).In addition, these carriers can also contain Encode artificial capsid sequence, this capsid be by AAV7 (or other new A AV) capsid one or more fragments with it is heterologous AAV or non-AAV capsid proteins (or fragment) fusion forms.These artificial capsid proteins are selected from AAV7, and (or other are new AAV) the discontinuous part of capsid or the capsid of other AAV serotypes.For example, we may want to modify one or more AAV Code area on vp1, i.e., the code area (HPV1-12) on one or more hypervariable regions, or vp2, and/or vp3.At another In embodiment, we may want to vp3 initiation codon changing over GTG.These modifications may can increase expression quantity, Quantum of output, and/or improve purifying of the albumen in selective expression's system, or other purposes (as changed inclusion body or change Neutralizing antibody epitope).
Carrier described herein is that plasmid can be used for various purposes, but it is especially applicable to the rAAV containing capsid is prepared, The capsid has AAV sequences or its fragment.These carriers, including rAAV, its element, construct and its application, herein all Have a detailed description.
One aspect of the present invention is related to the weight prepared with (or other the new A AV) capsid of AAV serotypes 7 or its fragment Group adeno-associated virus (AAV).This method includes culture host cell, and it is adjoint that the cell contains coding gland as herein defined The nucleotide sequence of viral (or other the new A AV) capsid protein of (AAV) serotype 7 or its fragment；Have functional rep genes； Mini gene at least containing AAV inverted terminal repeat sequences (ITR) and transgenosis；And enough miscellaneous functions are in order to will be small Gene packaging is led in AAV7 (or other new A AV) capsid protein.
The component for needing the culture in host cell and AAV mini genes being packaged into AAV capsids can use the mode of transduction It is supplied to host cell.In addition, any one or more of (i.e. mini gene, rep sequences, the cap sequences, and/or auxiliary of required component Assist energy) it can also be provided by a kind of host cell of stabilization, the cell is after genetic modification containing needed for one or more The component wanted, remodeling method are well-known to those skilled in the art.It is required contained by best this stable host cell Component should be located under inducible promoter control.But required component can also be located at its own composition promoter control Under system.The discussion part of suitable inducible promoters and itself transgenosis suitable regulating element of the composition promoter in this paper It is described.In addition, selectively stable host cell can also containing the optional component under itself composition promoter control and Other optional components under one or more inducible promoters controls.For example, stable host cell can be thin from 293 Born of the same parents' (cell contains E1 miscellaneous functions, under itself composition promoter control), but it also contains inducible promoters Rep and/or cap albumen under control.Other stable host cell those skilled in the art can also prepare.
Mini gene, rep sequences, cap sequences and miscellaneous function required for preparing rAAV of the present invention can be with any genes The form of element is imported into incasing cells, and entrained sequence can be imported into the cell by these elements.These selectivity Genetic elements can pass through any suitable method and import, including approach described herein.For implementing appointing for the present invention The method of what embodiment is all known to the technical staff in nucleic acid manipulation technology field, including technique for gene engineering, restructuring Engineering technology and synthetic technology, see Sambrook etc., molecular cloning:Laboratory manual, Cold Spring Harbor Publications, Cold SpringHarbor, NY.Together Sample, the method for preparing rAAV virions are also known in the art, select which kind of suitable method not represent to the present invention Limitation.See K.Fisher etc.,J.Virol.,70:520-532 (1993) and United States Patent (USP) 5,478,745.
A. mini gene
Mini gene is at least made up of transgenosis and its regulatory sequence, AAV 5' and 3' inverted terminal repeat sequence (ITR).Just It is that this mini gene is wrapped into capsid protein and is directed in selective host cell.
1. transgenosis
Transgenosis is a kind of nucleotide sequence, not homologous with the carrier sequence of its both sides, coding desired polypeptides, albumen or other Product.Nucleic acid coding sequence connects upper regulating element by manual type, and these regulating elements can be thin in host with render transgenic Intracellular transcription, translation and/or expression.
The composition of transgenosis is according to the different and different of its support applications.For example, a type of transgenic sequence includes One reporter sequences, it can produce a detectable signal after expressing.This reporter gene includes but not limited to encode The DNA sequence dna of following albumen：Beta-lactamase, beta galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescence Albumen (GFP), chloramphenicol acetyltransferase (CAT), luciferase, embrane-associated protein such as CD2, CD4, CD8, influenza hemagglutinin egg High-affinity antibody white and known in the art directly existing or being prepared by a conventional method it is combinable other Albumen, the fusion protein that the antigenic tag area containing embrane-associated protein and hemagglutinin or Myc sources suitably fuses and formed.
These coded sequences provide what can be detected with conventional method with controlling the regulatory sequence of its expression to be combined rear can Signal, including Enzyme catalytic analysis method, radio isotope assay method, colorimetric method, fluorescence or other chemoluminescence methods, fluorescence Activating cell classifying and analyzing method, immunoassay method such as enzyme-linked immune analytic method (ELISA), radioimmunoassay method And immunohistochemical assay (RIA).For example, when flag sequence is LacZ genes, the carrier with this signal can lead to The activity for crossing analysis beta galactosidase detects.When transgenosis is green fluorescent protein or luciferase, the signal is carried The color or optical signal that carrier is sent can be observed under the microscope.
But transgenosis can also be non-marker sequence, encode the product for biology or pharmacy, as albumen, polypeptide, RNA, enzyme or catalysis RNA.Preferable RNA molecule includes tRNA, dsRNA, rRNA, catalysis RNAs, and antisense RNA s.One The example of individual useful RNA sequence is the RNA that can inactivate the expression of target nucleic acid sequence in processed animal body.
Transgenosis can be used for correcting or improving gene defect, and the base of normal value is less than including normal gene expression level The gene defect do not expressed by defect or functional gene product.A kind of preferable transgenic sequence coding human cytokines or more Peptide, the albumen or polypeptide are in host cell inner expression.The invention further relates to single by more Asias to correct or improve using multiple genes Gene defect caused by the albumen of position.In some cases, different transgenosis is used for the different subunits of encoding proteins, or coding Different more peptide or proteins.The DNA of desirably encoding proteins subunit is larger, such as immunoglobulin, blood platelet source Growth factor or dystrophia albumen.In order that cell produces the protein of more subunits, it is necessary to can express difference simultaneously The recombinant virus transfectional cell of subunit.In addition, the different subunits of albumen can also use same transgenes encoding.In this feelings Under condition, this transgenosis contains the DNA for encoding different subunits, encodes the DNA internal ribosome knots of each subunit Site (IRES) is closed to separate.The DNA that we also are intended to encode each subunit is less, such as encode subunit DNA and IRES total size is within 5kb.In addition to IRES, DNA can also be opened with the sequence separates of coding 2A polypeptides, and this polypeptide exists Can be with self-cleavage after translation.See M.L.Donnelly etc., J.Gen.Virol., 78 (Part I):13-21(1997.1)； Furler, S etc., Gene Ther., 8 (11):864-873(2001.6)；Klump H etc., Gene Ther., 8 (10):811- 817(2001.5).This 2A polypeptide is more much smaller than IRES, therefore when be suitable for clip size and turn into limiting factor.But Selective transgenosis can encode any product with bioactivity or other products, such as be used for the product studied.
Those skilled in the art can easily select suitable transgenosis.The selection of transgenosis is not meant that to this The limitation of invention.
2. regulating element
In addition to the main element of above-mentioned mini gene, carrier can also contain some necessary conventional control elements, this A little element artificial connections intracellular turn in the viral of transfected plasmids carrier or the infection present invention in transgenosis, controlling it Record, translation and/or expression.As described herein, the sequence of artificial connection includes the expression control sequence adjacent with transgenosis and instead The expression control sequence of formula effect adjusts the expression control sequence of transgenosis in distal end.
Expression control sequence includes appropriate transcripting start point, terminating point, promoter and enhancer sequence；Effective RNA Process signal such as splice site and polyadenylic acid (polyA) signal；Stable endochylema mRNA sequence；Improve the sequence of translation efficiency Arrange (i.e. Kozak consensus sequences)；Improve the sequence of protein stability；Increase coded product secretion can also be contained if desired Sequence.There are many expression control sequences, including natural, itself composition, derivable and/or tissue known in the art Specific promoter can use.
The example of itself composition promoter includes but not limited to retrovirus Rous sarcoma virus (RSV) LTR promoters (enhancer can also be added), cytomegalovirus (CMV) promoter (enhancer can also be added) [see Boshart etc., Cell, 41:521-530 (1985)], SV40 promoters, dihyrofolate reductase promoter, beta-actin promoter, phosphoglycerol swash Enzyme (PGK) promoter and EF1 α promoters [Invitrogen].
Inducible promoters are capable of the expression of regulatory gene, and itself can also be by the compound of external source addition, ring The factor in border is adjusted, these factors include temperature or the specific physiological status such as differential period of acute stage, cell or Only in the intracellular of duplication.Inducible promoters and inducible system can obtain from many companies, wherein have Invitrogen, Clontech and Ariad.Other many systems also have been reported that those skilled in the art is easy to select.It can be added by external source The inducible promoters of promoter regulation include sheep metallothionine (MT) promoter of zinc induction, dexamethasone (Dex) lures Bittner milk factor (MMTV) promoter for leading, T7 polymerases promoter systems [WO 98/10088], insect moulting hormones open Mover [No etc., Proc.Natl.Acad.Sci.USA, 93:3346-3351 (1996)], tetracycline suppressor system [Gossen Deng, Proc.Natl.Acad.Sci.USA, 89:5547-5551 (1992)], tetracyclin inducible system [Gossen etc., Science, 268:1766-1769 (1995), referring also to Harvey etc., Curr.Opin.Chem.Biol., 2:512-518 (1998)], RU486 can induce system [Wang etc., Nat.Biotech., 15:239-243 (1997) and Wang etc., Gene Ther., 4:432-441 (1997)] and the inducible system of rapamycin [Magari etc., J.Clin.Invest., 100: 2865-2872(1997)].Other can be used for the inducible promoters of the present invention to be that those are adjusted by specific physiological status Promoter, such as stabilization, acute stage, cell specific differentiation state or duplication state.
Used in another embodiment is the natural promoter of transgenosis in itself.If only wish to make to turn Gene reaches natural expression, then natural promoter is preferable.If the expression of transgenosis must be by temporary transient tune Section, the regulation developed are adjusted in a manner of organizing specific or adjusted by certain species specific transcription stimulus signal, that Natural promoter can also be used.In another embodiment, other natural expression control elements can also be used such as Enhancer, polyadenylation site or Kozak consensus sequences simulate natural expression.
Another embodiment of transgenosis is that transgenosis is connected with tissue-specific promoter.If for example, Wish to express in skeletal muscle, it should use active promoter in musculature.It is following that these promoters include coding The promoter of the gene of protein：Skeletal muscle beta-actin, myosin light chain 2A, malnutritive element, muscle creatine kinase, And the muscle promoters of the synthesis higher than natural promoter activity are (see Li etc., Nat.Biotech., 17:241-245 (1999)).Known tissue-specific promoter be liver tissue-specific (albumin, Miyatake etc., J.Virol., 71: 5124-32(1997)；Hepatitis B core promoter, Sandig etc., Gene Ther., 3:1002-9(1996)；α-fetoprotein (AFP), Arbuthnot etc., Hum.Gene Ther., 7:1503-14 (1996)), BGP (Stein etc., Mol.Biol.Rep., 24:185-96(1997))；Bone sialoprotein (Chen etc., J.Bone Miner.Res., 11:654-64 (1996)), lymphocyte specific (CD2, Hansal etc., J.Immunol., 161:1063-8(1998)；Immunoglobulin Heavy chain；φt cell receptor α chains), neuronal specificity such as enolase (NSE) promoter (Andersen of neuronal specificity Deng, Cell.Mol.Neurobiol., 13:503-15 (1993)), neurofilament light gene (Piccioli etc., Proc.Natl.Acad.Sci.USA, 88:5611-5 (1991)), and neuronal specificity vgf genes (Piccioli etc., Neuron, 15:373-84(1995)).
In addition, selectable marker gene or reporter gene can also be included by carrying the plasmid of Therapeutic Transgenes, such as coding is lost Pass the sequence of mycin, hygromycin or puromycin (purimycin) resistance.This selection reporter gene or marker gene are (preferably Positioned at the outside of genome in order to use the present invention method recover) can be used for display bacterial cell in whether there is plasmid, such as Ampicillin resistance gene.The other elements of plasmid can also include replication orgin.These elements and other promoters with And the selection of carrier element is conventional, there is many can be for selection [seeing Sambrook etc., be incorporated as referring to herein].
Transgenosis, promoter/enhancer and 5' and 3'ITR be collectively known as " mini gene " in order to herein with reference to.Root According to the prompting of the present invention, this mini gene can be designed that by conventional technique.
3. mini gene is imported in packaging host cell
Mini gene is inserted into any suitable carrier, in plasmid, is then directed in host cell.For The plasmid of the present invention can be transformed with can be in prokaryotic or mammalian cell or in both through genetic engineering Replicate and integrate.These plasmids (or carrying 5'AAV ITR- heterologous molecules -3'ITR), which contain, can make mini gene in eukaryotic And/or the sequence and the selection markers of these systems replicated in prokaryotic.Selection markers or reporter gene can include compiling The sequence of code Geneticin, hygromycin or Puromycine resistance.Plasmid can also contain can be used for display bacterial cell in whether Certain selection reporter gene or marker gene of plasmid, such as ampicillin resistance gene be present.The other elements of plasmid include Replication orgin and amplicon, such as the amplification subsystem of Epstein Barr Virus Nuclear Antigens.This amplification subsystem or other classes As amplification subcomponent make carrier and replicated in the cell with the high copy of episomal.The molecule for carrying mini gene is preferably transfected into Into the cell, it can be instantaneous existing in the cell.(carrying 5'AAV ITR- source molecule -3'ITR) in addition, mini gene can be with Stable integration is in the genome of host cell, or is incorporated on chromosome, or exists in the form of episome.At certain In a little embodiments, mini gene exists in the form of multicopy, forms the string that head-head is connected, head-tail is connected or tail-tail is connected It is conjuncted.Suitable rotaring dyeing technology is well known, can be used in mini gene being transfected into host cell.
When transduceed in a manner of transfection the carrier containing mini gene when, Epstein Barr carrier in general amounts are that about 5 μ g are arrived 100 μ g DNA, preferably from about 10 to 50 μ g DNA, cell number is about 1 × 104To 1 × 1013, preferably from about 105Individual cell.But carry The relative quantity of body DNA and host cell can adjust, and this mainly considers selected carrier, transduction method, selected host The factors such as cell.
B.rep and cap sequences
In addition to mini gene, host cell is also containing driving new A AV capsid proteins (such as AAV7 or other new As AV Capsid, or the artificial capsid of the fragment containing one or more this capsids) host cell inner expression sequence and with AAV ITR serotype source identical rep sequences in mini gene.AAV cap sequences and rep sequences can be independently of one another Obtained from an AAV source, then imported into place with any method well-known to those skilled in the art described above In chief cell.In addition, when assuming that a kind of present invention new A AV capsids when, encoding the sequence of every rep albumen can derive from Same AAV serotypes, different serotype (such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 or this paper can also be derived from The new serotype identified).For example, rep78/68 sequences can come from AAV2, and rep52/40 sequences can come from AAV1。
In one embodiment, host cell stably expresses the capsid protein under appropriate promoters control, such as above Described.In this embodiment, capsid protein is preferably located under the control of inducible promoters.In another implementation In mode, capsid protein is supplied to host cell in a manner of trans.When being imported into a manner of trans in host cell, capsid egg It can be imported in vain by plasmid, the plasmid contains necessary sequence of the regulation capsid protein in host cell inner expression.When with trans When mode imported into intracellular, the plasmid for carrying capsid protein preferably also carries other sequences, such as rep necessary to rAAV is packed Sequence.
In another embodiment, host cell stably includes the rep sequences under appropriate promoters control, as above Described by face.In this embodiment, rep albumen is preferably located under the control of inducible promoters.In another reality Apply in mode, rep albumen is supplied to host cell in a manner of trans.When being imported into a manner of trans in host cell, rep eggs It can be imported in vain by plasmid, the plasmid contains regulation rep albumen sequence necessary to host cell inner expression.When with trans When mode imported into intracellular, the plasmid for carrying capsid protein preferably also carries other sequences, such as rep necessary to rAAV is packed Sequence and cap sequences.
Therefore, in one embodiment, rep and cap sequences are located on same nucleic acid molecules that to be transfected host thin Intracellular, and exist with the form stable of episome.In another embodiment, rep and cap sequences are stably integrated Into the genome of host cell.Yet another embodiment, expression of the rep and cap sequences in host cell is instantaneous. For example, a kind of nucleic acid molecules transfected through this mode contain 5' to 3' promoter, an insertion piece is selectively added Section, the fragment are located between the initiation site of promoter and rep genes, AAV rep genes and AAV cap genes.
In addition, the carrier containing rep and/or cap sequences can also need to be directed in host cell containing other Sequence.For example, carrier can include the rAAV constructs with mini gene.Carrier can contain one or more codings and aid in work( The gene of energy, such as adenovirus protein E1, E2a, and E4ORF6, and VAI rna genes.
It can be well-known to those skilled in the art or described above for the promoter in this construct What composition promoter, inducible promoters or natural promoter.AAV P5 promoters are used in one embodiment.Choosing That AAV is selected to provide these sequences be not limitation of the present invention.
In another preferred embodiment, rep promoter is a kind of inducible promoters, as described above It is connected like that with Transgene Regulator Elements.A preferred promoter for controlling rep expression is T7 promoters.Contain cap genes T7 polymerases can be expressed into the cell by transfecting or being transformed into the carrier of the rep genes of T7 promoters control.See WO 98/ 10088, publish March 12 1998 day.
Insert Fragment is a selectable element in the design of carrier.Insert Fragment be one be inserted in promoter and DNA sequence dna between rep Gene A TG initiation sites.Can be arbitrarily devised as required, that is it can be random sequence The sequence of nucleotides or encoding gene product (such as marker gene.Insert Fragment can contain band starting/termination site and The gene in polyA sites.Insert Fragment can be derived from prokaryotic or eukaryotic noncoding DNA sequence, repeat Non-coding sequence, the coded sequence without transcription control or the coded sequence for thering is transcription to control.Two examples in Insert Fragment source It is bacteriophage lambda step sequence and yeast step sequence, the two Insert Fragments can be bought, such as from Gibco or Invitrogen Bought Deng company.Insert Fragment can be any length, as long as it can be enough the expression for reducing rep78 and rep68 genes, Rep52, rep40 and cap gene is set to reach normal expression level.Therefore, the length range of Insert Fragment can from about 10bp to About 10.0kb, preferably from about 100bp are to about 8.0kb.In order to reduce the possibility of restructuring, Insert Fragment is more preferably less than 2kb, still, The present invention is restricted not to this.
Although rep and cap molecule can be instantaneously present in host cell and (such as pass through transfection), but it is preferably rep In albumen and cap albumen one or two and control promoter that it expresses can the stable expression in host cell, that is, make It is present in host cell or is incorporated into host cell chromosome for episome.The method for building the embodiment of the present invention Conventional technique for gene engineering or recombineering, as described by bibliography above technology.Although this explanation Some special constructs have been illustrated in book, but those skilled in the art inserts according to content described herein, selection Enter fragment, P5 promoters and other elements, add including at least a translation initiation signal and a termination signal and optionally Add polyadenylation site, it is possible to select and design other suitable constructs.
In another embodiment of the present invention, host cell can stably provide rep or cap albumen.
C. miscellaneous function
Packaging host cell, which also needs to miscellaneous function, could pack the rAAV of the present invention.These functions can also be by blister sore Poison provides.Necessary miscellaneous function is preferably people or non-human primate adenovirus source, it is as described above those And/or other sources, including American Type Culture Collection (ATCC), Manassas, VA (US).At current one preferably In embodiment, host cell provides and/or contained E1a, E1b, E2a and/or E4 ORF6 gene outcomes.Host cell can be with Containing other adenoviral genes, such as VAI RNA, but these genes are not essential.In a preferred embodiment, host Cell does not have other adenoviral genes or gene function.
The adenovirus DNA of expression E1a gene outcomes refers to the adenovirus of any coding E1a or any feature E1a albumen Sequence.Express E2a gene outcomes adenovirus DNA and express E4 ORF6 gene outcomes adenovirus DNA definition be also as 's.Additionally include adenoviral gene or any allele or other modification sequences of its function fragment.This modification can be with It is intentionally introduced by the technique for gene engineering or mutating technology of routine in order to strengthen the function of adenovirus in some manner, But it is the allelic mutation naturally occurred.The DNA and its method of modifying of this modification are well known to those skilled in the art 's.
Adenovirus E 1 a, E1b, E2a and/or E4ORF6 gene outcome and other any desired miscellaneous functions can lead to Any mode that crossing makes it express in the cell provides.The each sequence for encoding these products can be on different carriers, Can also be one or more genes on same carrier.Carrier can be known in the art or described herein Any carrier, including plasmid, clay and virus.Vector introduction can pass through known in the art or this paper institutes to host cell Description any method realize, such as transfection, infection, electroporation, liposome transduction, film integration technology, high pressure DNA be coated with particle, Virus infection and Protoplast fusion etc..One or more adenoviral genes can be stably integrated into host cell gene group, With the form stable expression of episome or transient expression.Gene outcome may be entirely transient expression, it is also possible to entirely exist It is being expressed in episome or stable integration, it is also possible to which that a part of gene outcome stabilization is expressed and another part gene outcome wink When express.Moreover, the promoter of each adenoviral gene independently selects, it can be composition promoter, can induce startup Son or native adenoviral promoter.Promoter can by the special physiological status adjustment of organism or cell (such as differentiation state or Duplication and inactive state), or adjusted by the factor of external source addition.
D. host cell and package cell line
Host cell can derive from any organism, including prokaryotic (such as bacterium), such as eukaryotic, insect in itself Cell, yeast cells and mammalian cell.Particularly preferred host cell is selected from any mammal, includes but not limited to A549, WEHI, 3T3,10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, 293 cells (can be with the adenovirus E 1 of expressive function), Saos, C2C12, L cells, HT1080, HepG2 and from lactation Animal includes primary fibroblast, liver cell and the sarcoblast of people, monkey, mouse, rat, rabbit and hamster.It is thin to provide host The mammalian species of born of the same parents are not limitations of the present invention, and the type of mammalian cell is nor limitation of the present invention, such as Fibroblast, liver cell, tumour cell etc..Host cell is preferably without any in addition to E1, E2a and/or E4 OR F6 Adenoviral gene, any other viral base that homologous recombination can occur during rAAV is produced with Virus Pollution is not contained in yet Cause；Host cell can infect or transfection DNA and can express the DNA of transfection.In a preferred embodiment, host cell is Stable transfection rep and cap cell.
It is a kind of to be used for the host cell that cell of the invention is stable conversion coding rep and cap sequences, the cell transfecting E1, E2a and/or E4 OR F6 and the construct for carrying above-mentioned mini gene.Stable expression rep and/or cap cell line, such as Cell described by B-50 (PCT/US98/19463) or those United States Patent (USP)s No.5,658,785 is equally applicable.Another Preferable host cell contains minimum adenovirus DNA, and this DNA is enough to express E4 OR F6.Utilize the new A AV of the present invention Rep and cap sequences can also construct other cell lines.
The preparation method of the host cell of the present invention includes the assembling of selective d NA sequences.This assembling can utilize normal Rule technology.Including cDNA and genomic clone technology, this is well known, is also described in Sambrook etc., is utilized The overlapping oligonucleotide acid sequence of adenovirus and AAV genomes, PCR, synthetic method is used in combination and can carry For any other proper method of required nucleotide sequence.
Molecule (plasmid or virus), which imports host cell, can also use known to those of skill in the art and whole explanation Technology discussed in book is carried out.Standard transfection techniques, such as CaPO are used in a preferred embodiment4Transfection or electricity Method for punching, and/or pass through adenovirus/for example (one kind contains human embryonic kidney cell HEK293 for AAV carrier heterozygote infection cells system The HK cells system of functional adenoviral E1 genes, the E1 albumen of the gene code cis acting).
The carrier in new A AV sources prepared by these those skilled in the art is beneficial to channel genes to selected thin Intracellular and the gene therapy for being used for patient, because it has not been found that AAV7 neutralizing antibody in crowd.Moreover, the research of early stage Show also there is no neutralizing antibody in stump-tailed macaque and chimpanzee, AAV7 cross reactivity is less than 15% in macaque, this serum Type is separated from the species.Those skilled in the art can be easily prepared containing this using its well known technology Other rAAV viral vectors of AAV7 capsid proteins described by text.Also have with other new As AV of present invention carriers prepared There is the advantages of same.
Therefore, those skilled in the art be readily appreciated that the present invention AAV7 sequences be suitable to prepare these carriers and other Viral vector, the gene transfer in vitro and in vivo.Equally, also easily the selection present invention is new by those skilled in the art Other fragments of AAV genomes are used for various rAAV and non-rAAV carrier systems.These carriers include slow virus, reverse transcription disease Poison, poxvirus, vaccinia virus etc..It is not limitation of the present invention to select which kind of virus system.
Therefore, the invention further relates to carrier prepared by the nucleic acid of the new A AV using the present invention and amino acid sequence.It is this Carrier has various uses, including transfer treats molecule and for preparing vaccine.Transfer treatment molecule preferably contains new A AV of the present invention The restructuring AAV of capsid.These carriers or the carrier of other new A AV sequences containing the present invention can also be used for vaccine therapy scheme, As and cell factor cotransfection or transfect immunogene itself.
V. recombinant virus and its application
Using approach described herein, those skilled in the art can prepare the new serotype capsid containing the present invention Or the rAAV of the new capsid of one or more new fragments of the AAV serotypes with useful method identification of the invention.One In individual embodiment, total length capsid used is AAV7 [SEQ ID NO from a serotype:2].In another embodiment In, the capsid of total length is by by a kind of one or more fragments of new serotype of the present invention and other AAV serotypes Sequence fusion is prepared in a framework.For example, a kind of rAAV can contain the one of a kind of AAV serotypes of the present invention Individual or multiple new hypervariable regions.In addition, the unique AAV serotypes of the present invention can also be used for containing other viruses or non-viral sequence In carrier.
Those skilled in the art is readily appreciated that the embodiment of certain particular serotype comprising the present invention is especially suitable For certain specific purpose.For example, the carrier in AAV7 capsids source of the present invention is especially suitable in muscle, and the present invention The carrier in rh.10 (44-2) capsids source is especially suitable for lung.The use of this carrier does not limit so, the skill of this area These carriers can also be used in other kinds of cell, tissue or organ by art personnel.Moreover, other capsid sources of the present invention Carrier can also be used for transfecting these and other cell, tissue or organ.
A. the transmission of transgenosis
Another aspect of the present invention, which is related to host, transmits transgene method, including the AAV sequences with the present invention Host cell selected by the carrier transfection or infection of preparation.Gene transfer method is well-known to those skilled in the art, and Do not represent limitation of the present invention.
In a preferred embodiment, the invention provides a kind of transfer method with AAV mediations to import transgenosis Method into host.This method includes being transfected with recombinant viral vector or infects selected host cell, and the carrier contains Selection transgenosis under control sequence control, control sequence can adjust the expression of transgenosis and AAV capsid proteins.
The sample of Hosts analyzes it and whether there is the antibody of selected AAV serotypes with being also an option that.Various detections Neutralizing antibody method is well-known to those skilled in the art.The selection of analysis method does not mean that limitation of the present invention.See Fisher etc., Nature Med., 3 (3):306-312 (1997.3) and W.C.Manning etc., Human Gene Therapy, 9:477-485(1998.3.1).Analysis result can be used for determining whether fit containing a kind of AAV carriers of particular serotype capsid protein In gene transfer, i.e., whether the specific antibody of the serotype capsid is not present.
In the one side of this method, the transfer with the carrier of selected AAV capsid proteins can be by containing different AAV The carrier of serotype capsid albumen is carried out before or after shifting a gene.Therefore, the side of rAAV carrier metastatic genes is passed through Method can into a host cell repetitive displacement gene.The rAAV carriers shifted afterwards can carry and first rAAV carrier phase With gene, but capsid protein contained by it and the capsid protein of first carrier can have different serotype sources. For example, if first carrier has AAV7 capsid proteins [SEQ ID NO:2], the capsid protein contained by carrier shifted afterwards It can be selected from other serotypes, such as AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV6, AAV10, AAV11, and AAV12, and Any other new A AV capsids identified herein, include but not limited to A3.1, H2, H6, C1, C2, C5, A3-3, A3-7, A3- 4, A3-5,3.3b, 223.4,223-5,223-10,223-2,223-7,223-6,44-1,44-5,44-2,42-15,42-8, 42-13,42-3A, 42-4,42-5A, 42-1B, 42-5B, 43-1,43-12,43-5,43-21,43-25,43-20,24.1, 42.2,7.2,27.3,16.3,42.10,42-3B, 42-11, F1, F5, F3,42-6B, and/or 42-12.
Above-mentioned recombinant vector can be imported into host cell with the method for document report.The best gels of RAAV, it is suspended in life In the medium for managing compatibility, people or the non-human mammal of illness are then administered to.Those skilled in the art can according to turn The virus of shifting selects suitable medium.For example, suitable medium includes salting liquid, various buffer solution (such as phosphate can be used Buffer solution) mix preparation is made.Other media include aseptic salt solution, lactose solution, sucrose solution, calcium phosphate solution, Portugal Grape sugar, agar, pectin, peanut oil, sesame oil, Yi Jishui.The selection of medium does not mean that limitation of the present invention.
In addition to rAAV and medium, composition of the invention can also contain other conventional Pharmaceutical ingredients, such as preservative Or chemical stabilizer.Suitable preservative includes anesin, potassium sorbate, sorbic acid, sulfur dioxide, gallic acid third Ester, p-hydroxybenzoate, ethyl vanillin, glycerine, phenol and parachlorphenol.Suitable chemical stabilizer is including gel and in vain Albumen.
Viral vector should can just obtain sufficiently high transfection efficiency and expression with enough amount transfectional cells, so The therapeutic effect of zero accident side effect can be obtained, or reaches expected physiological effect, the technical staff of medical domain can be true These fixed effects.Conventional and medicinal method of administration includes but not limited to be injected directly into selected organ that (such as venous perfusion arrives Liver), it is oral, suction (including nasal inhalation and aspiration), eye drip, intravenous injection, intramuscular injection, hypodermic injection, true Intracutaneous injection and other systems method of administration.Several methods of administration can also be used in combination if desired.
The dosage of viral vector is mainly according to factors such as the species of illnesses, the age of patient, body weight and health status It is determined that different patient doses is also different.For example, the effective dose of viral vector therapy people is typically 1ml to 100ml solution Between, contained viral number is about 1 × 109-1×1016.Preferable human dose is about 1013-1×1016AAV genomes. Dosage, this dosage therapeutic purposes to be reached according to recombinant virus can be adjusted according to therapeutic effect and the balance of side effect It is different and different.The expression of transgenosis can be monitored to determine the frequency of administration, preferably comprise the AAV carriers of mini gene. It can also be immunized with therapeutic scheme identical dosage.
The example that the transfection of the carrier containing AAV of the present invention is treated or is immunized is described below.These carriers can use In various therapeutic schemes or Vaccination Protocols, as described herein.In addition, these carriers can also with it is required treatment and/or Other one or more carriers or active component in Vaccine Regimens are administered together.
B. Therapeutic Transgenes
The treatment product of transgenes encoding includes hormone and growth factor and differentiation factor, including and be not limited to pancreas islet Element, hyperglycemic factor, growth hormone (GH), parathyroid hormone (PTH), somatotropin releasing factor (GFR), promoting sexual gland hormone (FSH), luteinising hormone (LH), human chorionic gonadotrophin (hCG), VEGF (VEGF), promotion blood vessel Generate element, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin(EPO) (EPO), CTGF (CTGF), basic fibroblast growth factor (bFGF), acid fibroblast growth factor (aFGF), EGF (EGF), transforming growth factor α (TGF-α), platelet derived growth factor (PDGF), insulin-like growth factor I and I (IGF-I And IGF-II), any member of transforming growth factor β superfamily including TGF β, Nandrolone Phenylpropionate, inhibin, Bones morphology occur Albumen (BMP) BMPs 1-15 any one, heregulin/neuregulin/ARIA/neu differentiation factors of growth factor (NDF) family any one, nerve growth factor (NGF), BDNF (BDNF), neurotrophic factor NT-3 and NT-4/5, CNTF (CNTF), GDNF (GDNF), Neurturin, agrin, brain signal albumen/disintegrate any a member of protein family, lead albumen -1 and lead albumen -2, liver are thin The intracellular growth factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydrolysis enzyme.
Other useful transgene products include that the protein of immune system can be adjusted, including and be not limited to cell because Son and lymphokine, such as TPO (TPO), interleukins (IL) IL-1 to IL-25 (including IL-2, IL-4, IL- 12, and IL-18), MCP, LIF ELISA, granulocyte macrophage colony stimulating factor, Fas match somebody with somebody Base, tumor necrosis factor α and β, interferon-' alpha ', β and γ, stem cell factor, flk-2/flt3 aglucons.Base caused by immune system Because product can also be used for the present invention.Including and be not limited to Immunoglobulin IgG, IgM, IgA, IgD and IgE, chimeric exempt from What epidemic disease globulin, the antibody of humanization, single-chain antibody, T cell antibody, I classes and II classes MHC molecule and genetic engineering were transformed Immunoglobulin and MHC molecule.Useful gene outcome also includes Complement Regulatory Protein, such as Complement Regulatory Protein, film co-factor Albumen (MCP), accelerate decay factor (DAF), CR1, CF2 and CD59.
Other useful gene outcomes also include hormone, growth factor, cell factor, lymphokine, regulatory protein and exempted from Any acceptor of epidemic disease systematic protein.The acceptor of the invention for including cholesterol modulation element, including low-density lipoprotein (LDL) acceptor, HDL (HDL) acceptor, VLDL (VLDL) acceptor and scavenger receptor.Base by the invention Because product also has the member of steroid hormone receptor superfamily, including glucocorticoid receptor and ERs, vitamin D by Body and other nuclear receptors.In addition, useful gene outcome also includes transcription factor, as jun, fos, max, mad, seroreaction because Sub (SRF), AP-1, AP2, myb, MyoD and myocyte generate albumen, ETS- boxes include albumen, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT- box binding protein, interferon regulatory factor (IRF- 1), nephroblastoma albumen, ETS- associated proteins, STAT, GATA- box binding protein, i.e. GATA-3 and winged-helix albumen Forkhead families.
