CN103525853B - The application of CBF1 gene in the high temperature resistance improving viride - Google Patents

The application of CBF1 gene in the high temperature resistance improving viride Download PDF

Info

Publication number
CN103525853B
CN103525853B CN201310456814.1A CN201310456814A CN103525853B CN 103525853 B CN103525853 B CN 103525853B CN 201310456814 A CN201310456814 A CN 201310456814A CN 103525853 B CN103525853 B CN 103525853B
Authority
CN
China
Prior art keywords
cbf1
viride
gene
impgwb502
mould
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201310456814.1A
Other languages
Chinese (zh)
Other versions
CN103525853A (en
Inventor
朱廷恒
王渭霞
陈勇
汪琨
崔志峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Hemin Biotechnology Co Ltd
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN201310456814.1A priority Critical patent/CN103525853B/en
Publication of CN103525853A publication Critical patent/CN103525853A/en
Application granted granted Critical
Publication of CN103525853B publication Critical patent/CN103525853B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides the application of CBF1 gene at the high temperature resistance of raising viride (Trichoderma viride), and the construction process turning CBF1 gene viride engineering bacteria providing a kind of high temperature resistance good.The transcription factor CBF1 gene of plant has been cloned in the present invention, construct the expressed in fungi binary vector of this gene, utilize agriculture bacillus mediated method to be transferred in viride (T.viride), the high temperature resistance ability of coercing turning the trichoderma viride strain of CBF1 gene of acquisition has had raising.The present invention to improving the mould ability conformed of wood, and then improves biocontrol efficacy, expands the mould use in farmland of wood, has important application prospect.