Other useful gene outcomes include carbamyl synzyme I, ornithine transcarbamylase, argininosuccinate Acyl-synthetase, argininosuccinate acyl lyases, arginase, fumaric acid acetoacetate hydrolase, phenylalanine hydrolase, α -1 antitrypsins, G-6-Pase, porphobilinogen deaminase, factor Ⅴ II, factors IX, cystathionine beta-synthase, Branched keto acid decarboxylase, albumin, isovaleryl-CoA dehydrogenase, propionyl CoA carboxylase, methylmalonyl-CoA become Position enzyme, glutaryl-CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylase, liver phoshorylase, phosphorylase kinase Enzyme, glycine decarboxylase, H- albumen, T-, albumen, cysticfibrosis transmembrane regulator (CFTR) sequence and malnutrition Plain cDNA sequence.Other useful gene outcomes also include enzyme of the enzyme as being used for replacement therapy, lack available for various enzymatic activitys Caused disease.For example, the enzyme containing mannose-6-phosphate can be used for treatment lysosomal storage disease (such as coding β-glucose Aldehydic acid enzyme (GUSB)).
Other useful gene outcomes include non-natural polypeptide, such as have non-natural amino acid sequence chimeric polyeptides or Hybrid polypeptide, wherein having the insertion of amino acid, deletion or replacement.For example, artificial single-chain immunoglobulins are some available for treating Immune deficiency patient.Other kinds of non-native gene sequence includes antisense molecule and catalytic nucleic acid, such as ribozyme, available for reducing The overexpression of target gene.
Reduce and/or change disease of the expression of gene particularly suitable for treating hyper-proliferative, these diseases are characterized in carefully The hyper-proliferative of born of the same parents, such as tumour and sauriasis.Target polypeptide includes the polypeptide of those overexpressions or high level expression, and these polypeptides exist Hyper-proliferative it is intracellular more much higher than expression in normal cell.Polypeptide of the target antigen including encoding oncogene, such as myb, Myc, fyn, and translocation genes bcr/abl, ras, src, P53, neu, trk and EGRF.Except the oncogene as target antigen Beyond product, the target polypeptide for Antioncogene treatment and protectiveness remedy measures also has various caused by B cell lymphoma The variable region of antibody and the variable region of the φt cell receptor of t cell lymphoma, in some embodiments, these variable regions Target antigen can be used as to be used to treat autoimmune disease.Some other tumor relative polypeptide can also be used as target polypeptide, such as swollen The polypeptide of high level expression in oncocyte, including can be by polypeptide and folate binding polypeptides that monoclonal antibody 17-A is identified.
Other suitable treatment polypeptides and albumen also include those and can be used for treatment Serum of Patients With Autoimmune Diseases and with by resisting The polypeptide and albumen of Disease caused by the extensive protective immunological reaction of target position, this protective immunological reaction with it is thin The autoimmunity of born of the same parents' acceptor and the cell of generation autoimmune antibody are relevant.The autoimmune disease of T cell mediation includes class wind Wet arthritis (RA), multiple sclerosis (MS),Syndrome, sarcoidosis, insulin-dependent diabetes mellitus (IDDM), Autoimmune thyroiditis, adjuvant arthritis, ankylosing spondylitis, chorionitis, polymyositis, dermatomyositis, sauriasis, vascular Inflammation, Wegener granulomatosis, segmental enteritis and ulcerative colitis, the feature of every kind of disease be all φt cell receptor with Endogenic antigen binding is so as to activating the cascade of response of inflammation relevant with autoimmune disease.
C. Immunogenic Transgenes
In addition, AAV sequence and encoded peptide, the transgenosis of peptide and protein of the carrier of the present invention also containing the present invention, These peptides, peptide and protein can induce the immune response to target immunogene.For example, immunogene can select various viral families Race.Including picornavirus family, such as rhinovirus class, the 50% of flu pathogenic factor is accounted for；Enterovirus class, bag Include poliovirus, Coxsackie virus, echovirus and human enterovirus such as hepatitis A virus；And Apthovirus belongs to, and it is the main virus for causing non-human animal's aftosa.Target in picornavirus family member Antigen includes VP1, VP2, VP3, VP4 and VPG.Another virus family is calcivirus families, including Norwalk races disease Poison, it is the principal causative virus of epidemic gastroenteritis.Induce the target antigen of immune response in people and non-human animal's body targeted Virus family also has togavirus family, including Alphavirus class, such as sindbis alphavirus, RossRiver viruses, Venezuela horse Encephalitis viruses, eastern equine encephalitis virus, the rubella virus of western equine encephalitis virus and rubella virus genus.Flaviviridae family includes stepping on Remove from office fever virus, flavivirus, japanese encephalitis virus, sage-Louis's encephalitis viruses and tick encephalitis viruses.Other target antigens can To be prepared from hepatitis type B virus and coronavirus family, including a variety of inhuman source viruses, such as infectious bronchitis Viral (poultry), the propagated intestines and stomach of pig viral (pig), pig coagulation encephalomyelitis virus (pig), cat Infectious peritonitis virus (cat), canine coronavirus (dog) and human respiratory coronavirus, the virus can cause common cold and non-first, non-second Non- hepatitis C.The target antigen in coronavirus family source includes E1 (also referred to as M or stromatin), E2 (also referred to as S or Spike eggs In vain), E3 (also referred to as HE or hemagglutin-elterose) glycoprotein (not every coronavirus is all present) or N (nucleocapsids Body).Other antigens are probably the target position of rhabdovirus family, including Vesiculovirus (such as vesicular stomatitis virus) and Common hydrophobin (such as rabies).Suitable antigen may be from G-protein or N protein in rhabdovirus family.Line Shape Viraceae includes hemorrhagic fever viruse such as Marburg and Ebola virus, and suitable antigenic source.Paramyxovirus family Including 1 type parainfluenza virus, 3 type parainfluenza viruses, the type parainfluenza virus of ox 3, rubulavirus (mumps virus, 2 type parainfluenza viruses, 4 type parainfluenza viruses), NDV (chicken), rinderpest virus, measles virus, including measles and hundstaupe Heat, Pneumovirinae, including respiratory syncytial virus (RSV).Influenza virus belongs to orthomyxovirus class, and suitable antigenic source (such as HA Albumen, N1 albumen).Bunyavirus family includes Bunyavirus (california antigenic group viruses, La Crosse), white Sandfly Tobamovirus (Rift valley fever), hantavirus category (puremala is a kind of hemahagin fever viruses), Nairovirus Belong to (nairobi eye) and various non-classified bungaviruses.The LCM and lassa virus of arenavirus family be also One of source of antigen.Reovirus family include reovirus category, rotavirus (acute gastroenteritis for causing children), Orbivirus, cultivirus (colorado tick fever, Lebombo (people), equine encephalitis, blue tongue).
Retrovirus family includes oncorivirinal subfamilies, causes the feline leukemia of people or beast disease sick wherein having Poison, HTLVI and HTLVII, lentiviridae (including human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), Feline immunodeficiency virus (FIV), equine infectious anaemia virus and Spumavirinae).Many of HIV and SIV are suitable Antigen, it is described herein available.Suitable HIV and SIV antigens include and cloth is limited to gag, pol, Vif, Vpx, VPR, Env, Tat and Rev albumen, and its various fragments.In addition, the various modifications to these antigens are also described herein.For this purpose Appropriate antigen be well-known to those skilled in the art.For example, encoding gag, pol, Vif, and Vpr, Env, Tat can be selected With Rev and other albumen a sequence.See the gag albumen through modification described by United States Patent (USP) 5,972,596.Also can join See D.H.Barouch etc., J.Virol., 75 (5):2462-2467 (2001.3), and R.R.Amara etc., Science, 292: HIV and SIV albumen described by 69-74 (2001.4.6).These albumen and its subunit can individually transduce, and can also pass through Different carriers or the transduction of single carrier in combination.
Papova viruses family includes polyomavirus subfamily (BKU and JCU viruses) and papillomavirus subfamily (relevant with tumour or papillomatous pernicious change).Adenovirus family includes viral (EX, AD7, ARD, O.B.), mainly causes and exhales Inhale tract disease and/or enteritis.Parvovirus family includes feline panleucopenia virus (feline enteritis), cat panleucopeniavirus, dog Parvovirus and pig parvoviral.Herpes virus group includes A type herpesviral subfamilies, wherein have Simplexvirus (HSVI, HSVII), Varicellavirus (pseudoabies, varicella, herpes zoster) and Betaherpesvirinae, including cytomegalovirus category (HCMV, murine cytomegalovirus), and Gammaherpesvirinae, including Lymphocryptovirus subfamily, EBV (Hugh Burkitts Lymthoma), infectious rhinotracheitis, Marek disease virus and rhadinovirus.Poxvirus family includes Chordopoxvirinae subgenus, wherein have orthopoxvirus (smallpox and cowpox), parapoxvirus, fowlpox virus, capripox virus, Rabbitpox virus, pig pox virus and Entomopoxvirinae.Liver DNA virus family includes hepatitis type B virus.It is a kind of unfiled The virus as antigenic source be hepatitis δ virus.Other viruses include fowl infectivity bursal disease virus and pig breathes And reproductive syndrome virus.Alphavirus family includes the arteritis virus of horse and various encephalitis viruses.
Present invention additionally comprises immunogene, these immunogenes are used to people or non-human animal be immunized to resist cause of disease such as bacterium, true Bacterium, parasitic microorganism or parasite, these cause of diseases can infect people or non-human vertebrate, or from thin with cancer or tumour Born of the same parents.Bacteria pathogeny includes pathogenic gram-positive coccus such as pneumococcus, staphylococcus and streptococcus；Pathogenic intestines leather is blue Family name's negative cocci such as enteral Cordycepps (enterobacteriaceae)；Meningococcus, gonococcus.Pathogenic intestines gram-negative Property bacillus such as pseudomonad；acinetobacteria；Aitken Salmonella；Glander-like disease；Salmonella；Shigella；Haemophilus； Not pull bar bacterium；Haemophilus ducreyi (H.ducreyi) (causing chancroid)；Brucella；Franisella tularensis (yatobyo)；Yersinia (Pasteurella)；Streptobacillus reads sphaeridium coccus and spirillum；Gram-positive bacillus includes single Monocytogenes；Erysipelothrix rhusiopathiae；Bacterium diphtheriae (diphtheria)；Cholera；Bacillus anthracis (anthrax)； Granuloma inguinale (granuloma inguinale)；And bartonella bacilliformis.The disease as caused by pathogenic anaerobic bacteria includes broken Cold；Botulismus；Disease caused by other clostridiums；Tubercle bacillus；Leprosy；And other mycobacterias.Pathogenic spirillum Caused disease includes syphilis；treponematoses；Framboesia；South American trypanosomiasis and halstern's disease；And hook end spiral Body disease.Other infect as caused by high pathogenic bacteria and pathogenic fungus includes lumpy jawl clams；Nocardiosis；Hidden ball Bacterium disease；Blastomycosis；Darling disease；Coccidioidomycosis；Candidiasis；Aspergillosis；Mucormycosis；Sporothrix Disease；Paracoccidiodomycosis, petriellidiosis, torulopsosis, maduromycosis and chromoblastomycosis； And tinea pedis.Rickettsial infection includes typhus, American spotted fever, Q heat and chigger borne rickettsiosis.Mycoplasma and Chlamydia Infection includes Eaton agent pneumonia；Lymphogranuloma venereum；Psittacosis；And the choamydiae infection of perinatal period.Pathogenic eucaryon life Thing includes pathogenic parasite and worm and its caused infection, such as amcbiasis；Malaria；Leishmaniasis；Taper parasitosis；Bow Body disease；Pneumocystis carinii disease；Trichans；Toxoplasma gondii (Toxoplasma gondii)；Babesiosis；Pyriform Flagellosis；Trichinosis；Filariasis；Snail fever；Nematodiasis；Fluke disease or fluke；And cestode infection.
Many and its caused toxin in these biologies are by Center for Disease Control [(CDC), HHS (Department of Heath and Human Services), USA] to be identified, some of which is possible to attack as biology The reagent hit.For example, including bacillus anthracis (anthrax), clostridium botulinum and its toxin (botulismus), yersinia pestis (mouse Epidemic disease), variola major (smallpox), francisella tularensis (native pyreticosis) and viral hemorrhagic fever, it is all these now all by It is classified as the A class factors；Bai Shi burnetiis (Q heat), Brucella (brucellosis), pseudomonas mallei (glanders), castor Fiber crops and its toxin (ricin), C.perfringens and its toxin (ε toxin), staphylococcus and its toxin (enterotoxin B), It is all these to be all classified as the B class factors now；Nipan viruses and hantavirus are classified as the C class factors now.In addition, other are such as This other microorganism classified or do not classified so may also be accredited in the future and be used for this purpose.It is readily appreciated that viral load Body and other constructs described herein can be used for the antigen for shifting these organisms, virus, its toxin or other accessory substances, Prevention and/or treatment are as the infection caused by these biotic factors or other side effects.
It can be excited by the immunogene of the anti-T cell variable region of carrier transport of the present invention immune anti-including CTL Should be to remove these T cells.The several specificity on φt cell receptor (TCRs) to be played a role in rheumatoid arthritis (RA) Variable region has been accredited, and these TCRs include V-3, V-14, V-17 and V α -17.Therefore, transduction encodes at least one this polypeptide Nucleotide sequence can excite immune response for T cell in RA.The T cell to be played a role in multiple sclerosis (MS) Several specific variable regions on acceptor (TCRs) have been accredited, and these TCRs include V-7 and V α -10.Therefore, transduction encodes extremely The nucleotide sequence of a few this polypeptide can excite the immune response for T cell in MS.The T to be played a role in chorionitis Several specific variable regions on cell receptor (TCRs) have been accredited, and these TCRs include V-6, V-8, V-14, and V α -16, V α - 3C, V α -7, V α -14, V α -15, V α -16, V α -28 and V α -12.Therefore, transduction encodes the nucleic acid sequence of at least one this polypeptide Row can excite the immune response for T cell in chorionitis.
In addition, the carrier of the sequence of the invention containing AAV also can use basis-strengthened scheme (prime-boost regimen) to turn Move.This area has reported many such schemes, it is easy to selects.See WO 00/11140, publish March 2 2000 day, It has been incorporated by reference herein.
This basis-strengthened scheme, which generally comprises, first gives DNA (such as plasmid) carriers tentatively to excite immune system, then Strengthen this immune response by giving traditional antigen such as protein or carrying the recombinant virus for the sequence for encoding the antigen. In one embodiment, the invention provides a kind of prime-boost schedules to excite for the immune anti-of selected antigen Should, the program first shifts a plasmid DNA vectors for carrying the antigen, is then strengthened, and is exactly containing the present invention in transfer The carrier of AAV sequences.
In one embodiment, basis-strengthened scheme includes basis and/or strengthens the expression of polyprotein in carrier.See R.R.Amara, Science, 292:69-74 (6April 2001), which describe the multiprotein regimen of expressing protein subunit For exciting the immune response of AntiHIV1 RT activity and SIV.For example, a DNA carrier is carrier can shift Gag, Pol with a transcripton, Vif, VPX and Vpr and Env, Tat, and Rev.In addition, SIV Gag, Pol and HIV-1 Env is also transferred.
But basis-strengthened scheme is not limited to the immune of HIV or shifts these antigens.For example, fundamental immunity is transfer The first chimpanzee carrier of the present invention, is then strengthened with the composition of the second chimpanzee carrier or the antigen containing protein form It is immune.In one embodiment, prime-boost schedules can provide the virus to antigen institute source, bacterium or other are micro- The protective immunological reaction of biology.In another preferred embodiment, prime-boost schedules can reach treatment effect Fruit, this effect can be detected using the analysis method of routine.
Based vaccines can be expelled to the various positions of body in a manner of dose-dependent, mainly immune according to what is excited The target antigen of reaction.The present invention does not limit the amount or site and pharmaceutical carrier of injection.The therapeutic scheme of fundamental immunity step can To be single dose or per hour, daily, weekly, monthly or annual dosage.For example, mammal can receive 1-2 injection, injection dosage are the carrier containing about 10 μ g to 50 μ g plasmids.Preferable fundamental immunity amount or basic DNA vaccination group The dosage of compound is about 1 μ g to 10,000 μ g DNA vaccinations.Dosage can also be the μ g of per kilogram of body weight about 1 to 1000 μ g DNA. The amount of injection or the selection in site will be according to the homogeneity and health of immune animal.
This document describes the dosage unit suitable for antigen to be transferred to required DNA vaccination in mammal body.For injecting DNA vaccination should hang or be dissolved into medicinal medium or Physiological Medium, such as isotonic salt, isotonic salting liquid or other preparations, this A little is all known to drug injection personnel.It will be apparent to those skilled in the art which is suitable medium, this is mainly root Selected according to the approach of injection.The composition of the present invention can be injected by above-mentioned approach, with biodegradable bio-compatible The form of property sustained release preparation made of polymer, or made of protomere, gel and liposome ejection preparation in place form Injection.
In addition, the priming step of the present invention also includes injecting primary composition of DNA vaccine, the adjuvant of Sq, such as Defined herein.
For mammal, booster immunization about 2 to 27 weeks preferably after primary DNA vaccination is injected are carried out.Reinforcement is exempted from The refraction of epidemic disease composition is the booster vaccine composition with effective dose, and said composition contains or can shifted basic DNA vaccination institute The same antigen given.Booster immunization composition origin comes from the recombinant viral vector composition of same virus or different virus.Separately Outside, " booster immunization composition " can contain with basic DNA vaccination coded by antigen identical antigen, simply the antigen be with egg White or peptide form is present, and said composition can induce the immune response of host.In another embodiment, booster immunization The composition that composition is included contains a kind of DNA sequence dna, the antigen under sequential coding regulatory sequence control, adjusts sequence Row can control its expression in mammalian cell, and carrier bacterium as is known or viral vector.Booster immunization combines One basic demand of thing be antigen in vaccine combination will or cross reaction identical with the antigen coded by DNA vaccination resist It is former.
The carrier of the present invention is also applied for containing non-AAV carriers or albumen, peptide or other biological treatment or immunogenic compound In immunization protocol.These schemes by gene transfer particularly suitable for being treated and be immunized, including inducing protective immunity.These Using being well-known to those skilled in the art.
The carrier or efficient gene treatment tool of the present invention, it can be in vivo or in vitro by selected transgenosis It imported into selected host cell, even if containing the neutralizing antibody of one or more AAV serotypes in organism.At one In embodiment, carrier (i.e. rAAV) and cell can mix in vitro；The cell infected with conventional method culture；Then again will The cell injection of transduction is in patient body.Moreover, the carrier of the present invention can also be used to prepare required gene outcome in vitro.It is right For external preparation, first with the rAAV transfection host cells of the molecule of the purpose product containing coding, in condition of its suitable expression Lower culture cell, the product (such as protein) required for then can obtains from cell culture.Then by expression product Purifies and separates.Suitable transfection, cell culture, purifying and isolation technics is all well-known to those skilled in the art.
The following examples explain the several aspects and embodiment of the present invention.
Embodiment
Embodiment 1：PCR amplifications, clone and the characterization of new A AV sequences
Oligonucleotides design primer based on known AAV high conservative regions screens non-human primate group with PCR method Knit interior AAV sequences.Across AAV1 [SEQ ID NO:6] 2886-3143bp one section of AAV sequence is as PCR amplicons, wherein Hypervariable region and other all known AAV serotypes on capsid protein (Cap) is all different, is named as " characteristic area " herein, Its both sides is conserved sequence.Find that this characteristic area is located between the conserved residues of hypervariable region 3 by later analysis.
Find to detect that AAV primate is sub- by the preliminary examination to one group of non-human primate peripheral blood sample Class is macaque, stump-tailed macaque, chimpanzee and baboon.But no discovery AAV in the animal of other some subclass of detection, its Include Japanese macaque, pigtail monkey and Squirrel monkey.Carrier has been carried out by the tissue for the macaque raised to Bin Xi Fa Niya universities The concentration analysis of distribution, and solution plane is carried out to spoil and is found that overall distribution situation of the AAV sequences in tissue.
The amplification of A.AAV characteristic areas
AAV1-6 and the AAV separated out of goose and duck body DNA sequence dna are with " Clustal W " are compared each other with default setting It is right.AAV1-6 aligned sequences and AAV7 information is shown in Fig. 1.The similitude of AAV sequences is contrasted.
In one group of research, one is crossed over [the SEQ ID NO of AAV 1:6] 2886bp-3143bp 257bp region and Respective regions [seeing Fig. 1] are identified by inventor on AAV2-6 genomes.The region is located on AAV capsid genes, its 5' end and 3' ends are all highly conserved, and intermediate region is relative variable.In addition, a restricted digestion of DraIII is contained in the region Site (CACCACGTC, SEQ ID NO:15).Inventor has found that the region can be as known all types AAV DNA's Special features region.In other words, reacted by PCR, the endonuclease digestion of known serotype specificity and gel electrophoresis, this area Domain can be used for the DNA of amplification being defined as serotype 1,2,3,4,5,6 or other serotypes.
Using AAV1,2 and 5DNA as control design, confirmation primer and optimization PCR conditions.Sequence of the design of primer based on AAV2 Row：5' primers, 1S:bp AAV2(SEQ ID NO:7) 2867-2891 and 3'primer, 18as, AAV2 (SEQ ID NO:7) Bp 3095-3121.
The cell DNA in the different tissues of the different macaques such as source such as blood, brain, liver, lung, testis is analyzed in aforementioned manners, As a result very strong pcr amplification product can be obtained from the DNA of these monkey different tissues by showing.PCR primer it is restricted Restriction analysis show that these products are to amplify to come from AAV sequences, all different from all AAV sequences delivered.
The PCR primer amplified in various monkey tissue DNA (about 255bp length) is cloned and is sequenced.To these new As AV sequences Row carry out bioinformatic analysis and find that they are the capsid genes of new A AV sequences, and different from each other.What Fig. 1 was shown AAV10-12 new A AV characteristic areas [SEQ ID NO:117,118 and 119].Carried out using Clustal W (1.81) program Multiple Sequence Alignment is analyzed.Percent sequence identity between the characteristic area of AAV1-7 and AAV10-12 genomes is seen below.
The sequence that table 2. is analyzed
Sequence number AAV serotypes Clip size (bp)
1 AAV1 258
2 AAV2 255
3 AAV3 255
4 AAV4 246
5 AAV5 258
6 AAV6 258
7 AAV7 258
10 AAV10 255
11 AAV11 258
12 AAV12 255
The pairing of table 3. compares (percentage of homogeneity)
AAV2 AAV3 AAV4 AAV5 AAV6 AAV7 AAV10 AAV11 AAV12
AAV1 90 90 81 76 97 91 93 94 93
AAV2 93 79 78 90 90 93 93 92
AAV3 80 76 90 92 92 92 92
AAV4 76 81 84 82 81 79
AAV5 75 78 79 79 76
AAV6 91 92 94 94
AAV7 94 92 92
AAV10 95 93
AAV11 94
One isolates and has been sequenced the clone of more than 300 serotypes of AV containing new A, what these serotypes were all allowed a choice 257bp region.By finding that this 257bp region can be used as one to the bioinformatic analysis of this more than 300 clones Individual superior flag sequence is used for the separation and identification of new A AV serotypes
B. performing PCR amplification is entered using characteristic area
The 5' ends that 257bp characteristic area can extend to PCR amplicons as PCR anchors genome cover rep Gene and cap genes (1398bp-3143bp, SEQ ID NO:6) bonding pad, the 3' ends that may be extended to genome obtain To complete cap gene orders (2866bp-4600bp, SEQ ID NO:6).Enter performing PCR amplification, 95 DEG C of changes using standard method Property 0.5-1min, 60-65 DEG C annealing 0.5-1min, 72 DEG C extension 1min/kb, 28-42 circulate.
Using " aligned sequences described in A ", it is found that other two relatively conservative regions again in the two sequences, One of sequence is located at the 3' ends of rep genes, and 257bp sequences are pointed in its 5' end, and another sequence is located at 257bp fragments Downstream but before the AAV 3'ITR.In order to amplify the complete capsids sequence of new A AV serotypes and part rep sequences Row, design two pairs of new primers and optimize PCR conditions.In order to improve specificity, 5' RLM-RACE primers：5' primers are AV1Ns, GCTGCGTCAACTGGACCAATGAGAAC [AAV1 nt1398-1423, SEQ ID NO:6], 3' primers are above-mentioned 18as.3' amplimers：5' primers are above-mentioned 1s, and 3' primers are AV2Las, TCGTTTCAGTTGAACTTTGGTCTCTGCG [AAV2 nt 4435-4462, SEQ ID NO:7].
For these PCR amplifications, 257bp areas prepare overlapping fragmentses to build completely as PCR anchors with mark is logged in Capsid gene, amplify as described herein 5' extension fragment and 3' extension fragment after by characteristic area Merge in DraIII sites.In order to more specifically amplify complete AAV7cap genes, three amplifications are produced respectively to specifications Thing (a) characteristic area sequence；(b) 5' extension sequences；(c) 3' extension sequences are cloned into pCR4-Topo [Invitrogen] plasmid In.Then with DraIII digested plasmids and recombinate to form complete cap genes.
In the experiment of this group, AAV7 and AAV8 about 80% capsid sequence is separated and analyzed.Another new serotype, AAV9 is also found in monkey #2.
Using above-mentioned PCR conditions, the remainder of AAV rep genes is separated and has cloned, primer used can expand Go out 108bp to the 1461bp of AAV genomes region (the numbering SEQ ID NO based on AAV2:7 calculate).The clone passes through It is used to build the complete AAV7 genomes without ITR after sequencing.
C. 3.1kb Cap fragments are directly expanded
In order to directly expand 3.1kb total length Cap fragments from NHP tissues and blood DNA, identified in AAV genomes Go out the PCR amplifications that two sections of other high conservative regions are used for large fragment.One is have selected in conserved region among rep genes to draw Thing (AV1ns:5'GCTGCGTCAACTGGACCAATGAGAAC 3', SEQ ID NO:6 nt 1398-1423) and positioned at Cap 3' primers (AV2cas in another conserved region of downstream of gene:5'CGCAGAGACCAAAGTTCAACTGAAACGA 3', SEQ ID NO:7) the cap fragments of total length are expanded.PCR primer is cloned into Topo according to the specification (Invitrogen) of producer, used Qiagengenomics (Qiagengenomics, Seattle, WA) carries out sequence analysis, as a result shows that accurate rate is more than 99.9%.50 capsid sequences clone is always isolated and identifies, wherein 37 Clone Origins are in macaque (rh.1-rh.37), 6 Individual Clone Origin is in stump-tailed macaque (cy.1-cy.6), and 2 Clone Origins are in baboon (bb.1 and bb.2), and 5 Clone Origins are in black orangutan Orangutan (ch.1-ch.5).
It is due to possibility caused by PCR mistakes to exclude sequence polymorphism in new A AV families, such as passes through DNA moulds Recombinate and lead in the gene splicing that PCR is mediated caused by overlap-extension PCR between plate different piece and homologous sequence, or bacterium The result of cause, a series of VP1 amplifications experiments are carried out again under identical condition, template used is cell STb gene.First, It is serially diluted after complete AAV7 and AAV8 equal proportions are mixed, the mixture being serially diluted is as template PCR amplifications 3.1kb VP1 fragments, primer used and amplification condition are identical with DNA cloning, see whether the PCR primer of any heterozygosis occur.Will Mixture is transformed into bacterium, isolates transformant, and whether observation heteroclone may be from the regrouping process in bacterium. In different experiments, we use the restricted digestion AAV7 and AAV8 of Msp I, Ava I and HaeI, and all enzymes can be in gene The diverse location of group is cut repeatedly, the digestion product of various combination is mixed and by the use of it as template PCR amplifications VP1 fragments, used Condition it is identical, see whether can because part AAV sequences overlap-extension PCR and producing any PCR primer.In another examination In testing, the 1.5kb AAV7VP15' fragment overlapping with characteristic area of gel-purified and 1.7kb AAV8VP13' fragments are mixed With, PCR is used for after being serially diluted and is expanded, adds or be not added with the cell DNA that 200ng derives from monkey cells system in system, should DNA does not contain AAV sequences through TaqMan analysis determinations.All these experiments all do not have under conditions of genomic DNA Cap amplifications The overlap for being found PCR mediations produces (data are unlisted).In order to further confirm, 3 groups of primers are devised, are located at respectively On different HVR, and be macaque F953 clone 42 it is specific, the mesenteric lymph with different primer combinations from F953 The fragment that amplification is shorter in (MLN) is tied, clone 42 is exactly to be separated from F953.What is identified in total length Cap clones is all Series jump strain is all present in these short-movie sections (data are unlisted).
Embodiment 2：Adeno-associated virus experienced substantive evolution in primate body during natural infection
The AAV of separation is subjected to sequence analysis and finds that the dispersiveness of whole gene group is concentrated mainly on the variable of capsid protein Area.Epidemiology survey result finds that all known serotypes are all primate site specifics, although clinical point It is only limited to separate AAV2 and AAV3 from the anus swab and throat swab of baby from strain, AAV5 is separated from the condyloma of people.Do not have also It was found that there is clinical complication relevant with AAV infection.
It is that model is infected with observation of nature with non-human primate to be best understood from AAV biological characteristics Complication.Based on known AAV high conservative regions design oligonucleotides primer (see embodiment 1), with the PCR method of the present invention from non- AAV sequences are screened in the tissue of people primate.Across AAV1 [SEQ ID NO:6] 2886-3143bp one section of AAV sequence As PCR amplicons, wherein conserved sequence is located at the both sides of hypervariable region, this hypervariable region and other all known AAV serum Type is all different, is named as herein " characteristic area ".
Find to detect that AAV primate is sub- by the preliminary examination to one group of non-human primate peripheral blood sample Class is macaque, stump-tailed macaque, chimpanzee and baboon.Carrier has been carried out by the tissue for the macaque raised to Bin Xi Fa Niya universities The concentration analysis of distribution, and solution plane is carried out to spoil and is found that overall distribution situation of the AAV sequences in tissue.
The characteristic area sequence of amplification is subcloned into plasmid, and each transformant is sequenced.As a result show different dynamic The all tangible change of the nucleotide sequence of the clone in thing source.Different clones of the change of characteristic area sequence in an animal Inside it is also apparent from.Tissue is removed in the animal that there are different flags sequence from two to be further analyzed, utilization is highly conserved The oligonucleotides in area amplifies the fragment of extension as primer by PCR method.Using this method two kinds of groups are constructed from newly Knit the viral genome in source.These provirus have in the sequence dispersiveness of cap genes significantly different with other known AAV
The AAV sequences that the experiment of next step is used to confirm in inhuman anthropoid cape animal tissue represent the original disease of virus infection Virus gene group, and these provirus genomes can be resumed to form virion.The genome of animal 98E056 hepatic tissues DNA can detect AAV8 characteristic area sequences, with being free of the endonuclease digestion in its site genome in a kind of AAV sequences DNA, and itself and a kind of plasmid are transfected into 293 into the cell together, the plasmid contains the gene of human Adenovirus serotype 5 of E1 missings Group, the source as miscellaneous function.Obtained pyrolysis product is passed on once on 293 cells, reclaim lysate, using with The polyclonal antibody of the Cap protein of multivalence reactivity detects whether to have AAV Cap proteins and utilizes PCR method amplification AAV8 The AAV provirus in source is to detect the abundance of DNA sequence dna.Detecting Cap protein by western blot method can prove to limit Property endonuclease digestion heart DNA and adenoviral helper plasmid cotransfection can produce high titre AAV8 virus, each 293 is thin Contain 10 in born of the same parents4AAV8 vector gene groups.Prepare on a large scale cell lysate and by cesium chloride centrifugation sedimentation therefrom Purifying.Contain 26nm icosahedrons (icosohedral) structure in the product of purifying, it appears that consistent with AAV serotypes 2.It is single The transfection of private adenovirus assistant carrier does not produce AAV albumen or genome, this eliminates the AAV of recovery as pollution sources can Can property.
In order to further determine that in animal kind and the variation situation of inter-species AAV flags sequence, select tissue and carry out extension PCR To expand the open reading frame of whole Cap protein.
Resulting fragment is cloned into bacterial plasmid, single transformant is separated and is sequenced.The tissue taken includes 3 (Tulane/V223-6 is cloned the lymphonodi mesenterici of macaque；Tulane/T612-7 is cloned；Tulane/F953-14 clone), 2 (Tulane/V251-3 is cloned the liver of individual macaque；Penn/00E033-3 is cloned), the spleen (Penn/97E043-3 of 1 macaque Clone), it is the heart (IHGT/98E046-1 clones) of 1 macaque, 1 chimpanzee (New Iberia/X133-5 clones), 6 short Tail monkey (Charles River/A1378, A3099, A3388, A3442, A2821, A3242-6 clones) and 1 baboon (SFRB/ 8644-2 clone) blood.In 50 clones of 15 animal origins, 30 are considered as non-unnecessary, because finding wherein At least 7 amino acid are different from each other.Using its separated order as numbering, prefix represents non-repetitive VP1 clones The species of the non-human primate in its source.Utilize SplitsTree programs [Huson, D.H.SplitsTree: Analyzing and visualizing evolutionary data.Bioinformatics 14,68-73 (1998)] plus The structure that upper division decomposition method is analyzed between the clone of this 30 non-severes and previously described 8 AAV serotypes is closed System.Analysis result shows between one group of sequence in tree network rather than branch tree network similitude be present.Its advantage exists In that can detect the packet assembled and formed and show its phylogenetic relationship, even if this relation may be by the event of parallel generation Reversed.Therefore substantial amounts of phylogenetic study is also needed to illustrate AAV evolution, and the present invention is simply carried out to different clones It is grouped to show its sequence similarity.
In order to determine that new VP1 sequences are virus infection genomic sources, from virus genomic group of high abundance Middle extraction cell DNA is knitted, the digestion with restriction enzyme without restriction enzyme site and rotaring redyeing 293 cell, then use adenopathy in AAV Poison 293 cells of infection.It can thus recover from the tissue DNA in two kinds of different animals sources and expand AAV genome (data It is unlisted).
New A AV VP1 sequences are further analyzed to determine the property of amino acid variation and position.To amino acid sequence each other All 30 VP1s clone of the row difference more than 1% compares the fraction evaluated and made a variation on each residue together.Analyzed according to one kind The algorithm of sequence discrete areas has obtained 12 hypervariable regions (HVR), wherein 5 with previously described variable area overlapping or its A part [Kotin, it is referenced above；Rutledge, referenced above].Three folded near-end peak (three-fold-proximal Peaks it is also variation) to contain loops of major part (HVR5-10) of variability interestingly on 2 times of axles and 8 times of axles More region.Capsid protein N-terminal has HVR1 and 2, and X-ray diffraction can not find the two regions, illustrate the N of VP1 albumen End is exposed to surfaces of viral particles.
AAV sequences are quantitatively detected from the tissue of 21 macaques with real-time PCR, primer and probe used is for known AAV Rep (1 couple) and Cap (2 couples) high conservative region.Each data point represents to be expanded from a kind of tissue of an animal Data.As a result find that AAV sequences have extensive distribution, although AAV contained between different animals amount is different.Animal Source and its background and suffered processing have no effect on distribution of the AAV sequences in macaque.AAV expression highests be In lymphonodi mesenterici, containing 0.01 copy in average each diploid gene in 13 animals showing positives.Liver and spleen are also containing height The viral DNA of abundance.Contain the AAV of very high copy, heart tissue, macaque 97E043 such as macaque 98E056 in some tissues Spleen tissue and macaque RQ4407 hepatic tissue, in them each diploid gene group contain respectively 1.5,3 and 20 copy AAV sequences.Viral DNA is horizontal relatively low in PMBC, illustrates that data are not due to residual in tissue in tissue (data are unlisted) caused by the blood deposited.It should be noted that this method can not be detected in non-primate body All AAV, because the sequence detected needs the homology for having height with oligonucleotides and real-time PCR probe.Pass through DNA Further animal tissue of the analysis with high abundance AAV DNA to determine DNA state, is divided hybridization technique by situ hybridization Analyse its distribution situation in the cell.
AAV provirus fragments, which have sequence variations, between different animals and between same animal different tissues makes one to associate many RNA virus can evolve in epidemiological process, or even when infecting an individual.It can find in many cases wild Type virus is replaced by a group, and these quasispecies are entered in the presence of pressure is selected by quick copy and mutation Change.One of example is HIV, and this virus can evolve because of immune pressure or drug pressure.RNA virus is mutated High rate have several mechanism, low fidelity including reverse transcriptase and lack error correcting capability, and non-homogeneous restructuring And homologous recombination.
The system that can be cloned in our current research by multiple provirus fragments is sequenced to illustrate the original of AAV quasispecies formation Cause.In fact, it all can not find completely the same sequence in any extension clone separated out of different animals or same animal.This The mechanism of kind sequence evolution is probably high-frequency homologous recombination between parental virus.As a result the hypervariable region frequency of Cap protein is caused Numerous exchange, so as to form one group of chimera, this chimera has different small taxises and different serotype specificities (attack for obtaining the ability, particularly neutralizing antibody of escaping immune response).The mechanism that homologous recombination occurs is not clear. It is a kind of be probably different single-stranded AAV genomes+chain and-chain hybridize when replicating, as formerly reported having many AAV weights During group son infection.Sequence evolution occurs for not clear be result in the presence or absence of other mechanism when AAV infects.When AAV is replicated Mutation sum frequency it is relatively low, test data does not also support high-frequency copy error occur.But have been reported confirmation and exist The rearrangement of AAV genomes can cause interference with the formation of particle defect during lytic infection.No matter cause sequence variations Mechanism is how, without exception be that the vp1 structures of quasispecies are also to maintain completely, frameshift mutation and nonsense mutation does not occur, This explanation tournament selection due to Population Dynamics makes virus be provided with optimal structure and form families.
These researchs are available for biology and several fields of medical science.The concept that quick virus is evolved is previously considered to The characteristic of RNA virus, have now found that DNA virus it can also happen that, this point is proved by serological analysis.For tiny disease For poison, develop a kind of new method to describe virus isolated strain be highly important, this description should be able to cover its structure With the complexity of biological characteristic, such as HIV, a general family with identical 26S Proteasome Structure and Function is classified as, is referred to as Clades.It is currently searching for other strategies to classify to separation strains by serotype specificity, and proposes to describe serum Learn the standard of variation in group.
Embodiment 3：Built using the chimeric plasmid of gene containing AAV2rep and new A AV cap genes and carry AAV2ITR's Recombinate serology and gene transfer research that AAV genome vectors are used for different animals model
AAV2 rep are constructed into chimeric package carrier with the cap sequences of new A AV serotypes.These chimeric packagings Carrier is initially used to false type (pseudotyping) the restructuring AAV genomes for carrying AAV2ITR, and method used is to utilize The triple rotaring redyeing 293 cells of Ad5 helper plasmids.Before the virus of complete infectious of these new serotypes is isolated, These pseudotyped vectors are used for the feasibility for evaluating the serological research method based on transduceing and new A AV serotypes not Include the gene transfering efficiency in NHP and rodent with animal model.
A.pAAV2GFP
AAV2 plasmids contain AAV2ITR and form the green fluorescent protein under promoter control.This plasmid includes as follows Element：AAV2ITR, CMV promoter and GFP coded sequences.
B. the clone of trans plasmid
In order to build the false type AAV7 carriers that chimeric trans plasmid carrys out Prepare restructuring, p5E18 plasmids (Xiao etc., 1999, J.Virol 73:3994-4003) use Xho I partial digested so that plasmid linearization, the plasmid only have one at 3169bp Xho I sites.Then connected by Xho I digestions end-fillings and then from newly.This engineered p5E18 plasmids Xba I and Xho I complete degestions are to remove AAV2cap gene orders, and with the 2267bp Spe I/Xho of a gene containing AAV7cap I fragments are replaced, and the fragment is cut from pCRAAV76-5+15-4 plasmids.
AAV2rep the sequences Rep78/68 and AAV2P19 that resulting plasmid contains under the control of AAV2P5 promoters start AAV2rep sequences Rep52/40 under son control.AAV7 capsid sequences are located under the control of AAV2P40 promoters, the sequence position In in Rep sequences.This plasmid also contains Insert Fragment 5'rep ORF.
C. false type rAAV preparation
RAAV particles (the AAV2 carriers of the capsid containing AAV7) are prepared with the method without adenovirus.Mainly comprise the following steps, will Cis plasmid (the pAAV2.1lacZ plasmids containing AAV2ITR), trans plasmid pCRAAV76-5+15-4 (containing AAV2rep and AAV7cap) and helper plasmid while rotaring redyeing 293 cell, its ratio are 1:1:2, transfection method is calcium phosphate precipitation.
In order to build pAd helper plasmids, plasmid pBG10 is have purchased from Microbix (Canada).Cut from pBHG10 One RsrII fragment containing L2 and L3 obtains the first helper plasmid pAd Δs F13.Cut from pBHG10 and next contain PmeI/Sgfl The Asp700/SalI fragments of missing, which are cloned into Bluescript, obtains plasmid Ad Δs F1.MLP, L2 are deleted from pAd Δs F1, L2 and L3.Then delete a 2.3kb NruI fragment respectively and a 0.5kb RsrII/NruI fragment obtains helper plasmid PAd Δ F5 and pAd Δs F6.The helper plasmid for being named as p Δs F6 has miscellaneous function necessary to E2a and E4 ORF6, and this is E1 expression auxiliary cell does not have, but this plasmid does not contain adenovirus capsid proteins and functional E1 areas.
Generally by 50 μ g DNA (cis plasmids:Trans plasmid:Helper plasmid) it is transfected into a 150mm tissue culture dishes In.After transfection 72 hours harvest 293 cells, ultrasonication and with 0.5% deoxycholic aicd receive processing (10 min.).Cell Lysate is through CsCl centrifugations twice.The peak fractions of the carrier containing rAAV are collected, is placed in container and uses PBS.
Embodiment 4：The infection clones for carrying complete new A AV serotypes are prepared in the cell line in people and NHP sources Its basic virology characteristic is studied, and the pathogenic of new A AV serotypes is evaluated in NHP and other animal models.
To reach this purpose, obtain 5' and 3' end sequences (ITR) with genomeWalker system and complete containing complete new The structure of the clone of AAV serotype genomes.
In short, using commercialized Universal Genome Walker Kit [Clontech], by monkey tissue and carefully Genomic DNA Dra I, EcoR V, the Pvu II and Stu I digestion with restriction enzyme in born of the same parents system source are simultaneously connected to Genome Obtain 4 individual Genome Walker Libraries (GWLs) on Walker Adaptor, in these genomic DNAs It is proved containing AAV7 sequences.GWLs DNA is template, and PCR amplifies AAV7 and its adjacent genome sequence, used Primer is adapter primer 1 (AP1, kit provide) and AAV7 specific primers 1, then use again adapter primer 2 (AP2) and Another AAV7 specific primer 2 carries out nested PCR, and the two primers are all in first group of primer.Obtained by nested PCR Primary product is cloned and carries out sequence analysis.
In this experiment, the primer for covering 257bp fragments or AAV genomes other labeled fragments is used for PCR amplifications The cell DNA extracted from people and NHP cell lines is to identify and identify the presence or absence of AAV sequences.Utilize different plant species and difference The helper adenovirus of strain can recover this latent AAV genomes from positive cell line.
In order to which classification has infective AAV clones out of NHP sources cell line, required cell is obtained from ATCC System, then screened with PCR method to identify 257bp amplicon, i.e. characteristic area of the invention.By 257bp PCR primer gram It is grand and pass through its serotype of sequencing analysis.The cell line of these sequences containing AAV7 with the simian adenovirus SV-15 bought from ATCC, People Ad5 infects, or the plasmid transfection with the genes of Ad containing people, this Ad gene code AAV miscellaneous function.Infection or transfection 48 are small When monkey, harvesting, according to Xiao etc., 1999, J.Virol, 73:3994-4003 description prepares Hirt DNA and is used for AAV7 The clone of genome.
Embodiment 5：The structure of AAV carriers
AAV1, AAV5 and AAV8 are packaged with using with the same false type construction of strategy that AAV1/7 in embodiment 3 is taken The AAV2 carriers of capsid protein.Briefly it is described below, it is triple by cis plasmid, adenoviral helper plasmid and chimeric package carrier Rotaring redyeing 293 cell packaging carries AAV2ITR restructuring AAV genomes, wherein AAV2rep genes and the cap of new A AV serotypes Gene Fusion is together.In order to build chimeric package carrier, the Xho I sites at 3169bp on plasmid p5E18, modification are removed Plasmid again with Xba I and Xho I complete degestions to remove AAV2cap genes, and with gene containing AAV8cap 2267bp Spe I/Xho I fragments replace [Xiao, W. etc., (1999) J Virol 73,3994-4003].With same strategy Build AAV2/1 and AAV2/5 chimeric packaging plasmid.In addition to AAV2/2, all recombinant vectors all use standard CsCl2Sedimentation Method is purified, and AAV2/2 is purified with heparin chromatographic column by a step.
Copy (GC) titre of AAV carriers in genome is passed through with the specific probe in AV40polyA areas and primer TaqMan analyzes to determine, [Gao, G. etc., (2000) the Hum Gene Ther 11,2079- reported such as former document 91]。
Every kind of serotype all carrier constructions in order to testing in vivo and in vitro.8 different transgene expression cassettes are inserted into In carrier, the recombinant virus particle of every kind of serotype is then prepared.According to its genome copy numbers, the viral count of recovery is listed in In following table 4.The carrier output of every kind of serotype is all very high, but the difference between serotype is different.Listed data in table It is average value plus-minus standard deviation × 10 of the genome copy numbers of more batches of 50 flat boards (150mm) transfections13。
The preparation of the recombinant virus of table 4.
Embodiment 6：The serological analysis of pseudotyped vector
Different serotypes (5 × 10 to C57BL/6 mouse muscle injection of AAV CBA1AT carriers11GC), collected after 34 days Sample.In order to detect the neutralizing antibody and cross-neutralization antibody that whether there is every kind of AAV serotypes in serum, to transduce as base The neutralizing antibody analytical serum [Gao, G.P. etc., (1996) J Virol 70,8934-43] of plinth.In order to improve spy The opposite sex, suppressed by evaluating serum different serotypes reporter virus (AAVCMVEGFP) transduce 84-31 cells ability come it is true Determine the presence of neutralizing antibody.Reporter virus AAVCMVEGFP [multiplicity of infection (the multiplicity of of every kind of serotype Infection) (MOI) can infect 90% indicator cells] animals of different from receiving AAV serotypes or control mouse source Hot inactivated serum is incubated altogether.After 37 DEG C are incubated 1 hour, virus is added in 96 orifice plates of the cell containing 84-31, according to different diseases Serotypes, it is incubated 48 or 72 hours.It is used in combination with FluoroImagin (Molecular Dynamics) measure GF P expression Image Quant Software are quantified.The titre of neutralizing antibody is defined as can be by the highest serum for being suppressed to less than 50% of transduceing Dilution factor.
The application of GFP expression vectors simplifies the analysis method of neutralizing antibody, and this method is based on to allowing cell line (i.e. Stable expression Ad5 E4 293 cells) transduction suppression.The antiserum of AAV serotypes is recombinated by being injected to animal muscle It is viral and preparation.1:20 and 1:The antiserum of 80 dilution factors is analyzed the (table seen below to the AAV neutralizations transduceed 5).AAV1, AAV2, AAV5 and AAV8 antiserum can suppress transduction (AAV5 and the AAV8 of the serotype in the antiserum source Inhibitory action it is weaker than AAV1 and AAV2), but can not suppress other serotypes transduction (there is no indication that in the presence of intersect Neutralization, it is real distinct serotype to illustrate AAV8).
The serological analysis of the new A AV serotypes of table 5.
The sample of serotype selected by neutralizing is screened from the serum of 52 normal persons.As a result not finding to neutralize AAV2/7 and AAV2/8 serum samples, and 20% and 10% serum can neutralize AAV2/2 and AAV2/1 carriers respectively.It is a kind of Mixing IgG represents the serum sample of 60000 collected people, and the mixture can not neutralize AAV2/7 and AAV2/8, still AAV2/2 and AAV2/1 carriers are neutralized by titre by 1/1280 and 1/640 sample respectively.
Embodiment 7：Evaluated inside AAV carrier different serotypes
In this experiment, 7 kinds of restructuring AAV genomes, AAV2CBhA1AT, AAV2AlbhA1AT, AAV2CMVrhCG, AAV2TBGrhCG, AAV2TBGcFIX, AAV2CMVLacZ and AAV2TBGLacZ are packaged with the capsid protein of different serotypes. In all 7 in carrier, the both sides of mini gene expression cassette are all AAV2ITR.People's α-antitrypsin (A1AT) [Xiao, W. etc., (1999) J Virol 73,3994-4003], macaque human chorionic gonadtropin (CG) beta subunit [Zoltick, P.W.＆ Wilson, J.M. (2000) Mol Ther 2,657-9], dog factors IX [Wang, L. etc., (1997) Proc Natl Acad Sci U S A 94,11563-6] and bacteria beta-galactosidase (i.e. Lac Z) gene cDNA as reporter gene.For straight For the liver gene transfer connect, with mouse albumin gene promoter (Alb) [Xiao, W. (1999), referenced above] or people's first Shape glandular hormone haptoglobin gene promoter (TBG) [Wang (1997), referenced above] drives reporter gene in liver Tissue specific expression.For the transfer of direct muscle cdna, with cytomegalovirus early promoter (CMV) or chicken β-flesh Filamentous actin promoter carrys out the expression of control report gene plus cmv enhancer (CB).
If carrying out gene transfer by direct intramuscular injection, be exactly by vector injection to 4-6 week old NCR nude mices or Calf is intramuscular before the right side shin of C57BL/6 mouse (Taconic, Germantown, NY).If directly liver gene transfer, just It is to arriving 7-9 week old NCR nude mices or C57BL/6 mouse (Taconic, Germantown, NY) by carrier by introportal infusion Liver in.After vector injection serum sample is collected at different time points.In different time point collection injection LacZ carriers Mouse muscle and hepatic tissue make freezing microtome section and carry out Xgal histochemical stains.In the experiment of repeat administration, C56BL/6 mouse by intramuscular injection AAV2/1,2/2,2/5,2/7 and 2/8CBA1AT carriers, detect the expression of A1AT genes first 7 weeks.Then injection of AAV 2/8TBGcFIX and the expression of cFIX genes is detected in portal vein.
Elisa assay is used to quantitatively detect above-mentioned hA1AT, the serum levels of rhCG and cFIX albumen [Gao, G.P. etc., (1996) J Virol 70,8934-43；Zoltick, P.W.＆Wilson, J.M. (2000) Mol Ther 2,657-9；Wang, L. etc., Proc Natl Acad Sci U S A 94,11563-6].Animal is put to death during off-test, gathers muscle and liver group Knit, therefrom extract DNA, quantified using one group of primer and probe as preparing the titre of carrier with measure by TaqMan methods Analyze existing vector copies [Zhang, Y. etc., (2001) Mol Ther 3,697- of the invention in target tissue genome 707]。
The carrier in new serotype source is evaluated in the mouse model that direct muscle and liver gene shift, and with The carrier in serotypes A AV1, the AAV2 and AAV5 sources known is compared.Express the carrier (α-antitrypsin of secretory protein (A1AT) and human chorionic gonadtropin (CG)) as index different serotypes are quantitative determined by the elisa assay of serum Between relative transduction efficiency.The distribution of transduction vector in the cell is texturized with LacZ expression vectors and X-gal in target organ Method is evaluated.
Carrier is injected directly into before the shin of mouse that calf is intramuscular to be analyzed by AAV carriers acting through in skeletal muscle. Carrier contains identical AAV2 genomes and CMV immediately-early genes, the beta-actin that the expression of the gene is strengthened by AMC Promoter controls.Previous studies show when AAV vector expression people's A1AT albumen there is the C57BL/6 of complete immunocompetence Mice Body interior energy excites limited humoral immune reaction [Xiao, W. etc., (1999) J Virol 73,3994- for the albumen 4003]。
In various carriers, the horizontal highests of A1AT caused by AAV2/1 carriers, AAV2/2 carriers are minimum, AAV2/7 and AAV2/8 carriers are in therebetween.Nu/nu NCR mouse injection carrier after 28 days CG expression reach peak value, wherein AAV2/7 highests, AAV2/2 is minimum, and AAV2/8 and AAV2/1 are positioned there between.After injection of AAV 2/1 and AAV2/7lacZ carriers Can produce gene expression in all muscle fibres of injection site, and after injection of AAV 2/2 and the carriers of AAV 2/8 it is observed that LacZ positive myofibers want low more.Transduction efficiency and AAV2/1 of these as shown by data AAV2/7 carriers in skeletal muscle be The same, and be that skeletal muscle transduction efficiency highest in the serotype reported in the past [Xiao, W. (1999), is cited above； Chao, H. etc., (2001) Mol Ther 4,217-22；Chao, H. etc., (2000) Mol Ther 2,619-23].
Direct liver gene transfer is evaluated with same mouse model.The carrier note in same dose of genome copies source It is mapped to the portal vein of mouse., then analyze the expression of transgenosis.Every kind of carrier all contains AAV2 genomes, special with above-mentioned liver Specific Promoters (i.e. the promoter of albumin or thyroid hormone binding globulin) drive the expression of transgenosis.More specifically It is that CMVCG and TBGCG mini gene expression cassettes are used in direct muscle and liver gene transfer respectively.RhCG expression use is relatively single Position (RUs × 103) represent.Data come from the blood serum sample (every group of 4 animals) of 28 days after vector injection.As shown in table 3, Capsid protein is to transduction efficiency of the A1AT carriers in nu/nu and C57BL/6 Mice Bodies and CG carriers in C57BL/6 Mice Bodies The influence of interior transduction efficiency is consistent (being shown in Table 6).
The expression of table 6. macaque human chorionic gonadtropin (rhCG) beta subunit
* do not detected in this experiment
Transgene expression level highest caused by AAV2/8 carriers, it is 16-110, higher than AAV2/2 in all examples Carrier；Therebetween, but AAV2/7 is higher than AAV2/5 to AAV2/5 and AAV2/7 carriers again.Inject corresponding lacZ carriers The hepatic tissue section of animal finds phase be present between the number of transducer cell and the expression aggregate level of transgenosis after X-gal is dyed Pass relation.Carrier DNA in the DNA for receiving to be extracted in the C57BL/6 murine liver tissues of A1AT carriers is analyzed using real time pcr Abundance.
After injection in 56 days hepatic tissues the amount of carrier DNA and the expression of transgenosis into dependency relation (being shown in Table 7).This In experiment, devise the specific probe in one group of vector gene group SV40polyA area and primer is used for TaqMan PCR.It is represented Numerical value be three animals average value plus-minus standard deviation.Animal is killed within 56 days after injection, collection hepatic tissue extracts its DNA.This A little experiments show that AAV8 is that direct liver gene shifts maximally effective carrier, because the liver cell number of its transduction is most.
Table 7-injection 1x1011With AAV carriers in real-time PCR analysis nu/nu murine liver tissues after the carrier of genome copies Abundance
Serology data above shows to be neutralized with other serotypes AAV2/8 carriers internal after immune. The A1AT carriers of C57BL/6 mouse muscles injection different serotypes introportal infusion expression dog factors IX (10 after 56 days11Genome Copy) AAV2/8 carriers.It is empty that the highest level of factors IX expression appears in AAV2/8 carriers (17 ± 2 μ g/ml, n=4) injection 14 days after white animal, with injection of AAV 2/1 (31 ± 23 μ g/ml, n=4), AAV2/2 (16 μ g/ml, n=2) and AAV2/7 (12 μ G/ml, n=2) animal there was no significant difference.Institute in animal is immunized in this result and the AAV2/8 of AAV2/8 factors IX vector injections It was observed that result on the contrary, without detect factors IX (<0.1 μ g/ml, n=4).
It can be amplified really from macaque using the specific oligonucleotides in cap genes conserved region and represent unique AAV's Sequence.Consistent cap characteristic area sequences can be detected in the Various Tissues of the macaque of at least two different clones.From one Rep the and cap open reading frames of total length are separated in source and are sequenced.Needs assessment new A AV cap open reading frames As the ability of carrier, because the carrier of the capsid containing AAV7 or AAV8 is prepared with AAV2 ITR and rep.This can also letter Change the comparison of different carriers, because the actual vector genome of different carriers serotype is consistent.In fact, utilize this side The generation of recombinant vector prepared by method indifference between different serotype.
AAV7 and AAV8 carriers have unique amynologic characteristic, and (i.e. they can not be by the antibody institute of other anti-serotypes With).Moreover, human serum can not neutralize the transduction of AAV7 and AAV8 carriers, therefore they are than the people source studied now [Chirmule, N. etc., (1999) Gene Ther 6,1574-83].
The taxis of every kind of novel carriers is suitable for vivo applications.The efficiency and AAV2/1 of AAV2/7 carrier transduction skeletal muscle It is similar, the latter be up to the present detected primate AAV in skeletal muscle transduction efficiency highest [Xiao, W., It is referenced above；Chou (2001), it is referenced above, and Chou (2000), it is referenced above].It will be appreciated, however, that In the gene transfer of liver, AA2/8 efficiency is higher than other serotypes, and up to the present, not finding can also stable transfection liver The gratifying carrier of cell.Compared with other carriers, AAV2/8 gene transfering efficiency can improve 10 to 100 times. The mechanism of AAV2/8 high transduction efficiency is not clear, although some have speculated that being probably by it absorbs relied on acceptor and its His carrier is different, and this receptor has higher activity in the base side surface of liver cell.This efficient carrier is for direct Liver gene transfer it is quite useful because treat urea cycle disorder and during familial hypercholesterolemia transducer cell number Mesh is very crucial.
Therefore, genome sequence is retrieved to separate new A AV by PCR the invention provides a kind of novel method.Amplification The sequence gone out is easy to be cloned into carrier and detected in animal body.Due to immune and load to AAV7 being not present in human body The taxis of body is suitable to transfection musculature, therefore AAV7 is suitable for as gene therapy of the carrier for human body and others Vivo applications.Similarly, since lacking the immune and its taxis to AAV serotypes of the present invention, these AAV are made to be controlled available for transfer Treat molecule or other useful molecules.
9-tissue tropisms of embodiment are studied
When designing high flux functionality screening scheme constructses new A AV carriers, select non-tissue specificity and high living Property promoter, the CB promoters chicken β actin promoters of enhancing (CMV) come drive one it is being easy to detection and can determine Measure reporter gene-people's alpha antitrypsin gene of detection.Each new A AV clones only need to build a carrier to carry out base Because of the research of transfer, specific AAV carriers are detected to three kinds of different target tissues, the taxis of liver, lung and muscle.Following table summarises 4 Data of the kind new A AV carriers obtained by tissue tropisms are studied in (AAVCBA1AT).It was found that wherein new A AV capsids gram Grand 44.2 all 3 kinds tissue in be all fabulous gene transfer vehicle, particularly in lung tissue.Table 8 reports experiment The data (μ g A1AT/mL serum) of 14 days.
Table 8
Other experiment has also been carried out in addition further to confirm super taxises of the AAV 44.2 in lung tissue.It is first First, the AAV carriers and new A AV capsid vacation type that the specific expressed CC10hA1AT mini genes of lung tissue will be carried, then note Penetrate and give immunodeficient animals (NCR nude mices), it is as shown in the table, by the carrier of Intratracheal instillation equivalent (each μ l stostes of animal 50, Do not dilute).In table 9, every μ l stostes of NCR nude mices 50, Monitoring lower-cut is 0.033 μ g/ml, and detection time is the 28th day.
Table 9
Also it is vector injection is identical to the animal (C57BL/6) with complete immunocompetence, gene copy number used (1x1011GC), as shown in table 10.(every animal 1x1011GC, C57BL/6,14 day, Monitoring lower-cut are 0.033 μ g/ml).
Table 10
The data of two experiments all confirm super taxis of the clone 44.2 in the transfer of direct lung cdna.
Interestingly, performance of the clone 44.2 in direct liver and muscle cdna transfer is also very prominent , the level reached close to optimal liver transduction vector AAV8 and optimal muscle transduction vector AAV1, illustrate that this is new AAV has the biological meaning extremely to induce one.
In order to study the serological characteristic of these new serotypes, false type AAVGFP vector immunity rabbits are prepared for, and In the presence of or lack different capsids it is sero-fast in the case of ex vivo transduction 84-31 cells.Overview of the data is as follows.
Intersection-NAB analyses intracellular table 11a.8431 and Adv coinfections
8431 cell infection following carriers (with Adv coinfections)：
Intersection-NAB analyses intracellular table 11b.8431 and Adv coinfections
8431 cell infection following carriers (with Adv coinfections)：
Table 12
Table 13a. infects 8431 cells (Adv coinfections) with GFP carriers
Table 13b. infects 8431 cells (coinfection Adv) with GFP carriers
The mouse model of 10-familial hypercholesterolemia of embodiment
Following experiment is used to prove that the AAV2/7 carriers of the present invention can shift ldl receptor and can express effective dose Ldl receptor is to reduce the level of blood plasma cholesterol level and triglyceride in familial hypercholesterolemia animal model body.
A. the structure of carrier
AAV carriers with AAV7 or AAV8 capsid proteins utilize false type construction of strategy [Hildinger M etc., J.Virol 2001；75:6199-6203].The restructuring AAV genomes for carrying AAV2 inverted terminal repeat sequences (ITR) are by using cis matter Grain, adenoviral helper plasmid and the triple rotaring redyeing 293 cells of chimeric package carrier and be packaged into, chimeric package carrier It is to be formed by the capsid of new A AV serotypes and AAV2 rep Gene Fusions.Chimeric packaging plasmid is by previously described Method structure [Hildinger etc., referenced above].The CsCl of recombinant vector standard2Intermediate processing purifies.In order to true The yield of fixed virus, TaqMan (Applied are carried out using the specific probe in carrier S V40polyA areas and primer Biosystems [Gao GP etc., Hum Gene Ther.2000 Oct 10) are analyzed；11(15):2079-91].Obtained carrier Express the transgenosis under human thyroid stimulator's haptoglobin gene promoter (TBG) control.
B. animal
The ldl receptor deficient mice in C57Bl/6 sources is bought from Jackson laboratories (Bar Harbor, ME, USA) , raised as reproductive cloning.Mouse drinking-water is not limited, starts within 3 weeks to feed high fat Western Diet (courages before vector injection Sterol percentage composition is high).By taking blood to gather blood sample at 0 day and 7 days after socket of the eye, lipids contents are determined.Mouse is randomly divided into 7 Group.As described previously by introportal infusion carrier [Chen SJ etc., Mol Therapy 2000；2 (3), 256-261].Letter speech It, mouse ketamine and Xylazine anesthesia, with 30g syringe draw suitable dosage with 100ul PBS dilutions Carrier is injected directly into portal vein.Injection site is pressed to stop blooding.Skin suture wound, carefully examined within the ensuing time Survey mouse.Taken a blood sample weekly 14 days to determine lipids contents after the transfer of direct liver gene.After injection 6 weeks and 12 weeks when it is every Group puts to death 2 animals, determines the size of athero- artery sclerosis and the expression of acceptor.Remaining mouse was put to death simultaneously at 20 weeks Determine the size of athero- artery sclerosis and the expression of acceptor.
Table 14
Carrier Dosage n
Group 1 AAV2/7-TBG-hLDLr 1x 1012gc 12
Group 2 AAV2/7-TBG-hLDLr 3x 1011gc 12
Group 3 AAV2/7-TBG-hLDLr 1x 1011gc 12
Group 4 AAV2/8-TBG-hLDLr 1x 1012gc 12
Group 5 AAV2/8-TBG-hLDLr 3x 1011gc 12
Group 6 AAV2/8-TBG-hLDLr 1x 1011gc 12
Group 7 AAV2/7-TBG-LacZ 1x 1011gc 16
C. serum lipoprotein and liver function analysis
Plexus vasculosus gathers blood sample after socket of the eye after fasting 6 hours.Serum is prepared from blood plasma by centrifugation.It is raw with clinic Change automatic analyzer (ACE, Schiapparelli Biosystems, Alpha Wassermann) measure serum in lipoprotein and The plasma content of liver transaminase.
D. the detection of transgene expression
Pass through immunofluorescence dyeing and the expression of Western blot analysis ldl receptor.With lysis buffer (20mM Tris, pH7.4,130mM NaCl, 1%Triton X 100, protease inhibitors (complete, no EDTA, Roche, Mannheim, Germany)) liver tissue homogenate of freezing is used for Western blot analysis.Utilize Micro BCA Protein Assay Reagent Kit (Pierce, Rockford, IL) determine protein concentration.40 μ g albumen are dissolved in 4-15%Tris-HCl In Ready Gels (Biorad, Hercules, CA), it is then transferred on nitrocellulose filter (Invitrogen).In order to make The antibody of standby anti-hLDL acceptors, give intravenous rabbit injection AdhLDLr prep (1x1013GC).Rabbit anteserum is gathered after 4 weeks to be used for Western blot.With 1:The serum of 100 dilutions, to connect HRP anti-rabbit IgG, then carries out ECL chemiluminescences as primary antibody Detect (ECL western blot detection kits, Amersham, Arlington Heights, IL).
E. immunohistochemistry
The expression of ldl receptor in freezing hepatic tissue section is analyzed with Cell immunohistochemical staining method.10um freezing microtome sections Either 5 minutes are fixed with acetone or do not fix.Lowlenthal serum with 10% is incubated progress in 1 hour altogether.Then section and primary antibody It is incubated 1 hour altogether at room temperature, dilutes rabbit-anti people's LDL polyclonal antibodies (Biomedical according to the explanation of producer Technologies Inc., Stoughton, MA), it is then added in section.With PBS washing slices, then with 1:100 dilutions Fluorescence labeling goat anti-rabbit igg (Sigma, St Louis, MO) altogether be incubated.Finally in fluorescence microscope Nikon Microphot- FXA observation sections.In all examples, each step incubation will thoroughly be washed after terminating with PBS.Negative control preincubate is used PBS, primary antibody is replaced with the nonimmune control antibodies of homotype matching.Each experiment is setting three species above-mentioned on the same day The control of type.
F. gene transfering efficiency
Its hepatic tissue is taken after putting to death animal at predetermined time point, quick freeze in liquid nitrogen is organized in, is then stored at -80 It is DEG C standby.DNA is extracted from hepatic tissue to specifications with QIAamp DNA Mini Kit (QIAGEN GmbH, Germany). Carried using the above-mentioned specific primer and probe of AV40poly (A) tail by Taqman analyses to determine AAV in hepatic tissue The genome copy numbers of body.
G. the measurement of atherosclerotic plaque
In order to measure the size of mouse intra-arterial atheromatous plaque, slurry mouse anesthesia (10% ketamine and Xylazine, vein note Penetrate), thoracic cavity is opened, irrigates the phosphate-buffered salt of frost into arterial system from left ventricle.Then carefully artery is cut, from The arch of aorta prolongs ventral midline to femoral artery and cut, and is then fixed with formaldehyde.Atherosclerotic plaque rich in lipid is used Sudan IV (Sigma, Germany) are dyed, and artery is followed closely in black paraffin surface with pin, colored with Sony DXC-960MD Video camera is taken a picture.The area of atheromatous plaque and its in the Phase 3Imaging Systems of the ratio shared by whole artery surface (Media Cybernetics) is analyzed.
H.I125LDL clearance rate
Two animals of every group of detection.Every 30 seconds by tail vein by I125The LDL of-mark is (typically by Dan Rader, U Penn is provided) it is slowly injected into Mice Body (1,000,000 countings of the sterile PBS dilutions of every μ l of animal injection 100 [I125]-LDL).3min, 30min, 1.5hr, 3hr, 6hr gather blood sample from socket of the eye artery clump after injection respectively.From complete Separated plasma in blood, 10 μ l blood plasma are taken to be counted on γ calculating instruments.Final fraction metabolic rate clears data from lipoprotein falls into a trap Calculate.
I. the evaluation of liver accumulation of lipid
Liver slice oil red is dyed to determine accumulation of lipid degree.Freezing liver slice is first rinsed with distilled water, Ran Hou It is incubated 2 minutes in anhydrous propylene glycol.Oil red solution (0.5%, be dissolved in propane diols) dyeing 16 hours is put into section, then Redyed 30 seconds, be fixed in the glycerine sol solution of heating with Mayer hematoxylin solutions.
In order to determine the content of cholesterol and triglyceride in hepatic tissue, hepatic tissue section is homogenized, then in chloroform/first Alcohol (2:1) it is incubated overnight in.Add 0.05%H2SO4Centrifuge 10 minutes afterwards, collect the lower floor of each sample, be divided into two pipes, in liquid Freezed in nitrogen.In order to determine cholesterol level, the lipid freezed in the first pipe is dissolved in the 1%Triton X- dissolved with chloroform In 100.Freezed after dissolving with liquid nitrogen.It is incubated 30 minutes at 37 DEG C after lipid is dissolved in hydrogen peroxide, then uses Total Cholesterol Kit (Wako Diagnostics) determine the concentration of T-CHOL.The lyophilized lipid of second pipe is dissolved in second In alcohol KOH, it is incubated 30 minutes at 60 DEG C.Then 1M MgCl are added2, be placed on ice be incubated 10 minutes, then 14,000rpm from The heart 30 minutes.Determine the triglyceride content (Wako Diagnostics) in supernatant.
Compared with control group, false type in AAV2/8 or AAV2/7 all carriers can reduce T-CHOL, LDL and sweet The content of oily three fat.These detected carriers can correct phenotype, the AAV2/8 of hypercholesterolemia in a manner of dose-dependent With the atheromatous plaque area in AAV2/7 mouse diminution (2 months), and this effect are can also be observed that in first experiment Fruit can continue to whole experiment (6 months).
Embodiment-function factor IX expression and haemophiliachemophiliac correction
A. knock out mice
The expression of factor Ⅸ deficient mouse in vivo functionality dog factors IX (FIX) is detected.Structure carries AAV1, The carrier of AAV2, AAV5, AAV7 or AAV8 capsid sequence, the structure of the carrier is AAV25'ITR- liver tissue-specific promoters [LSP]-dog FIX-woodchuck hepatitis viruse posttranscriptional regulatory element (WPRE)-AAV23'ITR.Such as Wang, 2000, Molecular Therapy 2:It is 154-158) described to build this carrier using appropriate capsid.
The preparation method of knock out mice is shown in Wang etc., 1997.Proc.Natl.Acad.Sci.USA 94:11563- 11566 description.Phenotype of this model closest to people's hemophilia B.
The carrier of different serotypes (AAV1, AAV2, AAV5, AAV7 and AAV8) once passes through introportal infusion to adult blood In the sick C57Bl/6 Mice Bodies of friend, wherein the injection dosage of 5 kinds of different serotypes is 1x1011GC/ mouse, AAV8 vehicle groups injection compared with Low dosage, 1x1010GC/ mouse.Control group injects 1x1011GC AAV2/8TBG LacZ3.Every group of animal is only male containing 5-10 And female mice.A blood sample is gathered after vector injection every two weeks.
1.ELISA
The dog FIX concentration of mouse blood plasma kind is detected by the specific elisa assay method of dog factors IX, such as Axelrod Deng 1990, Proc.Natl.Acad.Sci.USA, 87:Described by 5173-5177, the present invention slightly changes.The anti-dog factor of goat IX antibody (Enzyme Research Laboratories) is used as primary antibody, rabbit-anti dog factors IX antibody (Enzyme Research Laboratories) it is used as secondary antibody.Start within two weeks after injection to determine the cFIX blood plasma levels of all test carrier groups.As a result find Its blood plasma level increases, during whole experiment, i.e., by 12 weeks when, treatment level can be maintained.Treatment level is considered as The 5% of normal level, i.e., about 250ng/mL.
Highest expression appears in AAV2/8 (1011) and AAV2/7 vehicle groups, reach super physiological cFIX concentration (ratio Normal level is high 10 times).AAV2/8(1011) expression about than AAV2/2 and AAV2/8 (1010) group it is high 10 times.It is minimum Expression appear in AAV2/5 groups, although also in the range for the treatment of level.
2. the detection of Activated in Vitro partial thromboplastin time (aPTT)
Functional component IX activity passes through Activated in Vitro partial thromboplastin time in FIX knock out mice blood plasma (aPTT) analysis method determines-is added to the citrate of 1/10 volume from the blood sample of socket of the eye artery clump collection mouse and delays In fliud flushing.APTT test methods such as Wang etc., 1997, Proc.Natl.Acad.Sci.USA 94:Described by 11563-11566.
Found by aPTT analyses, after injection 2 weeks when all vector injection mouse plasma samples clotting time all just In normal scope (about 60 seconds), the normal clotting time and the whole test period (12 weeks) can be continued slightly shorter than the normal coagulation time.
Continuing the most short clotting time appears in and receives AAV2/8 (1011) and AAV2/7 mouse in.During by 12 weeks, AAV2/2 can also be induced and AAV2/8 the and AAV2/7 group identical clotting times.But this shorter clotting time is known Also do not observed at 12 weeks in AAV2/2 groups, and started can at 2 weeks in AAV2/8 and AAV2/7 groups it was observed that shorter Clotting time (between the 25-40 seconds).
Hepatic tissue, which is gathered, from some treatment mouse carries out immunohistochemical staining.The mouse of injection of AAV 2/8.cFIX carriers The liver cell that 70-80% is there are about in hepatic tissue is the dog FIX positives.
B. hemophilia B dog
Found by scale-model investigation, the point mutation of dog F.IX gene catalytic domains can make the albumen of the gene expression unstable It is fixed, cause hemophilia B [Evans etc., 1989, Proc.Natl.Acad.Sci.USA, 86:10095-10099]. University of North Carolina, Chapel Hill have this dog of a group to raise more than 20 years.These dogs Homeostasis parameter had been described in detail, including lack plasma F .IX antigens, whole blood coagulation time is more than 60 Minute (normal dogs are 6-8 minutes) and activated partial thromboplastin time extend to the 50-80 seconds (normal dogs are the 13-28 seconds). These dogs can occur hematostaxis repeatedly.In general, 10ml/kg normal dogs are once injected intravenously when there is hematostaxis Blood plasma can is prevented；Needing to be transfused repeatedly once in a while to stop blooding.
Pass through introportal infusion AAV.cFIX to 4 dogs according to following scheme.First dog shot dosage is 3.7x1011Genome copies (GC)/kg AAV2/2.cFIX.Second dog elder generation injection of AAV 2/2.cFIX (2.8x1011GC/ Kg), then in the 1180th day second injection of AAV 2/7.cFIX (2.3x1013GC/kg).3rd dog shot dosage is 4.6x1012GC/kg AAV2/2.cFIX.4th dog elder generation injection of AAV 2/2.cFIX (2.8x1012GC/kg), at the 995th day Injection of AAV 2/7.cFIX (5x10 again12GC/kg)。
The hair of belly, surgical incision belly, once by vector injection to portal vein are cut after hemophilia dog general anesthesia It is interior.For bleeding during preventing operation, animal injects normal dog plasma in advance.After dog calmness, intubation inducing systemic anesthesia, Belly shaving preserved skin.Spleen is moved on in surgical field of view after hara kiri, finds the position of splenic vein, by a suture loosely Remember in near-end, cut a small otch in the distal end of vein, by syringe needle quick insertion vein, then unclamp suture, A piece 5F sleeve pipe is bolted on the vein near portal vein crotch.Inflated after hemostasis in catheter air bag, will in 5 minutes About 5.0ml is injected into portal vein with the PBS carriers diluted.Then by air bag deflation, conduit is removed, completes vein stanch.So Spleen is resetted afterwards, the blood vessel of bleeding is burnt, sews up a wound.Animal is resistant to Post operation and removes intubation completely.The analysis of blood sample is as before Described [Wang etc., 2000, Molecular Therapy 2:154-158].
As a result showing that as was expected, AAV2/7 can be corrected and the haemophiliachemophiliac symptom of partial correction.
All documents that this specification is quoted all have been hereby incorporated by referring to.In reference particularly preferred embodiment to this While invention is described, the present invention is modified without departing from the spirit of the present invention and laudable.It is this Modification should be included within the scope of the claims.

Claims (13)

1. a kind of recombinant adeno-associated virus (AAV), comprising feature AAVrh.10 capsids, the capsid is by vp1 albumen, vp2 eggs White and vp3 albumen is formed, wherein, the vp1 capsid proteins are by SEQ ID NO:The sequence that 1 to 738 amino acids are formed in 81 Composition, the restructuring AAV is also comprising 3 ' and 5 ' AAV inverted terminal repeats and the transgenosis being operatively connected with regulatory sequence Coded sequence, the regulatory sequence instruct expression of the transgene coding sequence in host cell.
2. recombinant adeno-associated virus as claimed in claim 1, wherein, the inverted terminal repeat comes from AAV2.
3. a kind of composition, include the recombinant adeno-associated virus of claim 1 or 2 and physiological compatibility carrier.
4. a kind of adeno-associated virus capsid protein, is selected from：By SEQ ID NO:The vp1 capsids that 1 to 738 amino acids form in 81 Albumen；By SEQ ID NO:The vp2 capsid proteins that 138 to 738 amino acids form in 81；With by SEQ ID NO:204 in 81 To the vp3 capsid proteins of 738 amino acids composition.
5. a kind of nucleic acid molecules for separating or synthesizing, it encodes the albumen described in claim 4.
6. nucleic acid molecules as claimed in claim 5, the nucleotide sequence is selected from：SEQ ID NO:59 nt 845-3061； SEQ ID NO:59 nt 1256-3061；With SEQ ID NO:59 nt 1454-3061.
7. a kind of nucleic acid molecules for separating or synthesizing, it encodes the albumen and feature AAV rep albumen described in claim 4.
8. a kind of host cell, has transfected nucleic acid molecules any one of claim 5-7, the transfection in vitro is carried out.
9. a kind of method for the recombinant adeno-associated virus for producing the capsid containing recombinant adeno-associated virus, include the step of culture host cell Suddenly, the host cell has：(a) molecule of AAV capsids is encoded, the AAV capsids are selected from by SEQ ID NO:In 81 1 to 738 amino acids composition vp1 capsid proteins, by SEQ ID NO:The vp2 capsid eggs that 138 to 738 amino acids form in 81 In vain and by SEQ ID NO:The vp3 capsid proteins that 204 to 738 amino acids form in 81；(b) feature rep genes；(c) weight Group adeno-associated virus inverted terminal repeat and transgenosis；(d) by recombinant adeno-associated virus inverted terminal repeat and Transgenosis is packaged into required enough miscellaneous functions in AAV capsid proteins.
10. a kind of recombinant adeno-associated virus (AAV), including at least feature AAVrh.10 capsids, the capsid by vp1 albumen, Vp2 albumen and vp3 albumen are formed, wherein, the vp3 capsid proteins are by SEQ ID NO:The sequence of 204 to 738 amino acids in 81 Row are formed, and the restructuring AAV also comprising 3 ' and 5 ' AAV inverted terminal repeats and turns base with what regulatory sequence was operatively connected Because of coded sequence, the regulatory sequence instructs expression of the transgene coding sequence in host cell.
11. composition of the one kind comprising physiological compatibility carrier and at least one recombinant adeno-associated virus (AAV), described at least one Kind recombinant adeno-associated virus includes feature AAVrh.10 capsids, and the capsid is by vp1 albumen, vp2 albumen and vp3 albumen structures Into, wherein, the vp1 capsid proteins are by SEQ ID NO:The Sequence composition of 1 to 738 amino acids in 81, the restructuring AAV is also Include 3 ' and 5 ' AAV inverted terminal repeats and the transgene coding sequence being operatively connected with regulatory sequence, the regulation Sequence instructs expression of the transgene coding sequence in host cell.
12. composition of the one kind comprising physiological compatibility carrier and at least one recombinant adeno-associated virus (AAV), described at least one Kind recombinant adeno-associated virus includes feature AAVrh.10 capsids, and the capsid is by vp1 albumen, vp2 albumen and vp3 albumen structures Into, wherein, the vp3 capsid proteins are by SEQ ID NO:The Sequence composition of 204 to 738 amino acids in 81, the restructuring AAV Also comprising 3 ' and 5 ' AAV inverted terminal repeats and the transgene coding sequence being operatively connected with regulatory sequence, the tune Save sequence and instruct expression of the transgene coding sequence in host cell.
13. a kind of nucleic acid molecules for separating or synthesizing, the molecule encoding：(a)SEQ ID NO:1 to 738 amino acids in 81 AAVrh.10vp1 capsid proteins；(b) feature rep genes；(c) adeno-associated virus inverted terminal repeat and transgenosis； Adeno-associated virus inverted terminal repeat and transgenosis is packaged into AAV capsid protein in required enough auxiliary work((d) Energy.
CN201310326978.2A 2001-11-13 2002-11-12 The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified Expired - Lifetime CN103555678B (en)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US35060701P 2001-11-13 2001-11-13
US60/350,607 2001-11-13
US34111701P 2001-12-17 2001-12-17
US60/341,117 2001-12-17
US37706602P 2002-05-01 2002-05-01
US60/377,066 2002-05-01
US38667502P 2002-06-05 2002-06-05
US60/386,675 2002-06-05
CN028270592A CN101426935B (en) 2001-11-13 2002-11-12 A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN028270592A Division CN101426935B (en) 2001-11-13 2002-11-12 A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby

Publications (2)

Publication Number Publication Date
CN103555678A CN103555678A (en) 2014-02-05
CN103555678B true CN103555678B (en) 2018-02-09

Family

ID=27502639

Family Applications (6)

Application Number Title Priority Date Filing Date
CN201310326978.2A Expired - Lifetime CN103555678B (en) 2001-11-13 2002-11-12 The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified
CN201310326905.3A Expired - Lifetime CN103555677B (en) 2001-11-13 2002-11-12 The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified
CN201310326869.0A Expired - Lifetime CN103589692B (en) 2001-11-13 2002-11-12 The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified
CN201610112637.9A Expired - Lifetime CN105671005B (en) 2001-11-13 2002-11-12 Methods for detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified
CN201110081897.1A Expired - Lifetime CN102181480B (en) 2001-11-13 2002-11-12 Detect and/or identify the method for the novel sequences that adeno associated virus (AAV) sequence and separation are identified
CN201310326627.1A Expired - Lifetime CN103555676B (en) 2001-11-13 2002-11-12 The method of the novel sequences that detection and/or qualification adeno associated virus (AAV) sequence and separation are identified

Family Applications After (5)

Application Number Title Priority Date Filing Date
CN201310326905.3A Expired - Lifetime CN103555677B (en) 2001-11-13 2002-11-12 The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified
CN201310326869.0A Expired - Lifetime CN103589692B (en) 2001-11-13 2002-11-12 The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified
CN201610112637.9A Expired - Lifetime CN105671005B (en) 2001-11-13 2002-11-12 Methods for detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified
CN201110081897.1A Expired - Lifetime CN102181480B (en) 2001-11-13 2002-11-12 Detect and/or identify the method for the novel sequences that adeno associated virus (AAV) sequence and separation are identified
CN201310326627.1A Expired - Lifetime CN103555676B (en) 2001-11-13 2002-11-12 The method of the novel sequences that detection and/or qualification adeno associated virus (AAV) sequence and separation are identified

Country Status (23)

Country Link
US (15) US20030138772A1 (en)
EP (4) EP2341068B1 (en)
JP (6) JP3958191B2 (en)
KR (2) KR101015854B1 (en)
CN (6) CN103555678B (en)
AT (2) ATE317916T1 (en)
AU (1) AU2002361573B2 (en)
BR (3) BR122016004546B8 (en)
CA (8) CA2864537C (en)
DE (1) DE60209193T2 (en)
DK (1) DK1310571T3 (en)
ES (3) ES2439515T3 (en)
HK (2) HK1056198A1 (en)
HU (2) HU229379B1 (en)
IL (11) IL270065B2 (en)
MX (3) MX346493B (en)
NO (4) NO334379B1 (en)
NZ (7) NZ532635A (en)
PH (2) PH12014501487B1 (en)
PL (4) PL220644B1 (en)
SG (5) SG157224A1 (en)
WO (1) WO2003042397A2 (en)
ZA (1) ZA200403360B (en)

Families Citing this family (511)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2265460A1 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services Aav4 vector and uses thereof
ATE402254T1 (en) 1998-05-28 2008-08-15 Us Gov Health & Human Serv AAV5 VECTORS AND THEIR USE
US20040121335A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US7226739B2 (en) 2001-03-02 2007-06-05 Isis Pharmaceuticals, Inc Methods for rapid detection and identification of bioagents in epidemiological and forensic investigations
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US20030027135A1 (en) 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US7217510B2 (en) 2001-06-26 2007-05-15 Isis Pharmaceuticals, Inc. Methods for providing bacterial bioagent characterizing information
CA2864537C (en) * 2001-11-13 2016-11-29 The Trustees Of The University Of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
DK1453547T3 (en) * 2001-12-17 2016-12-05 Univ Pennsylvania ADENOASSOCATED VIRUS (AAV) SEROTYPE 8 SEQUENCES, VECTORS CONTAINING THESE AND APPLICATIONS THEREOF
ES2664505T3 (en) * 2001-12-17 2018-04-19 The Trustees Of The University Of Pennsylvania Sequences of serotype 9 of adeno-associated virus (AAV), vectors containing them, and uses thereof
DE60310297T2 (en) * 2002-04-29 2007-06-06 Trustees Of The University Of Pennsylvania Method for direct recovery and amplification of integrated viruses from cellular tissue DNA
US7419817B2 (en) 2002-05-17 2008-09-02 The United States Of America As Represented By The Secretary Department Of Health And Human Services, Nih. Scalable purification of AAV2, AAV4 or AAV5 using ion-exchange chromatography
US7220577B2 (en) * 2002-08-28 2007-05-22 University Of Florida Research Foundation, Inc. Modified AAV
CA2508726A1 (en) 2002-12-06 2004-07-22 Isis Pharmaceuticals, Inc. Methods for rapid identification of pathogens in humans and animals
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
WO2005017101A2 (en) 2003-05-19 2005-02-24 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH & HUMAN SERVICES, NATIONAL INSTITUTES OF HEALTH Avian adenoassociated virus (aaav) and uses thereof
PT3235827T (en) 2003-06-19 2021-04-09 Genzyme Corp Aav virons with decreased immunoreactivity and uses therefor
US9441244B2 (en) 2003-06-30 2016-09-13 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US9233131B2 (en) * 2003-06-30 2016-01-12 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
AU2010201278B2 (en) * 2003-09-01 2012-11-15 Academisch Medisch Centrum AAV vectors for in vivo gene therapy of rheumatoid arthritis
US8529885B2 (en) * 2003-09-01 2013-09-10 Academisch Medisch Centrum AAV vectors for in vivo gene therapy of rheumatoid arthritis
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US20120122099A1 (en) 2003-09-11 2012-05-17 Rangarajan Sampath Compositions for use in identification of bacteria
AU2011250849B2 (en) * 2003-09-30 2013-09-12 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) clades, sequences, vectors containing same, and uses therefor
HUE033158T2 (en) 2003-09-30 2017-11-28 Univ Pennsylvania Adeno-associated virus (AAV) clades, sequences, vectors containing same, and uses thereof
US8137960B2 (en) 2003-12-04 2012-03-20 The United States Of America As Represented By The Department Of Health And Human Services Bovine adeno-associated viral (BAAV) vector and uses thereof
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
ES2361000T3 (en) 2004-04-28 2011-06-13 The Trustees Of The University Of Pennsylvania SEQUENTIAL SUPPLY OF IMMUNOGENIC MOLECULES THROUGH ADMINISTRATIONS OF AN ADENOVIRUS AND AN ADENO-ASSOCIATED VIRUS.
JP2007535541A (en) 2004-04-28 2007-12-06 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Immunization scheme using E4-deleted adenovirus primary immunization and E1-deleted adenovirus booster immunization
CA2567839C (en) 2004-05-24 2011-06-28 Isis Pharmaceuticals, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US20050266411A1 (en) 2004-05-25 2005-12-01 Hofstadler Steven A Methods for rapid forensic analysis of mitochondrial DNA
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
EP1771571A2 (en) * 2004-07-30 2007-04-11 Targeted Genetics Corporation Recombinant aav based vaccine methods
US7309589B2 (en) * 2004-08-20 2007-12-18 Vironix Llc Sensitive detection of bacteria by improved nested polymerase chain reaction targeting the 16S ribosomal RNA gene and identification of bacterial species by amplicon sequencing
KR20070056138A (en) * 2004-10-05 2007-05-31 메르츠 파마 게엠베하 운트 코. 카가아 Novel cyclic and acyclic propenones for treating cns disorders
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
CA2600184A1 (en) 2005-03-03 2006-09-08 Isis Pharmaceuticals, Inc. Compositions for use in identification of adventitious viruses
EP3603676A1 (en) 2005-04-07 2020-02-05 The Trustees of the University of Pennsylvania Method of increasing the function of an aav vector
WO2006119432A2 (en) * 2005-04-29 2006-11-09 The Government Of The U.S.A., As Rep. By The Sec., Dept. Of Health & Human Services Isolation, cloning and characterization of new adeno-associated virus (aav) serotypes
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
EP1957678B1 (en) * 2005-11-28 2012-06-13 Ibis Biosciences, Inc. Compositions for use in identification of adventitious contaminant viruses
US7588772B2 (en) 2006-03-30 2009-09-15 Board Of Trustees Of The Leland Stamford Junior University AAV capsid library and AAV capsid proteins
EP2018421B1 (en) 2006-04-28 2012-12-19 The Trustees of the University of Pennsylvania Scalable production method for aav
AU2007277392A1 (en) * 2006-07-25 2008-01-31 Celladon Corporation Extended antegrade epicardial coronary infusion of adeno-associated viral vectors for gene therapy
JP5420412B2 (en) 2006-09-14 2014-02-19 アイビス バイオサイエンシズ インコーポレイティッド Targeted whole genome amplification method for pathogen identification
JP5680304B2 (en) 2007-02-23 2015-03-04 アイビス バイオサイエンシズ インコーポレイティッド Rapid forensic DNA analysis
DK2623605T3 (en) 2007-04-09 2019-03-25 Univ Florida RAAV VECTOR COMPOSITIONS WITH TYROSIN MODIFIED CAPSIDE PROTEINS AND PROCEDURES FOR USE THEREOF
US9725485B2 (en) 2012-05-15 2017-08-08 University Of Florida Research Foundation, Inc. AAV vectors with high transduction efficiency and uses thereof for gene therapy
US9611302B2 (en) 2007-04-09 2017-04-04 University Of Florida Research Foundation, Inc. High-transduction-efficiency RAAV vectors, compositions, and methods of use
WO2008151023A2 (en) 2007-06-01 2008-12-11 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
EP2058401A1 (en) * 2007-10-05 2009-05-13 Genethon Widespread gene delivery to motor neurons using peripheral injection of AAV vectors
AU2009274482A1 (en) 2008-05-20 2010-01-28 Eos Neuroscience, Inc. Vectors for delivery of light-sensitive proteins and methods of use
US9217155B2 (en) 2008-05-28 2015-12-22 University Of Massachusetts Isolation of novel AAV'S and uses thereof
EP2344893B1 (en) 2008-09-16 2014-10-15 Ibis Biosciences, Inc. Microplate handling systems and methods
EP2347254A2 (en) 2008-09-16 2011-07-27 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
EP2349549B1 (en) 2008-09-16 2012-07-18 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, and system
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
PL2425000T3 (en) 2009-04-30 2019-08-30 The Trustees Of The University Of Pennsylvania Compositions for targeting conducting airway cells comprising adeno-associated virus constructs
WO2010138263A2 (en) 2009-05-28 2010-12-02 University Of Massachusetts Novel aav 's and uses thereof
WO2010143761A1 (en) * 2009-06-12 2010-12-16 (주)바이오니아 Method for quickly detecting infectious microorganisms in unknown sample
WO2011008972A1 (en) 2009-07-17 2011-01-20 Ibis Biosciences, Inc. Systems for bioagent identification
WO2011008971A1 (en) 2009-07-17 2011-01-20 Ibis Biosciences, Inc. Lift and mount apparatus
WO2011041502A1 (en) 2009-10-01 2011-04-07 The Trustees Of The University Of Pennsylvania Aav vectors expressing sec1o for treating kidney damage
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification
US9315825B2 (en) 2010-03-29 2016-04-19 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
JP5922095B2 (en) 2010-03-29 2016-05-24 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Pharmacologically induced transgene ablation system
CA3050894C (en) 2010-04-23 2022-10-18 University Of Massachusetts Multicistronic expression constructs
DK2561073T3 (en) * 2010-04-23 2016-12-12 Univ Massachusetts Aav vectors targeted to central nervous system and methods of use thereof
JP2013533847A (en) 2010-04-23 2013-08-29 ユニバーシティ オブ マサチューセッツ AAV-based treatment of cholesterol-related disorders
EP2605798A1 (en) 2010-07-12 2013-06-26 Universidad Autònoma de Barcelona Gene therapy composition for use in diabetes treatment
US8663624B2 (en) 2010-10-06 2014-03-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
EP2699688A1 (en) 2011-04-20 2014-02-26 The Trustees Of The University Of Pennsylvania Regimens and compositions for aav-mediated passive immunization of airborne pathogens
EP3318635A1 (en) 2011-04-21 2018-05-09 University of Massachusetts Raav-based compositions and methods for treating alpha-1 anti-trypsin deficiencies
SG10202110919YA (en) 2011-04-22 2021-11-29 Univ California Adeno-associated virus virions with variant capsid and methods of use thereof
ES2857773T3 (en) * 2011-08-24 2021-09-29 Univ Leland Stanford Junior New AAV capsid proteins for nucleic acid transfer
US20130136729A1 (en) * 2011-11-11 2013-05-30 University of Virginia Patent Foundation, d/b/a University of Virginia Licensing & Ventures Group Compositions and methods for targeting and treating diseases and injuries using adeno-associated virus vectors
JP6373763B2 (en) 2012-02-17 2018-08-22 ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィアＴｈｅ Ｃｈｉｌｄｒｅｎ’Ｓ Ｈｏｓｐｉｔａｌ Ｏｆ Ｐｈｉｌａｄｅｌｐｈｉａ AAV vector components and methods for gene transfer into cells, organs and tissues
WO2013130393A1 (en) * 2012-02-28 2013-09-06 Cornell University Aav-directed persistent expression of an anti-nicotine antibody gene for smoking cessation
WO2013154744A1 (en) * 2012-04-13 2013-10-17 Cornell University Development of a highly efficient second generation nicotine-conjugate vaccine to treat nicotine addiction
US10294281B2 (en) 2012-05-15 2019-05-21 University Of Florida Research Foundation, Incorporated High-transduction-efficiency rAAV vectors, compositions, and methods of use
EP2692868A1 (en) 2012-08-02 2014-02-05 Universitat Autònoma De Barcelona Adeno-associated viral (AAV) vectors useful for transducing adipose tissue
EP2954051B1 (en) 2013-02-08 2019-03-27 The Trustees Of The University Of Pennsylvania Modified aav8 capsid for gene transfer for retinal therapies
EP4223772A3 (en) 2013-02-15 2023-10-18 Bioverativ Therapeutics Inc. Optimized factor viii gene
US8957044B2 (en) 2013-03-01 2015-02-17 Wake Forest University Health Sciences Systemic gene replacement therapy for treatment of X-linked myotubular myopathy (XLMTM)
SG11201507507PA (en) 2013-03-15 2015-10-29 Univ Pennsylvania Compositions and methods for treating mpsi
US9719106B2 (en) 2013-04-29 2017-08-01 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and uses thereof
US11136557B2 (en) 2013-05-31 2021-10-05 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
CN110606874B (en) 2013-07-22 2024-04-19 费城儿童医院 Variant AAV and compositions, methods and uses for gene transfer into cells, organs and tissues
PT3099333T (en) * 2014-01-31 2020-12-24 Univ Temple Bag3 as a target for therapy of heart failure
GB201403684D0 (en) 2014-03-03 2014-04-16 King S College London Vector
WO2015127128A2 (en) 2014-02-19 2015-08-27 University Of Massachusetts Recombinant aavs having useful transcytosis properties
PL3116900T3 (en) 2014-03-09 2021-03-08 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of ornithine transcarbamylase (otc) deficiency
US10000741B2 (en) 2014-03-17 2018-06-19 Adverum Biotechnologies, Inc. Compositions and methods for enhanced gene expression in cone cells
DK3119797T3 (en) 2014-03-18 2021-03-15 Univ Massachusetts RAAV-BASED COMPOSITIONS AND METHODS FOR THE TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS
MY190726A (en) 2014-03-21 2022-05-12 Genzyme Corp Gene therapy for retinitis pigmentosa
EP2933335A1 (en) 2014-04-18 2015-10-21 Genethon A method of treating peripheral neuropathies and motor neuron diseases
US11555059B2 (en) 2014-04-25 2023-01-17 The Trustees Of The University Of Pennsylvania LDLR variants and their use in compositions for reducing cholesterol levels
JP6983511B2 (en) 2014-04-25 2021-12-17 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Methods and Compositions for Treating Metastatic Breast Cancer and Other Cancers in the Brain
WO2015164786A1 (en) 2014-04-25 2015-10-29 University Of Massachusetts Recombinant aav vectors useful for reducing immunity against transgene products
MA44179B1 (en) 2014-05-13 2020-10-28 Univ Pennsylvania Compositions comprising an adeno-associated virus expressing double antibody constructs and their uses
US10689653B2 (en) 2014-06-03 2020-06-23 University Of Massachusetts Compositions and methods for modulating dysferlin expression
EP3151866B1 (en) 2014-06-09 2023-03-08 Voyager Therapeutics, Inc. Chimeric capsids
EP2960336A1 (en) 2014-06-27 2015-12-30 Genethon Efficient systemic treatment of dystrophic muscle pathologies
SI3164394T1 (en) 2014-07-03 2020-08-31 Board Of Regents, The University Of Texas System Gls1 inhibitors for treating diseases
EP4012035A1 (en) 2014-09-16 2022-06-15 Genzyme Corporation Adeno-associated viral vectors for treating myocilin (myoc) glaucoma
CA2961523A1 (en) 2014-09-16 2016-03-24 Genzyme Corporation Adeno-associated viral vectors for treating myocilin (myoc) glaucoma
US10711270B2 (en) 2014-10-03 2020-07-14 University Of Massachusetts High efficiency library-identified AAV vectors
US10370432B2 (en) 2014-10-03 2019-08-06 University Of Massachusetts Heterologous targeting peptide grafted AAVS
CN107073051B (en) 2014-10-21 2021-08-24 马萨诸塞大学 Recombinant AAV variants and uses thereof
EP3215191A4 (en) 2014-11-05 2018-08-01 Voyager Therapeutics, Inc. Aadc polynucleotides for the treatment of parkinson's disease
JP6863891B2 (en) 2014-11-14 2021-04-21 ボイジャー セラピューティクス インコーポレイテッドＶｏｙａｇｅｒ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． Regulatory polynucleotide
CN114717264A (en) 2014-11-14 2022-07-08 沃雅戈治疗公司 Compositions and methods for treating Amyotrophic Lateral Sclerosis (ALS)
US11697825B2 (en) 2014-12-12 2023-07-11 Voyager Therapeutics, Inc. Compositions and methods for the production of scAAV
US11033638B2 (en) 2015-01-07 2021-06-15 Universität Autonoma De Barcelona Single-vector gene construct comprising insulin and glucokinase genes
WO2016115503A1 (en) 2015-01-16 2016-07-21 Voyager Therapeutics, Inc. Central nervous system targeting polynucleotides
CN107646052A (en) 2015-01-20 2018-01-30 建新公司 For characterizing the analytical supercentrifugation of recombinant virus particle
US20180030096A1 (en) 2015-02-03 2018-02-01 University Of Florida Research Foundation, Inc. Recombinant aav1, aav5, and aav6 capsid mutants and uses thereof
EP3256487A4 (en) 2015-02-09 2018-07-18 Duke University Compositions and methods for epigenome editing
CN107530447A (en) 2015-02-10 2018-01-02 建新公司 The enhancing of virion to corpus straitum and cortex delivers
KR20170110149A (en) 2015-02-10 2017-10-10 젠자임 코포레이션 Mutant RNAi
EP3256170B1 (en) 2015-02-13 2020-09-23 University of Massachusetts Compositions and methods for transient delivery of nucleases
JP7095994B2 (en) 2015-03-02 2022-07-05 アドヴェラム バイオテクノロジーズ， インコーポレイテッド Compositions and Methods for Intravitreal Delivery of Polynucleotides to the Retinal Pyramids
JP2018509164A (en) 2015-03-10 2018-04-05 ザ・トラスティーズ・オブ・コロンビア・ユニバーシティ・イン・ザ・シティ・オブ・ニューヨーク Recombinant Glut1 adeno-associated virus vector construct and method for restoring Glut1 expression
AU2016235163B2 (en) 2015-03-24 2022-03-24 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
TWI707951B (en) 2015-04-08 2020-10-21 美商健臻公司 Production of oversized adeno-associated vectors
EP3285788A4 (en) 2015-04-23 2018-12-05 University of Massachusetts Modulation of aav vector transgene expression
US11046955B2 (en) 2015-04-24 2021-06-29 University Of Massachusetts Modified AAV constructs and uses thereof
EP3288594B1 (en) 2015-04-27 2022-06-29 The Trustees of The University of Pennsylvania Dual aav vector system for crispr/cas9 mediated correction of human disease
GB201508026D0 (en) 2015-05-11 2015-06-24 Ucl Business Plc Capsid
CN108135994B (en) 2015-05-13 2022-01-25 宾夕法尼亚州大学信托人 AAV-mediated expression of anti-influenza antibodies and methods of use thereof
KR20230142649A (en) 2015-05-16 2023-10-11 젠자임 코포레이션 Gene editing of deep intronic mutations
BR112017027956A2 (en) 2015-06-23 2018-08-28 Childrens Hospital Philadelphia modified ix factor and compositions, methods and uses for gene transfer to cells, organs and tissues
EP3325018A4 (en) 2015-07-22 2019-04-24 Duke University High-throughput screening of regulatory element function with epigenome editing technologies
EA201890565A1 (en) 2015-08-25 2019-04-30 Дьюк Юниверсити COMPOSITIONS AND METHODS OF IMPROVING SPECIFICITY IN GENOMIC ENGINEERING WITH THE USE OF RNA-DIRECTED ENDONUCLEAS
WO2017040524A1 (en) 2015-08-31 2017-03-09 The Trustees Of The University Of Pennsylvania Aav-epo for treating companion animals
EP3359663A4 (en) 2015-09-24 2019-08-14 The Trustees of The University of Pennsylvania Composition and method for treating complement-mediated disease
BR112018003665A2 (en) 2015-09-28 2018-09-25 Univ North Carolina Chapel Hill methods and compositions for antibody evasion viral vectors
WO2017062750A1 (en) 2015-10-09 2017-04-13 The Trustees Of The University Of Pennsylvania Compositions and methods useful in treating stargardt's disease and other ocular disorders
EP4089175A1 (en) 2015-10-13 2022-11-16 Duke University Genome engineering with type i crispr systems in eukaryotic cells
WO2017070516A1 (en) 2015-10-22 2017-04-27 University Of Massachusetts Prostate-targeting adeno-associated virus serotype vectors
EP3364997B1 (en) 2015-10-22 2024-01-17 University of Massachusetts Aspartoacylase gene therapy in the treatment of canavan disease
WO2017075335A1 (en) 2015-10-28 2017-05-04 Voyager Therapeutics, Inc. Regulatable expression using adeno-associated virus (aav)
CN116196410A (en) 2015-10-28 2023-06-02 宾夕法尼亚州大学信托人 Intrathecal administration of adeno-associated viral vectors for gene therapy
EA201891066A1 (en) 2015-10-30 2018-10-31 ЭнБиИ-ТЕРАПЬЮТИКС АГ ANTIBODIES TO ROR1
US10983110B2 (en) 2015-12-02 2021-04-20 Voyager Therapeutics, Inc. Assays for the detection of AAV neutralizing antibodies
FR3044926B1 (en) 2015-12-09 2020-01-31 Genethon EFFICIENT GENE THERAPY TOOLS FOR JUMPING DYSTROPHIN EXON 53
US11015174B2 (en) 2015-12-11 2021-05-25 The Trustees Of The University Of Pennsylvania Scalable purification method for AAV8
WO2017160360A2 (en) 2015-12-11 2017-09-21 The Trustees Of The University Of Pennsylvania Scalable purification method for aav9
WO2017100674A1 (en) * 2015-12-11 2017-06-15 The Trustees Of The University Of Pennsylvania Scalable purification method for aav1
ES2918998T3 (en) 2015-12-11 2022-07-21 Univ Pennsylvania Scalable purification method for AAVrh10
MA43570A (en) 2015-12-11 2018-11-14 Univ Pennsylvania GENE THERAPY TO TREAT FAMILY HYPERCHOLESTEROLEMIA
EP3389723A1 (en) 2015-12-14 2018-10-24 The Trustees Of The University Of Pennsylvania Composition for treatment of crigler-najjar syndrome
WO2017106202A2 (en) 2015-12-14 2017-06-22 The Trustees Of The University Of Pennsylvania Gene therapy for ocular disorders
IL259964B (en) 2015-12-15 2022-09-01 Genzyme Corp Adeno-associated viral vectors for treating mucolipidosis type ii
AU2017210327A1 (en) 2016-01-20 2018-08-09 Nbe-Therapeutics Ag ROR1 antibody compositions and related methods
BR112018015659A2 (en) 2016-02-01 2018-12-26 Bioverativ Therapeutics Inc optimized factor viii genes
US11826433B2 (en) 2016-02-02 2023-11-28 University Of Massachusetts Method to enhance the efficiency of systemic AAV gene delivery to the central nervous system
WO2017136500A1 (en) 2016-02-03 2017-08-10 The Trustees Of The University Of Pennsylvania Gene therapy for treating mucopolysaccharidosis type i
CA3012344A1 (en) 2016-02-12 2017-08-17 University Of Massachusetts Anti-angiogenic mirna therapeutics for inhibiting corneal neovascularization
US10729789B2 (en) * 2016-03-01 2020-08-04 University Of Virginia Patent Foundation Compositions and methods for adeno-associated virus mediated gene expression in myofibroblast-like cells
EP3440210A4 (en) 2016-04-05 2019-11-27 University of Massachusetts Compositions and methods for selective inhibition of grainyhead-like protein expression
EP3443001A4 (en) 2016-04-11 2020-04-29 Obsidian Therapeutics, Inc. Regulated biocircuit systems
WO2017180861A1 (en) 2016-04-15 2017-10-19 The Trustees Of The University Of Pennsulvania Gene therapy for treating hemophilia b
US11413356B2 (en) 2016-04-15 2022-08-16 University Of Massachusetts Methods and compositions for treating metabolic imbalance
US11253612B2 (en) 2016-04-15 2022-02-22 The Trustees Of The University Of Pennsylvania Gene therapy for treating mucopolysaccharidosis type II
KR102574810B1 (en) 2016-04-15 2023-09-08 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 Compositions for the treatment of wet age-related macular degeneration
WO2017180857A1 (en) 2016-04-15 2017-10-19 The Trustees Of The University Of Pennsylvania Gene therapy for treating hemophilia a
SG11201808812RA (en) * 2016-04-15 2018-11-29 Univ Pennsylvania Novel aav8 mutant capsids and compositions containing same
WO2017184463A1 (en) 2016-04-17 2017-10-26 The Trustees Of The University Of Pennsylvania Compositions and methods useful for prophylaxis of organophosphates
US11299751B2 (en) 2016-04-29 2022-04-12 Voyager Therapeutics, Inc. Compositions for the treatment of disease
EP3448874A4 (en) 2016-04-29 2020-04-22 Voyager Therapeutics, Inc. Compositions for the treatment of disease
GB201608046D0 (en) * 2016-05-09 2016-06-22 Cambridge Entpr Ltd And Syndey Children S Hospitals Network Randwick And Westmead Incorporating The Treatment of complement-mediated disorders
CN109476707B (en) 2016-05-13 2022-12-02 4D分子治疗有限公司 Adeno-associated virus variant capsids and methods of use thereof
BR112018073384A2 (en) 2016-05-18 2019-03-06 Voyager Therapeutics, Inc. modulating polynucleotides
WO2017201258A1 (en) 2016-05-18 2017-11-23 Voyager Therapeutics, Inc. Compositions and methods of treating huntington's disease
CN109313018B (en) * 2016-06-08 2021-12-10 索尼公司 Imaging control apparatus and method, and vehicle
WO2017218852A1 (en) 2016-06-15 2017-12-21 University Of Massachusetts Recombinant adeno-associated viruses for delivering gene editing molecules to embryonic cells
WO2018009553A1 (en) 2016-07-05 2018-01-11 University Of Massachusetts Aav2-mediated gene delivery of sfasl as a neuroprotective therapy in glaucoma
EP3481958A4 (en) 2016-07-08 2019-12-25 The Trustees of The University of Pennsylvania Methods and compositions for treatment of disorders and diseases involving rdh12
WO2018022511A1 (en) 2016-07-25 2018-02-01 The Trustees Of The University Of Pennsylvania Compositions comprising a lecithin cholesterol acyltransferase variant and uses thereof
WO2018022608A2 (en) * 2016-07-26 2018-02-01 Biomarin Pharmaceutical Inc. Novel adeno-associated virus capsid proteins
KR20230039779A (en) 2016-07-29 2023-03-21 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 Adeno-associated virus virions with variant capsid and methods of use thereof
JP7021191B2 (en) 2016-08-15 2022-02-16 ジェンザイム・コーポレーション Methods for Detecting AAV
EP3506817A4 (en) 2016-08-30 2020-07-22 The Regents of The University of California Methods for biomedical targeting and delivery and devices and systems for practicing the same
US10457940B2 (en) 2016-09-22 2019-10-29 University Of Massachusetts AAV treatment of Huntington's disease
US11078238B2 (en) * 2016-09-29 2021-08-03 University Of Florida Research Foundation, Incorporated AAVrh.10 variants with host antibody escape capabilities and altered tissue targeting properties
US11578340B2 (en) 2016-10-13 2023-02-14 University Of Massachusetts AAV capsid designs
CA3040179A1 (en) 2016-10-19 2018-04-26 Adverum Biotechnologies, Inc. Modified aav capsids and uses thereof
US20190328846A1 (en) 2016-12-01 2019-10-31 INSERM (Institut National de la Santé et de la Recherche Médicale) Pharmaceutical compositions for the treatment of retinal degenerative diseases
US11584931B2 (en) 2016-12-14 2023-02-21 The J. David Gladstone Institutes Methods and compositions for generating a deletion library and for identifying a defective interfering particle (DIP)
CN110325199A (en) * 2016-12-30 2019-10-11 宾夕法尼亚州立大学托管会 For treating the gene therapy of phenylketonuria
WO2018152485A1 (en) 2017-02-20 2018-08-23 The Trustees Of The University Of Pennsylvania Gene therapy for treating familial hypercholesterolemia
JOP20190200A1 (en) 2017-02-28 2019-08-27 Univ Pennsylvania Compositions useful in treatment of spinal muscular atrophy
SG10201912969XA (en) 2017-02-28 2020-02-27 Univ Pennsylvania Adeno-associated virus (aav) clade f vector and uses therefor
AU2018229293A1 (en) 2017-02-28 2019-08-29 Janssen Biotech, Inc. Influenza vaccines based on AAV vectors
JP7211960B2 (en) 2017-03-01 2023-01-24 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Gene therapy for eye diseases
EP3589311A1 (en) 2017-03-02 2020-01-08 Genethon Method for removing anti-aav antibodies from a blood-derived composition
US11739346B2 (en) 2017-04-05 2023-08-29 University Of Massachusetts Minigene therapy
US11499154B2 (en) 2017-04-10 2022-11-15 Genethon Antisense targeting dynamin 2 and use for the treatment of centronuclear myopathies and neuropathies
SG11201909361SA (en) 2017-04-14 2019-11-28 Regenxbio Inc Treatment of mucopolysaccharidosis ii with recombinant human iduronate-2 sulfatase (ids) produced by human neural or glial cells
US11879133B2 (en) 2017-04-24 2024-01-23 The Trustees Of The University Of Pennsylvania Gene therapy for ocular disorders
US11752181B2 (en) 2017-05-05 2023-09-12 Voyager Therapeutics, Inc. Compositions and methods of treating Huntington's disease
WO2018204786A1 (en) 2017-05-05 2018-11-08 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (als)
WO2018208972A1 (en) 2017-05-09 2018-11-15 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (als)
CA3061655A1 (en) 2017-05-11 2018-11-15 The Trustees Of The University Of Pennsylvania Gene therapy for neuronal ceroid lipofuscinoses
AU2018265541B2 (en) 2017-05-12 2023-05-25 University Of Massachusetts Viral vector production
CN108103058A (en) * 2017-05-12 2018-06-01 北京五加和分子医学研究所有限公司 A kind of gene therapy medicament of type-1 diabetes mellitus
WO2018218359A1 (en) 2017-05-31 2018-12-06 The Trustees Of The University Of Pennsylvania Gene therapy for treating peroxisomal disorders
MX2019014760A (en) 2017-06-06 2020-08-03 Univ Massachusetts Self-regulating aav vectors for safe expression of mecp2 in rett syndrome.
WO2018232149A1 (en) 2017-06-14 2018-12-20 The Trustees Of The University Of Pennsylvania Gene therapy for ocular disorders
JOP20190269A1 (en) 2017-06-15 2019-11-20 Voyager Therapeutics Inc Aadc polynucleotides for the treatment of parkinson's disease
US10812532B2 (en) 2017-06-15 2020-10-20 Palo Alto Networks, Inc. Security for cellular internet of things in mobile networks
US10693918B2 (en) 2017-06-15 2020-06-23 Palo Alto Networks, Inc. Radio access technology based security in service provider networks
US10721272B2 (en) 2017-06-15 2020-07-21 Palo Alto Networks, Inc. Mobile equipment identity and/or IOT equipment identity and application identity based security enforcement in service provider networks
US10708306B2 (en) 2017-06-15 2020-07-07 Palo Alto Networks, Inc. Mobile user identity and/or SIM-based IoT identity and application identity based security enforcement in service provider networks
US11050789B2 (en) 2017-06-15 2021-06-29 Palo Alto Networks, Inc. Location based security in service provider networks
KR20200019231A (en) * 2017-06-22 2020-02-21 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 Method for producing regulatory immune cells and uses thereof
CA3068328A1 (en) 2017-07-06 2019-01-10 The Trustees Of The University Of Pennsylvania Aav9-mediated gene therapy for treating mucopolysaccharidosis type i
US11596698B2 (en) 2017-07-07 2023-03-07 Genethon Synthetic polynucleotides encoding a human FKRP protein
JP7229989B2 (en) 2017-07-17 2023-02-28 ボイジャー セラピューティクス インコーポレイテッド Trajectory array guide system
MX2020001187A (en) 2017-08-03 2020-10-05 Voyager Therapeutics Inc Compositions and methods for delivery of aav.
SG11202000846WA (en) 2017-08-07 2020-02-27 Nbe Therapeutics Ag Anthracycline-based antibody drug conjugates having high in vivo tolerability
US11680249B2 (en) * 2017-08-28 2023-06-20 The Regents Of The University Of California Adeno-associated virus capsid variants and methods of use thereof
PE20201264A1 (en) 2017-09-20 2020-11-19 4D Molecular Therapeutics Inc VARIANTS OF ADENO-ASSOCIATED VIRUS CAPSIDS AND METHODS OF USE OF THEM
CA3076191A1 (en) 2017-09-22 2019-03-28 Genzyme Corporation Variant rnai
CN111448321A (en) 2017-09-22 2020-07-24 马萨诸塞大学 SOD1 double expression vector and its use
CA3076036A1 (en) 2017-09-22 2019-03-28 The Trustees Of The University Of Pennsylvania Gene therapy for treating mucopolysaccharidosis type ii
KR20200078513A (en) * 2017-10-03 2020-07-01 프리베일 테라퓨틱스, 인크. Gene therapy for lysosomal disorders
WO2019079240A1 (en) 2017-10-16 2019-04-25 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (als)
US20200237799A1 (en) 2017-10-16 2020-07-30 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis (als)
CA3079568A1 (en) 2017-10-18 2019-04-25 Regenxbio Inc. Fully-human post-translationally modified antibody therapeutics
AU2018350990A1 (en) 2017-10-18 2020-05-21 Regenxbio Inc. Treatment of ocular diseases and metastatic colon cancer with human post-translationally modified VEGF-Trap
EP3697764A4 (en) 2017-10-18 2021-07-21 Board Of Regents, The University Of Texas System Glutaminase inhibitor therapy
DK3717636T3 (en) 2017-11-27 2023-05-30 4D Molecular Therapeutics Inc Adeno-associated-virus variant capsids and use in inhibiting angiogenesis
WO2019108857A1 (en) 2017-11-30 2019-06-06 The Trustees Of The University Of Pennsylvania Gene therapy for mucopolysaccharidosis iiia
EA202091352A1 (en) 2017-11-30 2020-08-27 Дзе Трастиз Оф Дзе Юниверсити Оф Пенсильвания GENOTHERAPY OF MUCOPOLYSACCHARIDOSIS IIIB
KR20200090927A (en) 2017-12-19 2020-07-29 아카우오스, 인크. AAV-mediated delivery of therapeutic antibodies to the inner ear
US10610606B2 (en) 2018-02-01 2020-04-07 Homology Medicines, Inc. Adeno-associated virus compositions for PAH gene transfer and methods of use thereof
EP3755795A4 (en) 2018-02-19 2022-07-20 Homology Medicines, Inc. Adeno-associated virus compositions for restoring f8 gene function and methods of use thereof
EP3762500A1 (en) 2018-03-06 2021-01-13 Voyager Therapeutics, Inc. Insect cell manufactured partial self-complementary aav genomes
EP4169576A1 (en) 2018-03-23 2023-04-26 University of Massachusetts Gene therapeutics for treating bone disorders
CA3098448A1 (en) 2018-04-27 2019-10-31 University Of Massachusetts Aav capsids identified by in vivo library selection
CA3098566A1 (en) 2018-04-29 2019-11-07 Zhuchun WU Systems and methods of spectrophotometry for the determination of genome content, capsid content and full/empty ratios of adeno-associated virus particles
CA3098565A1 (en) 2018-04-29 2019-11-07 Claire G. ZHANG Scalable clarification process for recombinant aav production
IL278393B2 (en) 2018-05-08 2023-11-01 Univ Rutgers Aav-compatible laminin-linker polymerization proteins
EP3790627A2 (en) 2018-05-09 2021-03-17 BioMarin Pharmaceutical Inc. Methods of treating phenylketonuria
TW202005978A (en) 2018-05-14 2020-02-01 美商拜奧馬林製藥公司 Novel liver targeting adeno-associated viral vectors
US20210230632A1 (en) 2018-05-15 2021-07-29 Voyager Therapeutics, Inc. Compositions and methods for delivery of aav
BR112020023082A2 (en) 2018-05-15 2021-02-09 Voyager Therapeutics, Inc. compositions and methods for the treatment of parkinson's disease
WO2019222444A2 (en) 2018-05-16 2019-11-21 Voyager Therapeutics, Inc. Directed evolution
EP3793686A1 (en) 2018-05-16 2021-03-24 Voyager Therapeutics, Inc. Aav serotypes for brain specific payload delivery
US20220403001A1 (en) 2018-06-12 2022-12-22 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
EP3807404A1 (en) 2018-06-13 2021-04-21 Voyager Therapeutics, Inc. Engineered 5' untranslated regions (5' utr) for aav production
JP7385603B2 (en) 2018-06-14 2023-11-22 リジェネクスバイオ インコーポレイテッド Anion exchange chromatography for recombinant AAV production
EP3818161A1 (en) 2018-07-02 2021-05-12 Voyager Therapeutics, Inc. Treatment of amyotrophic lateral sclerosis and disorders associated with the spinal cord
GB201811368D0 (en) 2018-07-11 2018-08-29 Ucb Biopharma Sprl Antibody
CN112770812A (en) 2018-07-24 2021-05-07 沃雅戈治疗公司 System and method for producing gene therapy formulations
US20210292790A1 (en) * 2018-07-30 2021-09-23 Gene Therapy Research Institution Co., Ltd. Method for enhancing gene expression using aav vector
KR20210062627A (en) 2018-08-03 2021-05-31 젠자임 코포레이션 Variant RNAi for alpha-synuclein
JP2021533757A (en) 2018-08-10 2021-12-09 リジェネクスバイオ インコーポレイテッド A scalable method for recombinant AAV generation
AU2019333315B2 (en) 2018-08-30 2022-09-29 Tenaya Therapeutics, Inc. Cardiac cell reprogramming with myocardin and ASCL1
CA3113472A1 (en) 2018-09-28 2020-04-02 President And Fellows Of Harvard College Cellular reprogramming to reverse aging and promote organ and tissue regeneration
US20210403923A1 (en) 2018-09-28 2021-12-30 President And Fellows Of Harvard College Mutant reverse tetracycline transactivators for expression of genes
WO2020069461A1 (en) 2018-09-28 2020-04-02 Voyager Therapeutics, Inc. Frataxin expression constructs having engineered promoters and methods of use thereof
JP2022512589A (en) 2018-10-01 2022-02-07 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Composition useful for the treatment of GM1 gangliosidosis
WO2020072849A1 (en) 2018-10-04 2020-04-09 Voyager Therapeutics, Inc. Methods for measuring the titer and potency of viral vector particles
EP3861107A1 (en) 2018-10-05 2021-08-11 Voyager Therapeutics, Inc. Engineered nucleic acid constructs encoding aav production proteins
BR112021006796A2 (en) 2018-10-12 2021-07-20 Genzyme Corporation generation of improved human pah for treatment of severe pku by liver-targeted gene replacement therapy
WO2020077165A1 (en) 2018-10-12 2020-04-16 Voyager Therapeutics, Inc. Compositions and methods for delivery of aav
CN112912518A (en) 2018-10-15 2021-06-04 再生生物股份有限公司 Methods for measuring infectivity of replication-defective viral vectors and viruses
UY38407A (en) 2018-10-15 2020-05-29 Novartis Ag TREM2 STABILIZING ANTIBODIES
JP2022505106A (en) 2018-10-15 2022-01-14 ボイジャー セラピューティクス インコーポレイテッド Expression vector for large-scale production of rAAV in the baculovirus / Sf9 system
MX2021004602A (en) 2018-10-22 2021-09-08 Univ Rochester Genome editing by directed non-homologous dna insertion using a retroviral integrase-cas9 fusion protein.
US20210386788A1 (en) 2018-10-24 2021-12-16 Obsidian Therapeutics, Inc. Er tunable protein regulation
EP3650956A1 (en) 2018-11-07 2020-05-13 Tissot S.A. Method for broadcasting an acoustic signal
SG11202105030VA (en) 2018-11-16 2021-06-29 Astellas Pharma Inc Method for treating muscular dystrophy by targeting utrophin gene
CA3120105A1 (en) * 2018-11-16 2020-05-22 Asklepios Biopharmaceutical, Inc. Therapeutic adeno-associated virus for treating pompe disease
WO2020112967A1 (en) 2018-11-29 2020-06-04 University Of Massachusetts Modulation of sptlc1 via recombinant adeno-associated vectors
WO2020140007A1 (en) 2018-12-28 2020-07-02 University Of Rochester Gene therapy for best1 dominant mutations
US20220090131A1 (en) 2019-01-04 2022-03-24 Ultragenyx Pharmaceutical Inc. Gene therapy constructs for treating wilson disease
KR20210126014A (en) 2019-01-14 2021-10-19 유니버시티 오브 로체스터 Nuclear RNA cleavage and polyadenylation targeted with CRISPR-Cas
US20220064671A1 (en) 2019-01-18 2022-03-03 Voyager Therapeutics, Inc. Methods and systems for producing aav particles
JP2022523719A (en) 2019-01-31 2022-04-26 オレゴン・ヘルス・アンド・サイエンス・ユニバーシティ Methods for Using Transcription-Dependent Orthogenic Evolution of AAV Capsids
EP3927381A1 (en) 2019-02-22 2021-12-29 The Trustees of The University of Pennsylvania Recombinant adeno-associated virus for treatment of grn-associated adult-onset neurodegeneration
WO2020172537A1 (en) 2019-02-22 2020-08-27 University Of Massachusetts Oxr1 gene therapy
BR112021016501A2 (en) 2019-02-25 2021-10-26 Novartis Ag COMPOSITIONS AND METHODS TO TREAT BIETTI'S CRYSTALLINE DYSTROPHY
JP2022520875A (en) 2019-02-25 2022-04-01 ノバルティス アーゲー Compositions and Methods for Treating Bietti Crystallin Retinopathy
CA3130055A1 (en) 2019-02-26 2020-09-03 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of krabbe disease
JP2022522756A (en) 2019-02-28 2022-04-20 リジェネロン・ファーマシューティカルズ・インコーポレイテッド Adeno-associated virus vector for delivery of therapeutic agents
JP2022526526A (en) 2019-03-25 2022-05-25 ジェネトン Production of large sized quasi-dystrophins using overlapped AAV vectors
CN113966236A (en) 2019-04-03 2022-01-21 再生生物股份有限公司 Gene therapy for ocular conditions
TW202102526A (en) 2019-04-04 2021-01-16 美商銳進科斯生物股份有限公司 Recombinant adeno-associated viruses and uses thereof
WO2020210600A1 (en) 2019-04-11 2020-10-15 Regenxbio Inc. Methods of size exclusion chromatography for the characterization of recombinant adeno-associated virus compositions
KR20220009389A (en) 2019-04-17 2022-01-24 코디악 바이오사이언시즈, 인크. Composition of exosomes and AAV
MX2021012564A (en) 2019-04-19 2022-01-18 Regenxbio Inc Adeno-associated virus vector formulations and methods.
AU2020262416A1 (en) * 2019-04-24 2021-12-16 Regenxbio Inc. Fully-human post-translationally modified antibody therapeutics
TW202106879A (en) 2019-04-29 2021-02-16 美商航海家醫療公司 Systems and methods for producing baculoviral infected insect cells (biics) in bioreactors
EP3976078A4 (en) * 2019-04-29 2023-08-30 The Trustees of The University of Pennsylvania Novel aav capsids and compositions containing same
US20240124889A1 (en) 2019-05-07 2024-04-18 Voyager Therapeutics, Inc. Compositions and methods for the vectored augmentation of protein destruction, expression and/or regulation
EP3976631A1 (en) * 2019-05-24 2022-04-06 Regeneron Pharmaceuticals, Inc. Modified viral particles and uses thereof
CN113785066A (en) 2019-05-28 2021-12-10 安斯泰来制药株式会社 Methods of treating muscular dystrophy by targeting DMPK genes
EP3987024A4 (en) 2019-06-20 2023-11-01 University Of Massachusetts Compositions and methods for improved gene editing
CN114616000A (en) 2019-07-02 2022-06-10 M6P医疗(瑞士)有限责任公司 Carrier compositions and methods for their use in treating lysosomal storage disorders
WO2021005223A1 (en) 2019-07-10 2021-01-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of epilepsy
CA3146718A1 (en) 2019-07-11 2021-01-14 Centre National De La Recherche Scientifique Chemically-modified adeno-associated virus
EP3997226A1 (en) 2019-07-11 2022-05-18 Tenaya Therapeutics, Inc. Cardiac cell reprogramming with micrornas and other factors
US10653731B1 (en) * 2019-07-15 2020-05-19 Vigene Biosciences Inc. Recombinantly-modified adeno-associated virus (rAAV) having improved packaging efficiency
US10557149B1 (en) * 2019-07-15 2020-02-11 Vigene Biosciences, Inc. Recombinantly-modified adeno-associated virus helper vectors and their use to improve the packaging efficiency of recombinantly-modified adeno-associated virus
EP4004206A1 (en) 2019-07-23 2022-06-01 University of Rochester Targeted rna cleavage with crispr-cas
JP2022544004A (en) 2019-07-26 2022-10-17 リジェネックスバイオ インコーポレイテッド ENGINEERED NUCLEIC ACID REGULATORY ELEMENTS AND METHODS OF USE THEREOF
WO2021021674A1 (en) 2019-07-26 2021-02-04 Akouos, Inc. Methods of treating hearing loss using a secreted target protein
US20220290182A1 (en) 2019-08-09 2022-09-15 Voyager Therapeutics, Inc. Cell culture medium for use in producing gene therapy products in bioreactors
JP2022546236A (en) * 2019-08-14 2022-11-04 ユニバーシティー オブ フロリダ リサーチ ファンデーション， インク． AAV capsid variants for gene therapy
BR112022003811A2 (en) 2019-08-26 2022-11-16 Regenxbio Inc TREATMENT OF DIABETIC RETINOPATHY WITH POST-TRANSLATION MODIFIED FULLY HUMAN ANTI-VEGF FAB
WO2021041485A1 (en) 2019-08-26 2021-03-04 Voyager Therapeutics, Inc. Controlled expression of viral proteins
TW202118873A (en) 2019-08-27 2021-05-16 美商維泰克斯製藥公司 Compositions and methods for treatment of disorders associated with repetitive dna
WO2021046155A1 (en) 2019-09-03 2021-03-11 Voyager Therapeutics, Inc. Vectorized editing of nucleic acids to correct overt mutations
WO2021046451A1 (en) 2019-09-06 2021-03-11 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
JP2022547305A (en) 2019-09-13 2022-11-11 ラトガース，ザ ステート ユニバーシティ オブ ニュー ジャージー AAV compatible laminin-linker polymeric protein
CA3149449A1 (en) 2019-09-19 2021-03-25 Evelyne GICQUEL Gene therapy expression system alleviating cardiac toxicity of fkrp
US11834659B2 (en) 2019-09-26 2023-12-05 Massachusetts Institute Of Technology Trans-activated functional RNA by strand displacement and uses thereof
US11492622B2 (en) 2019-09-26 2022-11-08 Massachusetts Institute Of Technology MicroRNA-based logic gates and uses thereof
JP2022550435A (en) 2019-10-04 2022-12-01 ウルトラジェニックス ファーマシューティカル インコーポレイテッド Methods for improved therapeutic use of recombinant AAV
JP2022552262A (en) 2019-10-07 2022-12-15 リジェネックスバイオ インコーポレイテッド Adeno-associated virus vector pharmaceutical compositions and methods
CN113518824B (en) * 2019-10-16 2024-02-23 上海药明康德新药开发有限公司 Novel AAV variants
MX2022004352A (en) 2019-10-17 2022-07-19 Stridebio Inc Adeno-associated viral vectors for treatment of niemann-pick disease type c.
US20230340078A1 (en) 2019-11-14 2023-10-26 Biomarin Pharmaceutical Inc. Treatment of hereditary angioedema with liver-specific gene therapy vectors
WO2021099394A1 (en) 2019-11-19 2021-05-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Antisense oligonucleotides and their use for the treatment of cancer
TW202134260A (en) 2019-11-28 2021-09-16 美商銳進科斯生物股份有限公司 Microdystrophin gene therapy constructs and uses thereof
JP2023505851A (en) 2019-12-10 2023-02-13 武田薬品工業株式会社 Adeno-associated virus vectors for the treatment of Hunter's disease
TW202140791A (en) 2020-01-13 2021-11-01 美商霍蒙拉奇醫藥公司 Methods of treating phenylketonuria
AU2021211416A1 (en) 2020-01-22 2022-08-11 Regenxbio Inc. Treatment of mucopolysaccharidosis I with fully-human glycosylated human alpha-L-iduronidase (IDUA)
JP2023512242A (en) 2020-01-29 2023-03-24 レジェンクスバイオ インコーポレーテッド Treatment of Mucopolysaccharidosis II with Recombinant Human Iduronate-2-Sulfatase (IDS) Produced by Human Neuronal or Human Glial Cells
AR121201A1 (en) 2020-01-29 2022-04-27 Regenxbio Inc TREATMENT OF MUCOPOLYSACCHARIDOSIS IVA
IL295129A (en) 2020-01-30 2022-09-01 Umoja Biopharma Inc Bispecific transduction enhancer
IL294924A (en) 2020-02-02 2022-09-01 Univ Pennsylvania Compositions useful for treating gm1 gangliosidosis
WO2021158964A1 (en) 2020-02-07 2021-08-12 University Of Rochester Ribozyme-mediated rna assembly and expression
WO2021158982A2 (en) 2020-02-07 2021-08-12 University Of Rochester Targeted translation of rna with crispr-cas13 to enhance protein synthesis
WO2021163322A1 (en) 2020-02-14 2021-08-19 Ultragenyx Pharmaceutical Inc. Gene therapy for treating cdkl5 deficiency disorder
AU2021230476A1 (en) 2020-03-02 2022-10-20 Tenaya Therapeutics, Inc. Gene vector control by cardiomyocyte-expressed microRNAs
JP2023519307A (en) 2020-03-27 2023-05-10 ユニバーシティ オブ ロチェスター Targeted destruction of viral RNA by CRISPR-CAS13
WO2021195525A1 (en) 2020-03-27 2021-09-30 University Of Rochester Crispr-cas13 crrna arrays
CN115667298A (en) 2020-03-27 2023-01-31 Ucb生物制药有限责任公司 Autonomous bulge domain peptides
AU2021248577A1 (en) 2020-03-31 2022-09-29 Sichuan Univeristy AAV capsids variants and uses thereof
JP2023520402A (en) 2020-03-31 2023-05-17 ウルトラジェニックス ファーマシューティカル インコーポレイテッド Gene therapy to treat propionic acidemia
AR122409A1 (en) 2020-04-03 2022-09-07 Biomarin Pharm Inc TREATMENT OF PHENYLKETONURIA WITH AAV AND THERAPEUTIC FORMULATIONS
KR20220167324A (en) 2020-04-10 2022-12-20 솔라 바이오사이언시즈 엘엘씨 Compositions and methods for the treatment of protein aggregation disorders
CA3180222A1 (en) 2020-04-15 2021-10-21 Voyager Therapeutics, Inc. Tau binding compounds
KR20230025659A (en) 2020-04-28 2023-02-22 솔라 바이오사이언시즈 엘엘씨 Compositions and methods for the treatment of TDP-43 proteinopathy
AU2021271635A1 (en) 2020-05-12 2023-01-05 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of krabbe disease
KR20230010670A (en) 2020-05-12 2023-01-19 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 Compositions for DRG-specific reduction of transgene expression
WO2021231567A2 (en) 2020-05-13 2021-11-18 Akouos, Inc. Compositions and methods for treating slc26a4-associated hearing loss
US20230212606A1 (en) 2020-05-13 2023-07-06 Akouos, Inc. Compositions and methods for treating kcnq4-associated hearing loss
WO2021230385A1 (en) 2020-05-15 2021-11-18 Astellas Pharma Inc. Method for treating muscular dystrophy by targeting utrophin gene
WO2021247995A2 (en) 2020-06-04 2021-12-09 Voyager Therapeutics, Inc. Compositions and methods of treating neuropathic pain
US20230234997A1 (en) 2020-06-05 2023-07-27 Sola Biosciences Llc Compositions and Methods for the Treatment of Synucleinopathies
US20230220069A1 (en) 2020-06-17 2023-07-13 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of gene therapy patients
CN115996758A (en) 2020-06-19 2023-04-21 吉尼松公司 Gene therapy expression system for enabling SGCG to be fully expressed in muscle and heart
US20230277686A1 (en) 2020-07-10 2023-09-07 Genethon A novel muscle-specific promoter
IL299771A (en) 2020-07-10 2023-03-01 Inst Nat Sante Rech Med Methods and compositions for treating epilepsy
IL299762A (en) 2020-07-13 2023-03-01 Univ Pennsylvania Compositions useful for treatment of charcot-marie-tooth disease
EP4182455A1 (en) 2020-07-15 2023-05-24 University of Rochester Targeted rna cleavage with dcasl3-rnase fusion proteins
WO2022017630A1 (en) 2020-07-23 2022-01-27 Ucl Business Ltd GENE THERAPY VECTOR FOR eEF1A2 AND USES THEREOF
CA3190309A1 (en) 2020-07-27 2022-02-03 Voyager Therapeutics, Inc. Compositions and methods for the treatment of neurological disorders related to glucosylceramidase beta deficiency
US20230285596A1 (en) 2020-07-27 2023-09-14 Voyager Therapeutics, Inc Compositions and methods for the treatment of niemann-pick type c1 disease
WO2022032153A1 (en) 2020-08-06 2022-02-10 Voyager Therapeutics, Inc. Cell culture medium for use in producing gene therapy products in bioreactors
EP4192515A2 (en) 2020-08-07 2023-06-14 Amicus Therapeutics, Inc. Vesicle targeting proteins and uses of same
WO2022032226A1 (en) 2020-08-07 2022-02-10 Spacecraft Seven, Llc Plakophilin-2 (pkp2) gene therapy using aav vector
CN114075610B (en) * 2020-08-11 2023-11-17 北京荷塘生华医疗科技有限公司 Universal primer for detecting wild adeno-associated virus and application thereof
CA3188956A1 (en) 2020-08-14 2022-02-17 James M. Wilson Novel aav capsids and compositions containing same
GB202013194D0 (en) 2020-08-24 2020-10-07 Combigene Ab Gene therapy for lipodystrophy
BR112023003310A2 (en) 2020-08-24 2023-05-02 Univ Pennsylvania VIRAL VECTORS ENCODING GLP-1 RECEPTOR AGONIST FUSIONS AND THEIR USES IN THE TREATMENT OF METABOLIC DISEASES
CA3189107A1 (en) 2020-08-26 2022-03-03 James M. Wilson Recombinant adeno-associated virus for treatment of grn-associated adult-onset neurodegeneration
US20220096606A1 (en) 2020-09-09 2022-03-31 Vertex Pharmaceuticals Incorporated Compositions and Methods for Treatment of Duchenne Muscular Dystrophy
AU2021339003A1 (en) 2020-09-10 2023-02-09 Ludwig-Maximilians-Universität München Engineered AAV vectors
EP4213890A1 (en) 2020-09-15 2023-07-26 RegenxBio Inc. Vectorized lanadelumab and administration thereof
EP4214242A1 (en) 2020-09-15 2023-07-26 RegenxBio Inc. Vectorized antibodies for anti-viral therapy
US20230383278A1 (en) 2020-09-18 2023-11-30 The United States Of America,As Represented By The Secretary,Department Of Health And Human Services Novel adeno-associated viral (aav) vectors to treat hereditary methylmalonic acidemia (mma) caused by methylmalonyl-coa mutase (mmut) deficiency
US11401531B2 (en) 2020-09-24 2022-08-02 University Of Massachusetts AAV vectors encoding NF1 and uses thereof
TW202229559A (en) 2020-10-01 2022-08-01 美商健臻公司 Human pah expression cassette for treatment of pku by liver-directed gene replacement therapy
CA3197342A1 (en) 2020-10-07 2022-04-14 Regenxbio Inc. Gene therapy for ocular manifestations of cln2 disease
JP2023544799A (en) 2020-10-07 2023-10-25 レジェンクスバイオ インコーポレーテッド Preparations for suprachoroidal administration, such as those containing aggregate formers
IL301947A (en) 2020-10-07 2023-06-01 Regenxbio Inc Formulations for suprachoroidal administration such as gel formulations
EP4225270A1 (en) 2020-10-07 2023-08-16 RegenxBio Inc. Formulations for suprachoroidal administration such as high viscosity formulations
MX2023003699A (en) 2020-10-07 2023-04-21 Regenxbio Inc Adeno-associated viruses for ocular delivery of gene therapy.
WO2022076750A2 (en) 2020-10-07 2022-04-14 Regenxbio Inc. Recombinant adeno-associated viruses for cns or muscle delivery
US11781156B2 (en) 2020-10-09 2023-10-10 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy methods and compositions
JP2023545433A (en) 2020-10-09 2023-10-30 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Compositions and methods for the treatment of Fabry disease
EP4229186A1 (en) 2020-10-18 2023-08-23 The Trustees of The University of Pennsylvania Improved adeno-associated virus (aav) vector and uses therefor
WO2022094078A1 (en) 2020-10-28 2022-05-05 The Trustees Of The University Of Pennsylvania Compositions useful in treatment of rett syndrome
AU2021371307A1 (en) 2020-10-28 2023-06-01 Regenxbio, Inc. VECTORIZED ANTI-TNF-α ANTIBODIES FOR OCULAR INDICATIONS
WO2022094157A1 (en) 2020-10-28 2022-05-05 Regenxbio Inc. Vectorized anti-cgrp and anti-cgrpr antibodies and administration thereof
JP2023548145A (en) 2020-10-29 2023-11-15 リジェネックスバイオ インコーポレイテッド Vectored TNF-alpha antagonists for ocular indications
US20230390418A1 (en) 2020-10-29 2023-12-07 Regenxbio Inc. Vectorized factor xii antibodies and administration thereof
US20230414648A1 (en) 2020-11-06 2023-12-28 Vertex Pharmaceuticals Incorporated Compositions and Methods for Treatment of DM1 with SLUCAS9 and SACAS9
CN112322791B (en) * 2020-11-27 2023-10-27 福建省农业科学院畜牧兽医研究所 Novel duck dependent genus virus loop-mediated isothermal amplification detection primer set and kit
CA3197936A1 (en) 2020-12-01 2022-06-09 Akouos, Inc. Anti-vegf antibody constructs and related methods for treating vestibular schwannoma associated symptoms
EP4256065A2 (en) 2020-12-01 2023-10-11 The Trustees of The University of Pennsylvania Novel compositions with tissue-specific targeting motifs and compositions containing same
JP2023551911A (en) 2020-12-01 2023-12-13 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Compositions and uses thereof for the treatment of Angelman syndrome
AU2021403076A1 (en) 2020-12-16 2023-06-29 Regenxbio Inc. Method of producing a recombinant adeno-associated virus particle
WO2022147087A1 (en) 2020-12-29 2022-07-07 Regenxbio Inc. Tau-specific antibody gene therapy compositions, methods and uses thereof
MX2023007800A (en) 2020-12-29 2023-07-11 Akouos Inc Compositions and methods for treating clrn1-associated hearing loss and/or vision loss.
CN116848255A (en) 2021-01-21 2023-10-03 再生生物股份有限公司 Improved production of recombinant polypeptides and viruses
AU2022212952A1 (en) 2021-01-27 2023-08-10 Umoja Biopharma, Inc. Lentivirus for generating cells expressing anti-cd19 chimeric antigen receptor
EP4284335A1 (en) 2021-02-01 2023-12-06 RegenxBio Inc. Gene therapy for neuronal ceroid lipofuscinoses
KR20230145386A (en) 2021-02-10 2023-10-17 리젠엑스바이오 인크. Treatment of mucopolysaccharidosis II using recombinant human iduronate-2-sulfatase (IDS)
GB202101958D0 (en) 2021-02-12 2021-03-31 Ucl Business Ltd Gene therapy for dopamine transporter deficiency syndrome
EP4298227A1 (en) 2021-02-26 2024-01-03 Takeda Pharmaceutical Company Limited Composition and methods for the treatment of fabry disease
TW202246510A (en) 2021-02-26 2022-12-01 美商維泰克斯製藥公司 Compositions and methods for treatment of myotonic dystrophy type 1 with crispr/slucas9
TW202302848A (en) 2021-02-26 2023-01-16 美商維泰克斯製藥公司 Compositions and methods for treatment of myotonic dystrophy type 1 with crispr/sacas9
WO2022187548A1 (en) 2021-03-03 2022-09-09 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2022187473A2 (en) 2021-03-03 2022-09-09 Voyager Therapeutics, Inc. Controlled expression of viral proteins
EP4314303A2 (en) 2021-03-22 2024-02-07 Genzyme Corporation Size exclusion chromatography analysis of empty and full aav capsids
WO2022204476A1 (en) 2021-03-26 2022-09-29 The Board Of Regents Of The University Of Texas System Nucleotide editing to reframe dmd transcripts by base editing and prime editing
EP4323520A1 (en) 2021-04-12 2024-02-21 The Trustees of The University of Pennsylvania Compositions useful for treating spinal and bulbar muscular atrophy (sbma)
WO2022226263A1 (en) 2021-04-23 2022-10-27 The Trustees Of The University Of Pennsylvania Novel compositions with brain-specific targeting motifs and compositions containing same
KR20240000580A (en) 2021-04-23 2024-01-02 유니버시티 오브 로체스터 Genome editing and treatment method by direct non-homologous DNA insertion using retroviral integrase-Cas fusion protein
EP4329821A1 (en) 2021-04-26 2024-03-06 RegenxBio Inc. Microdystrophin gene therapy administration for treatment of dystrophinopathies
WO2022229851A1 (en) 2021-04-26 2022-11-03 Crispr Therapeutics Ag Compositions and methods for using slucas9 scaffold sequences
EP4334454A2 (en) 2021-05-04 2024-03-13 RegenxBio Inc. Novel aav vectors and methods and uses thereof
WO2022234519A1 (en) 2021-05-05 2022-11-10 Crispr Therapeutics Ag Compositions and methods for using sacas9 scaffold sequences
EP4337267A1 (en) 2021-05-11 2024-03-20 RegenxBio Inc. Treatment of duchenne muscular dystrophy and combinations thereof
US20230038295A1 (en) 2021-06-25 2023-02-09 Homology Medicines, Inc. Adeno-associated virus packaging systems
CA3225985A1 (en) 2021-07-01 2023-01-05 Indapta Therapeutics, Inc. Engineered natural killer (nk) cells and related methods
WO2023279073A1 (en) 2021-07-01 2023-01-05 Amicus Therapeutics, Inc. Neurotensin variants and tagged proteins comprising neurotensin or sortilin propeptide
US20230133924A1 (en) 2021-07-08 2023-05-04 Tenaya Therapeutics, Inc. Optimized expression cassettes for gene therapy
WO2023004331A1 (en) 2021-07-19 2023-01-26 New York University Auf1 combination therapies for treatment of muscle degenerative disease
WO2023010133A2 (en) 2021-07-30 2023-02-02 Tune Therapeutics, Inc. Compositions and methods for modulating expression of frataxin (fxn)
AU2022318664A1 (en) 2021-07-30 2024-02-29 Tune Therapeutics, Inc. Compositions and methods for modulating expression of methyl-cpg binding protein 2 (mecp2)
WO2023018637A1 (en) 2021-08-09 2023-02-16 Vertex Pharmaceuticals Incorporated Gene editing of regulatory elements
AU2022326565A1 (en) 2021-08-11 2024-02-08 Sana Biotechnology, Inc. Genetically modified cells for allogeneic cell therapy
WO2023019227A1 (en) 2021-08-11 2023-02-16 Sana Biotechnology, Inc. Genetically modified cells for allogeneic cell therapy to reduce complement-mediated inflammatory reactions
AU2022325955A1 (en) 2021-08-11 2024-02-08 Sana Biotechnology, Inc. Genetically modified cells for allogeneic cell therapy to reduce instant blood mediated inflammatory reactions
CA3227108A1 (en) 2021-08-11 2023-02-16 Xiaomeng HU Genetically modified primary cells for allogeneic cell therapy
WO2023039444A2 (en) 2021-09-08 2023-03-16 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exon 51 for treatment of duchenne muscular dystrophy
WO2023056329A1 (en) 2021-09-30 2023-04-06 Akouos, Inc. Compositions and methods for treating kcnq4-associated hearing loss
AR127217A1 (en) 2021-10-01 2023-12-27 Biomarin Pharm Inc TREATMENT OF HEREDITARY ANGIOEDEMA WITH AAV GENOTHERAPY VECTORS AND THERAPEUTIC FORMULATIONS
WO2023056399A1 (en) 2021-10-02 2023-04-06 The Trustees Of The University Of Pennsylvania Novel aav capsids and compositions containing same
WO2023060113A1 (en) 2021-10-05 2023-04-13 Regenxbio Inc. Compositions and methods for recombinant aav production
WO2023060272A2 (en) 2021-10-07 2023-04-13 Regenxbio Inc. Recombinant adeno-associated viruses for cns tropic delivery
WO2023060269A1 (en) 2021-10-07 2023-04-13 Regenxbio Inc. Recombinant adeno-associated viruses for targeted delivery
WO2023060221A2 (en) 2021-10-08 2023-04-13 Sola Biosciences Llc Compositions and methods for the treatment of proteopathies
WO2023060248A1 (en) 2021-10-08 2023-04-13 Sola Biosciences Llc Compositions and methods for the treatment of p53-mediated cancers
AU2022371442A1 (en) 2021-10-21 2024-04-18 Vertex Pharmaceuticals Incorporated Hypoimmune cells
WO2023077092A1 (en) 2021-10-28 2023-05-04 Regenxbio Inc. Engineered nucleic acid regulatory elements and methods and uses thereof
WO2023087019A2 (en) 2021-11-15 2023-05-19 The Trustees Of The University Of Pennsylvania Compositions for drg-specific reduction of transgene expression
WO2023102442A1 (en) 2021-11-30 2023-06-08 Jaguar Gene Therapy, Llc Gene therapy methods for treatment of diabetes
WO2023102517A1 (en) 2021-12-02 2023-06-08 The Trustees Of The University Of Pennsylvania Compositions and methods for treatment of fabry disease
WO2023111348A1 (en) 2021-12-17 2023-06-22 Centre National De La Recherche Scientifique Peptides and methods for use in treating pain
WO2023133593A2 (en) * 2022-01-10 2023-07-13 University Of Florida Research Foundation, Incorporated Aav5 capsid variants
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
TW202340467A (en) 2022-01-10 2023-10-16 賓州大學委員會 Compositions and methods useful for treatment of c9orf72-mediated disorders
TW202338086A (en) 2022-01-10 2023-10-01 賓州大學委員會 Compositions useful in treatment of metachromatic leukodystrophy
EP4215614A1 (en) 2022-01-24 2023-07-26 Dynacure Combination therapy for dystrophin-related diseases
WO2023147304A1 (en) 2022-01-25 2023-08-03 The Trustees Of The University Of Pennsylvania Aav capsids for improved heart transduction and detargeting of liver
TW202342525A (en) 2022-02-02 2023-11-01 美商阿科奧斯公司 Anti-vegf antibody constructs and related methods for treating vestibular schwannoma associated symptoms
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
TW202346599A (en) 2022-02-08 2023-12-01 美商航海家醫療公司 Aav capsid variants and uses thereof
WO2023156530A1 (en) 2022-02-17 2023-08-24 Lysogene Gene therapy for neurodegenerative diseases
WO2023158836A1 (en) 2022-02-17 2023-08-24 Sana Biotechnology, Inc. Engineered cd47 proteins and uses thereof
WO2023172926A1 (en) 2022-03-08 2023-09-14 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exons for treatment of duchenne muscular dystrophy
WO2023172927A1 (en) 2022-03-08 2023-09-14 Vertex Pharmaceuticals Incorporated Precise excisions of portions of exon 44, 50, and 53 for treatment of duchenne muscular dystrophy
WO2023173123A1 (en) 2022-03-11 2023-09-14 Sana Biotechnology, Inc. Genetically modified cells and compositions and uses thereof
WO2023178053A1 (en) 2022-03-13 2023-09-21 Regenxbio Inc. Modified muscle-specific promoters
WO2023178220A1 (en) 2022-03-16 2023-09-21 Regenxbio Inc. Compositions and methods for recombinant aav production
WO2023183623A1 (en) 2022-03-25 2023-09-28 Regenxbio Inc. Dominant-negative tumor necrosis factor alpha adeno-associated virus gene therapy
WO2023187728A1 (en) 2022-04-01 2023-10-05 Takeda Pharmaceutical Company Limited Gene therapy for diseases with cns manifestations
WO2023196873A1 (en) 2022-04-06 2023-10-12 Regenxbio Inc. Pharmaceutical composition comprising a recombinant adeno-associated virus vector with an expression cassette encoding a transgene forsuprachoidal administration
WO2023196842A1 (en) 2022-04-06 2023-10-12 Regenxbio Inc. Formulations for suprachoroidal administration such as formulations with aggregate formation
WO2023196892A1 (en) 2022-04-06 2023-10-12 The Trustees Of The University Of Pennsylvania Passive immunization with anti- aav neutralizing antibodies to prevent off-target transduction of intrathecally delivered aav vectors
WO2023196893A1 (en) 2022-04-06 2023-10-12 The Trustees Of The University Of Pennsylvania Compositions and methods for treating her2 positive metastatic breast cancer and other cancers
WO2023196862A1 (en) 2022-04-06 2023-10-12 Genzyme Corporation Targeted gene therapy for dm-1 myotonic dystrophy
TW202345913A (en) 2022-04-06 2023-12-01 美商銳進科斯生物股份有限公司 Formulations for suprachoroidal administration such as gel formulations
WO2023196851A1 (en) 2022-04-06 2023-10-12 President And Fellows Of Harvard College Reversing aging of the central nervous system
WO2023201207A1 (en) 2022-04-11 2023-10-19 Tenaya Therapeutics, Inc. Adeno-associated virus with engineered capsid
WO2023198652A1 (en) 2022-04-11 2023-10-19 Centre National De La Recherche Scientifique Chemically-modified adeno-associated viruses
WO2023198828A1 (en) 2022-04-13 2023-10-19 Universitat Autònoma De Barcelona Treatment of neuromuscular diseases via gene therapy that expresses klotho protein
WO2023201277A1 (en) 2022-04-14 2023-10-19 Regenxbio Inc. Recombinant adeno-associated viruses for cns tropic delivery
WO2023201308A1 (en) 2022-04-14 2023-10-19 Regenxbio Inc. Gene therapy for treating an ocular disease
WO2023205606A1 (en) 2022-04-18 2023-10-26 Vertex Pharmaceuticals Incorporated Compositions and methods for enhancing aav therapy and decreasing tropism of aav to the liver
WO2023215806A2 (en) 2022-05-03 2023-11-09 Regenxbio Inc. Vectorized anti-complement antibodies and complement agents and administration thereof
WO2023215807A1 (en) 2022-05-03 2023-11-09 Regenxbio Inc. VECTORIZED ANTI-TNF-α INHIBITORS FOR OCULAR INDICATIONS
WO2023214346A1 (en) 2022-05-06 2023-11-09 Novartis Ag Novel recombinant aav vp2 fusion polypeptides
WO2023227731A1 (en) 2022-05-25 2023-11-30 Tafalgie Therapeutics Peptides and methods for use in treating pain
WO2023239627A2 (en) 2022-06-08 2023-12-14 Regenxbio Inc. Methods for recombinant aav production
WO2023240236A1 (en) 2022-06-10 2023-12-14 Voyager Therapeutics, Inc. Compositions and methods for the treatment of spinal muscular atrophy related disorders
WO2024006770A1 (en) * 2022-06-27 2024-01-04 Astellas Gene Therapies, Inc. Compositions and methods for the treatment of myotonic dystrophies
WO2024006741A1 (en) 2022-06-28 2024-01-04 Voyager Therapeutics, Inc. Aav capsid variants and uses thereof
WO2024007020A1 (en) 2022-06-30 2024-01-04 Indapta Therapeutics, Inc. Combination of engineered natural killer (nk) cells and antibody therapy and related methods
WO2024011112A1 (en) 2022-07-06 2024-01-11 Voyager Therapeutics, Inc. Aav capsid variants and uses thereof
WO2024015881A2 (en) 2022-07-12 2024-01-18 Tune Therapeutics, Inc. Compositions, systems, and methods for targeted transcriptional activation
WO2024020352A1 (en) 2022-07-18 2024-01-25 Vertex Pharmaceuticals Incorporated Tandem guide rnas (tg-rnas) and their use in genome editing
WO2024017990A1 (en) 2022-07-21 2024-01-25 Institut National de la Santé et de la Recherche Médicale Methods and compositions for treating chronic pain disorders
WO2024026377A1 (en) 2022-07-27 2024-02-01 Sana Biotechnology, Inc. Methods of transduction using a viral vector and inhibitors of antiviral restriction factors
CN115354049A (en) * 2022-07-29 2022-11-18 中国科学院深圳先进技术研究院 Application of gene delivery system in delivering target gene to liver through intravenous injection
WO2024044725A2 (en) 2022-08-24 2024-02-29 Regenxbio Inc. Recombinant adeno-associated viruses and uses thereof
WO2024042485A1 (en) 2022-08-25 2024-02-29 Takeda Pharmaceutical Company Limited Composition for use in the treatment of fabry disease
WO2024054983A1 (en) 2022-09-08 2024-03-14 Voyager Therapeutics, Inc. Controlled expression of viral proteins
WO2024064856A1 (en) 2022-09-22 2024-03-28 Biomarin Pharmaceutical Inc. Treatment of cardiomyopathy with aav gene therapy vectors
WO2024064863A2 (en) 2022-09-22 2024-03-28 Biomarin Pharmaceutical Inc. Treatment of arrhythmogenic cardiomyopathy with aav gene therapy vectors
WO2024073669A1 (en) 2022-09-30 2024-04-04 Regenxbio Inc. Treatment of ocular diseases with recombinant viral vectors encoding anti-vegf fab
WO2024081746A2 (en) 2022-10-11 2024-04-18 Regenxbio Inc. Engineered nucleic acid regulatory elements and methods and uses thereof
CN116622908B (en) * 2023-04-13 2024-02-06 武汉珈创生物技术股份有限公司 Primer probe, kit and method for rapidly detecting wild adeno-associated virus and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000028061A2 (en) * 1998-11-05 2000-05-18 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same

Family Cites Families (69)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8929110D0 (en) * 1989-12-22 1990-02-28 3I Res Expl Ltd Polypeptides and dna encoding therefor
US5449616A (en) 1990-05-23 1995-09-12 University Of Iowa Research Foundation Nucleic acid encoding dystrophin-associated protein
US5173414A (en) * 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
CA2046745A1 (en) 1991-07-10 1993-01-11 Isaac Neuman Article including a container containing at least one precious stone
US6174666B1 (en) 1992-03-27 2001-01-16 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/instability regions from mRNA
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US5658785A (en) 1994-06-06 1997-08-19 Children's Hospital, Inc. Adeno-associated virus materials and methods
US6204059B1 (en) 1994-06-30 2001-03-20 University Of Pittsburgh AAV capsid vehicles for molecular transfer
US5856152A (en) 1994-10-28 1999-01-05 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV vector and methods of use therefor
US6001650A (en) * 1995-08-03 1999-12-14 Avigen, Inc. High-efficiency wild-type-free AAV helper functions
JPH11514853A (en) * 1995-09-08 1999-12-21 ジエンザイム コーポレイション Improved AAV vector for gene therapy
WO1997020943A1 (en) * 1995-12-01 1997-06-12 Introgene B.V. Regulated protein expression in stably transfected mammalian cells
US6083716A (en) 1996-09-06 2000-07-04 The Trustees Of The University Of Pennsylvania Chimpanzee adenovirus vectors
CA2264482A1 (en) 1996-09-06 1998-03-12 The Trustees Of The University Of Pennsylvania An inducible method for production of recombinant adeno-associated viruses utilizing t7 polymerase
US5866552A (en) * 1996-09-06 1999-02-02 The Trustees Of The University Of Pennsylvania Method for expressing a gene in the absence of an immune response
EP0932418B1 (en) 1996-09-06 2007-12-05 The Trustees Of The University Of Pennsylvania Method for recombinant adeno-associated virus-directed gene therapy
US20020037867A1 (en) * 1999-02-26 2002-03-28 James M. Wilson Method for recombinant adeno-associated virus-directed gene therapy
AU722375B2 (en) 1996-09-06 2000-08-03 Trustees Of The University Of Pennsylvania, The Methods using cre-lox for production of recombinant adeno-associated viruses
CA2265460A1 (en) * 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services Aav4 vector and uses thereof
NZ336185A (en) * 1996-12-05 2001-02-23 Introgene Bv Genetic modification of primate hemopoietic repopulating stem cells
US6039942A (en) * 1996-12-20 2000-03-21 Novo Nordick A/S Phytase polypeptides
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6251677B1 (en) 1997-08-25 2001-06-26 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
CA2304131A1 (en) 1997-09-19 1999-04-01 James M. Wilson Method for gene transfer using bcl2 and compositions useful therein
WO1999015685A1 (en) * 1997-09-19 1999-04-01 The Trustees Of The University Of Pennsylvania Methods and cell line useful for production of recombinant adeno-associated viruses
CA2303768C (en) 1997-09-19 2009-11-24 The Trustees Of The University Of Pennsylvania Methods and vector constructs useful for production of recombinant aav
WO1999047691A1 (en) 1998-03-20 1999-09-23 Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
US6953690B1 (en) 1998-03-20 2005-10-11 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
ATE402254T1 (en) 1998-05-28 2008-08-15 Us Gov Health & Human Serv AAV5 VECTORS AND THEIR USE
US6210663B1 (en) 1998-08-20 2001-04-03 The Wistar Institute Of Anatomy And Biology Methods of augmenting mucosal immunity through systemic priming and mucosal boosting
US6759237B1 (en) * 1998-11-05 2004-07-06 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
US6387368B1 (en) * 1999-02-08 2002-05-14 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
JP4693244B2 (en) * 1999-03-18 2011-06-01 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Compositions and methods for helperless production of recombinant adeno-associated virus
AU2409200A (en) 1999-06-02 2000-12-28 Trustees Of The University Of Pennsylvania, The Compositions and methods useful for production of recombinant viruses which require helper viruses
CN1378593A (en) * 1999-08-20 2002-11-06 约翰斯霍普金斯大学医学院 Method and compostions for construction and use of fusion libraries
US6399385B1 (en) * 1999-09-29 2002-06-04 The Trustees Of The University Of Pennsylvania Methods for rapid PEG-modification of viral vectors, compositions for enhanced gene transduction, compositions with enhanced physical stability, and uses therefor
US6365394B1 (en) * 1999-09-29 2002-04-02 The Trustees Of The University Of Pennsylvania Cell lines and constructs useful in production of E1-deleted adenoviruses in absence of replication competent adenovirus
WO2001040455A2 (en) 1999-12-03 2001-06-07 The Trustees Of The University Of Pennsylvania Compositions and methods for increasing packaging and yields of recombinant adenoviruses using multiple packaging signals
US6821512B1 (en) 1999-12-03 2004-11-23 The Trustees Of The University Of Pennsylvania Compositions and methods for increasing packaging and yield of recombinant adenoviruses using multiple packaging signals
CA2373110A1 (en) * 2000-03-14 2001-09-20 Neurologix, Inc. Production of chimeric capsid vectors
US6468524B1 (en) * 2000-03-22 2002-10-22 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services AAV4 vector and uses thereof
US6855314B1 (en) 2000-03-22 2005-02-15 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector for transducing brain cells and lung cells
US7056502B2 (en) * 2000-04-28 2006-06-06 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids
JP2004520812A (en) * 2000-08-30 2004-07-15 ハプロゲン・エルエルシー Methods for determining alleles
US7749492B2 (en) 2001-01-05 2010-07-06 Nationwide Children's Hospital, Inc. AAV vectors and methods
US20020159978A1 (en) * 2001-02-06 2002-10-31 James Allen Muscle-directed gene transfer by use of recombinant AAV-1 and AAV-6 virions
CA2864537C (en) 2001-11-13 2016-11-29 The Trustees Of The University Of Pennsylvania A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby
ES2664505T3 (en) 2001-12-17 2018-04-19 The Trustees Of The University Of Pennsylvania Sequences of serotype 9 of adeno-associated virus (AAV), vectors containing them, and uses thereof
DK1453547T3 (en) * 2001-12-17 2016-12-05 Univ Pennsylvania ADENOASSOCATED VIRUS (AAV) SEROTYPE 8 SEQUENCES, VECTORS CONTAINING THESE AND APPLICATIONS THEREOF
AU2002367943A1 (en) 2001-12-18 2003-12-22 University Of North Carolina At Chapel Hill Improved reagents and methods for producing parvoviruses
US20040002159A1 (en) * 2002-04-05 2004-01-01 Weidong Xiao Methods for the production of chimeric adeno-associated virus (AAV) vectors, compositions of chimeric AAV vectors, and methods of use thereof
DE60310297T2 (en) * 2002-04-29 2007-06-06 Trustees Of The University Of Pennsylvania Method for direct recovery and amplification of integrated viruses from cellular tissue DNA
PT3235827T (en) 2003-06-19 2021-04-09 Genzyme Corp Aav virons with decreased immunoreactivity and uses therefor
HUE033158T2 (en) * 2003-09-30 2017-11-28 Univ Pennsylvania Adeno-associated virus (AAV) clades, sequences, vectors containing same, and uses thereof
US20090054823A1 (en) 2004-09-30 2009-02-26 The Trustees Of The University Of Pennsylvania Perfusion circuit and use therein in targeted delivery of macromolecules
EP3603676A1 (en) 2005-04-07 2020-02-05 The Trustees of the University of Pennsylvania Method of increasing the function of an aav vector
US7788045B2 (en) 2005-09-01 2010-08-31 Meditasks, Llc Systems and method for homeostatic blood states
EP2018421B1 (en) 2006-04-28 2012-12-19 The Trustees of the University of Pennsylvania Scalable production method for aav
JP2009102988A (en) 2007-10-19 2009-05-14 Toyota Motor Corp Fuel injection device for internal combustion engine
JP5634272B2 (en) 2008-03-14 2014-12-03 ヒューマンザイム リミテッド Recombinant production of authentic human protein using human cell expression system
US20090280103A1 (en) 2008-04-04 2009-11-12 Martin Flueck Regulation of muscle repair
WO2010065630A2 (en) 2008-12-03 2010-06-10 The Johns Hopkins University Compositions and methods for treating hepatic neoplasia
DK2561073T3 (en) 2010-04-23 2016-12-12 Univ Massachusetts Aav vectors targeted to central nervous system and methods of use thereof
EP2731470B1 (en) 2011-07-15 2017-09-06 Alfred Kärcher GmbH & Co. KG Rotating brush and sweeping machine with a rotating brush
US9434928B2 (en) 2011-11-23 2016-09-06 Nationwide Children's Hospital, Inc. Recombinant adeno-associated virus delivery of alpha-sarcoglycan polynucleotides
JP6373763B2 (en) 2012-02-17 2018-08-22 ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィアＴｈｅ Ｃｈｉｌｄｒｅｎ’Ｓ Ｈｏｓｐｉｔａｌ Ｏｆ Ｐｈｉｌａｄｅｌｐｈｉａ AAV vector components and methods for gene transfer into cells, organs and tissues
WO2013170078A1 (en) 2012-05-09 2013-11-14 Oregon Health & Science University Adeno associated virus plasmids and vectors
US9819463B2 (en) 2016-02-18 2017-11-14 Huawei Technologies Co., Ltd. Method and apparatus for transmitting data in a wireless communication system
SG10201912969XA (en) 2017-02-28 2020-02-27 Univ Pennsylvania Adeno-associated virus (aav) clade f vector and uses therefor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000028061A2 (en) * 1998-11-05 2000-05-18 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
一种通用型重组2型腺伴随病毒载体的构建及外源基因表达的研究;张桐等;《西安医科大学学报》;19970930;第18卷(第3期);第312-316，320页 *
一种高效的重组腺伴随病毒载体生产系统;伍志坚等;《中国科学（C辑）》;20011031;第31卷(第5期);第423-430页 *

Also Published As

Publication number Publication date
US20170240921A1 (en) 2017-08-24
US20210285012A1 (en) 2021-09-16
CA2864537C (en) 2016-11-29
CN105671005B (en) 2020-09-15
US11377669B2 (en) 2022-07-05
SG10202108118RA (en) 2021-08-30
SG168422A1 (en) 2011-02-28
PL404537A1 (en) 2014-02-17
EP1456419B1 (en) 2011-08-17
ATE520707T1 (en) 2011-09-15
DE60209193D1 (en) 2006-04-20
US20160097040A1 (en) 2016-04-07
EP2341068A1 (en) 2011-07-06
US20110151434A1 (en) 2011-06-23
CA2406745A1 (en) 2003-05-13
BR122016004944B8 (en) 2021-07-27
US20220025401A1 (en) 2022-01-27
EP1310571A3 (en) 2003-08-13
NZ618298A (en) 2015-04-24
HUP0600229A3 (en) 2010-01-28
KR101015854B1 (en) 2011-02-23
ATE317916T1 (en) 2006-03-15
US10526617B2 (en) 2020-01-07
PL222683B1 (en) 2016-08-31
MXPA04004600A (en) 2004-08-13
BR122016004546B1 (en) 2016-11-29
ES2455126T3 (en) 2014-04-14
IL161827A0 (en) 2005-11-20
BRPI0214119B1 (en) 2016-09-27
HK1068925A1 (en) 2005-05-06
CA3066428C (en) 2022-05-24
IL227866A0 (en) 2013-09-30
HU229379B1 (en) 2013-11-28
NZ600121A (en) 2013-12-20
ES2439515T3 (en) 2014-01-23
US11499167B2 (en) 2022-11-15
EP2338900A1 (en) 2011-06-29
BRPI0214119B8 (en) 2021-05-25
JP5140627B2 (en) 2013-02-06
JP2005525086A (en) 2005-08-25
ZA200403360B (en) 2005-04-26
PL397823A1 (en) 2012-07-16
US10544432B2 (en) 2020-01-28
IL233391A (en) 2016-12-29
JP3958191B2 (en) 2007-08-15
DE60209193T2 (en) 2006-09-28
US20030138772A1 (en) 2003-07-24
WO2003042397A3 (en) 2004-02-05
IL233391A0 (en) 2014-08-31
JP2009195237A (en) 2009-09-03
JP2003235562A (en) 2003-08-26
WO2003042397A2 (en) 2003-05-22
EP2338900B1 (en) 2014-01-01
CA2915124A1 (en) 2003-05-22
PL217623B1 (en) 2014-08-29
CN103555676A (en) 2014-02-05
CA2756866C (en) 2017-06-06
NO20150196L (en) 2004-07-14
CA2465868C (en) 2017-02-28
IL221602A0 (en) 2012-10-31
US20220213501A1 (en) 2022-07-07
AU2002361573B2 (en) 2008-06-12
US20180030479A1 (en) 2018-02-01
IL270065B1 (en) 2023-06-01
JP5969547B2 (en) 2016-08-17
IL227866A (en) 2015-11-30
CN103589692A (en) 2014-02-19
US20190024117A1 (en) 2019-01-24
PL409838A1 (en) 2015-07-20
CA2756866A1 (en) 2003-05-22
IL193525A (en) 2014-08-31
CN102181480B (en) 2016-01-27
US20130045186A1 (en) 2013-02-21
PL221877B1 (en) 2016-06-30
IL258545A (en) 2018-06-28
BR0214119A (en) 2005-06-28
EP2341068B1 (en) 2013-09-25
KR20050058234A (en) 2005-06-16
BR122016004944B1 (en) 2016-11-22
CA3159060A1 (en) 2003-05-22
IL213810A0 (en) 2011-07-31
IL234063A (en) 2017-06-29
CA2945734A1 (en) 2003-05-22
EP1310571A2 (en) 2003-05-14
US20200131534A1 (en) 2020-04-30
US9790472B2 (en) 2017-10-17
IL161827A (en) 2009-11-18
JP5669795B2 (en) 2015-02-18
NZ564506A (en) 2009-09-25
IL270065B2 (en) 2023-10-01
IL193525A0 (en) 2009-02-11
HUP0600229A2 (en) 2006-06-28
NO20042183L (en) 2004-07-14
NZ548094A (en) 2008-07-31
CN103555678A (en) 2014-02-05
HK1056198A1 (en) 2004-02-06
CN103555677A (en) 2014-02-05
IL213810A (en) 2014-08-31
NO20140988L (en) 2004-07-14
US8524446B2 (en) 2013-09-03
JP2014239680A (en) 2014-12-25
PH12014501487A1 (en) 2015-12-07
US20170298388A1 (en) 2017-10-19
MX346493B (en) 2017-03-21
KR101014207B1 (en) 2011-02-14
CA3159060C (en) 2023-05-16
NZ532635A (en) 2007-05-31
US10508286B2 (en) 2019-12-17
JP4677187B2 (en) 2011-04-27
EP1456419A2 (en) 2004-09-15
US10308958B2 (en) 2019-06-04
US11034976B2 (en) 2021-06-15
NO338362B1 (en) 2016-08-15
KR20100029134A (en) 2010-03-15
PH12014501487B1 (en) 2015-12-07
US11041171B2 (en) 2021-06-22
SG10201912509RA (en) 2020-02-27
EP1310571B1 (en) 2006-02-15
CA2915124C (en) 2018-08-14
IL248724A0 (en) 2017-01-31
NO334379B1 (en) 2014-02-24
CA2864537A1 (en) 2003-05-22
JP6212142B2 (en) 2017-10-11
PL220644B1 (en) 2015-11-30
US11034977B2 (en) 2021-06-15
JP2013013414A (en) 2013-01-24
IL221602A (en) 2015-09-24
SG157224A1 (en) 2009-12-29
US20200080109A1 (en) 2020-03-12
IL248724B (en) 2018-04-30
CA2465868A1 (en) 2003-05-22
JP2016136953A (en) 2016-08-04
CN103589692B (en) 2018-07-24
US10041090B2 (en) 2018-08-07
CN103555676B (en) 2016-08-31
CN102181480A (en) 2011-09-14
IL270065A (en) 2019-12-31
SG10201506627PA (en) 2015-10-29
DK1310571T3 (en) 2006-06-19
US20200087684A1 (en) 2020-03-19
CN105671005A (en) 2016-06-15
CN103555677B (en) 2018-01-30
CA3066428A1 (en) 2003-05-22
BR122016004546B8 (en) 2021-07-27
NO336801B1 (en) 2015-11-02
NO20131359L (en) 2004-07-14
NZ578982A (en) 2011-03-31
US8906675B2 (en) 2014-12-09
CA2945734C (en) 2020-02-25
NO336468B1 (en) 2015-08-31
NZ591012A (en) 2012-06-29
PH12016502583A1 (en) 2017-10-18
CA2406745C (en) 2006-01-10
PL373864A1 (en) 2005-09-19
ES2258601T3 (en) 2006-09-01
MX359371B (en) 2018-09-25
HU230406B1 (en) 2016-04-28
IL234063A0 (en) 2014-09-30
US20110263027A1 (en) 2011-10-27
IL258545B (en) 2019-11-28
EP1456419A4 (en) 2005-11-09

Similar Documents

Publication Publication Date Title
CN103555678B (en) The method for the novel sequences that detection and/or identification adeno-associated virus (AAV) sequence and separation are identified
CN102199626B (en) Adeno-associated virus (AAV) clades, sequences, vectors containing same, and uses therefor
AU2002361573A1 (en) A method of detecting and/or identifying ADENO-associated virus (AAV) sequences and isolating novel sequences identified thereby
AU2017279564B2 (en) ADENO-ASSOCIATED VIRUS cy.5 (AAVcy.5) SEQUENCES AND RECOMBINANT AAVs COMPRISING SAME
CN101426935B (en) A method of detecting and/or identifying adeno-associated virus (aav) sequences and isolating novel sequences identified thereby

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CX01 Expiry of patent term
CX01 Expiry of patent term

Granted publication date: 20180209