Description

The application of CBF1 gene in the high temperature resistance improving viride
(1) technical field
The present invention relates to the application of CBF1 gene at the high temperature resistance of raising viride (Trichoderma viride), and a kind of construction process turning CBF1 gene viride engineering bacteria.
(2) background technology
Wood mould (Trichoderma spp.) belongs to Deuteromycotina Moniliaceae, be a kind of multi-functional filamentous fungus, in the biological control, edatope of Plant diseases, the decomposition of the degraded of toxic substance and soil remediation, the soil organism is become thoroughly decomposed and has purposes widely in Micro Ecosystem improvement, the production of cellulase and the utilization of cellulosic material etc.
Wood is mould is apply the most successfully Plant diseases biocontrol fungi up to now, and common wood is mould viride (T.viride), trichoderma harziarum (T.hazinum), healthy and free from worry wood mould (T.konigii).Some trichoderma strains have been widely used in the biological control of Plant diseases, the fungus-caused soil such as control sickle-like bacteria (Fusariumspp.), dry thread Pyrenomycetes (Rhizoctonia solani), Verticillium (Verticillia dahelia), Sclerotium rolfsii (Sclerotium rolfsii) bacterium passes root disease as root rot, blight, canker, verticillium, southern blight etc., also the fungus-caused leaf portion gray molds etc. such as Botrytis cinerea (Botrytis cinerea) can be prevented and treated, Be very effective.The mould biological control mechanism of action of wood mainly comprises competition, superparasitism, antagonism, generation antibacterial substance, induces host to produce several aspects such as disease resistance.The mould growth of wood is rapid, low to nutritive substance requirement, the cellulase system that secretion is abundant, can be survived in the habitat containing organic matter such as plant residue, soil by mycelial growth and propagative spore.Wood is mould also can be colonized on some mycomas, cause host mycelia to be cleared up with the mycelia of other fungi for food, dead.The antimicrobial substance of the mould generation of wood comprises trichodermin, wood glue mycin etc., can suppress other microbial growths.In addition, wood is mould can also produce system resume and Promoting plant growth by inducing plant.Therefore, wood is mould is made into the several formulations such as spore powder, and be widely used in disease flocking biocontrol, business-like Trichoderma preparation on sale at present has multiple.
But be applied in the process of biocontrol of plant disease at Trichoderma preparation, prevention effect is larger by the impact of envrionment conditions.Wood is mould inevitably will in the face of some adverse environments, and as high temperature, low temperature and high salt and arid etc., this directly affects wooden mould existence.Concerning biological control, first wood is mould must can adapt to residing ecological environmental condition and can survive well surely grow, and then just can demonstrate effect.Manyly in laboratory, show good bacterial strain, often can not conform when Field information, can not effectively surely grow, thus cause preventive effect to decline.Especially, under the disadvantageous edatope condition such as lower, too high or too low for temperature, higher high osmotic pressure caused of salinity of some humidity, the disease-controlling effect of Trichoderma preparation in field significantly declines, and major cause is exactly that survival rate is too low.Temperature as lower in winter becomes the key factor affecting wooden mould existence, and during this period, application wood is mould may to resist cold the disease that strain plant pathogenic fungi causes by protective plant.Such as, the control of the snow mold of high latitude area cereal crop in winter and turfgrass generation.American Studies person have developed a strain and to resist cold trichoderma strain apply for United States Patent (USP) (5418165), and bacterial strain product spore ability at low temperatures strengthens, and may be used for the control of plant disease of low temp area.Wood as biocontrol agent application is mould, and another maximally related limiting factor is that they are impatient at dry condition.Soil moisture is the important factor affecting wooden mould activity, and as spore germination, germ tube growth and mycelial growth, moisture shows the conclusive effect of the mould saprophytic ability of wood.But, even if some plant pathogenic fungis also can grow up at the soil of drying cause Plant diseases.In addition, arid is often adjoint with the edatope of high osmotic pressure, research finds to cause the Fusarium oxysporum of tomato wilt disease (F.oxysporum) spore germination under salt stress to start, and just can infect tomato and form the symptoms such as wilting and yellow under high salt levels.
Therefore, improve the mould adaptive faculty to adverse environment of wood, as improved the mould low temperature resistant or high temperature of wood and the tolerance to salt stress and high osmotic pressure, just can improve its adaptive faculty to poor environment, this is for significant the mould application in biological control of wood.Utilize genetic engineering technique to carry out genetic improvement to wood is mould, improving its resistance is a very potential approach.But, at present the expression improving the mould relevant lytic enzyme of wood is mainly concentrated on to the genetically engineered improvement of trichoderma strain, as chitinase (chitinases), cellulase (cellulases), zytase (xylanase), dextranase (glucanase) and proteolytic enzyme (proteinases) etc., then almost do not have the improvement of the mould resistance aspect of wood.
(3) summary of the invention
The object of the invention is to provide the application of CBF1 gene at the high temperature resistance of raising viride (Trichoderma viride), and the construction process turning CBF1 gene viride engineering bacteria providing a kind of high temperature resistance good.
The application of CBF1 gene in the high temperature resistance improving viride (Trichoderma viride).Viride is well-grown within the scope of 20 ~ 30 DEG C generally, can produce abundant spore, and under the high temperature of about 37 DEG C, growth weakens, and produces spore ability and declines.Turn after CBF1 gene viride engineering bacteria cultivates process under 37 DEG C of high temperature in the present invention, significantly improve than the non-transgenic starting strain of wild-type and produce spore ability.
Concrete, described CBF1 gene order is as shown in SEQ ID No.1:
1 atgaactcat tttcagcttt ttctgaaatg tttggctccg attacgagcc tcaaggcgga
61 gattattgtc cgacgttggc cacgagttgt ccgaagaaac cggcgggtcg taagaagttt
121 cgtgaaactc gtcacccaat ttacagagga gttcgtcaaa gaaactccgg taagtgggtg
181 tctgaagtga gagagccaaa caagaaaacg aggatttggc tcgggacttt ccaaaccgct
241 gagatggcag ctcgtgctca cgacgtcgct gcattagccc tccgtggccg atcagcatgt
301 ctcaacttcg ctgactcggc ttggcggcta cgaatccctg agtcaacatg cgccaaggat
361 atccaaaaag cggctgctga agcggcgttg gcttttcaag atgagacgtg tgatacgacg
421 accacggatc atggcctgga catggaggag acgatggtgg aagctattta tacaccggaa
481 cagagcgaag gtgcgtttta tatggatgag gagacaatgt ttgggatgcc gagtttgttg
541 gataatatgg ctgaaggcat gcttttaccg ccgccgtctg ttcagtggaa tcataattat
601 gacggcgaag gagatggtga cgtgtcactt tggagttact aa
The invention still further relates to a kind of construction process turning CBF1 gene viride engineering bacteria, described method comprises:
(1) mixed with carrier pENTR by the CBF1 gene of sequence as shown in SEQ ID No.1, transformation of E. coli DH5 α competent cell, transformant, after order-checking confirms that sequence is correct, obtains pENTR-CBF1;
(2) pENTR-CBF1 and carrier ImpGWB502 is passed through LR recombining reaction by CBF1 transgenosis, after order-checking confirms, obtain expression vector ImpGWB502-CBF1;
(3) expression vector ImpGWB502-CBF1 is proceeded to Agrobacterium, through PCR qualification, obtain the Agrobacterium with object plasmid ImpGWB502-CBF1;
(4) by the Agrobacterium inoculation with object plasmid ImpGWB502-CBF1 in containing the LB solid medium of 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, cultivate after 2 ~ 3 days for 28 DEG C, picking list bacterium colony is connected in the LB liquid nutrient medium containing 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, 28 DEG C, 200r/min is cultured to thalline OD 600when being 1.0, with MM liquid nutrient medium by bacterium liquid dilution OD 600to 0.15, then add the Syringylethanone of 200 μm of ol/mL, in 28 DEG C, 200r/min inducing culture 5 ~ 6h, to OD 600be 0.5 ~ 0.6, obtain Agrobacterium bacterium liquid;
(5) step (4) gained Agrobacterium bacterium liquid and isopyknic concentration are 1 × 10 6~ 1 × 10 7after the viride spore suspension mixing of individual/mL, coat on the MM solid medium containing 200 μm of ol/mL Syringylethanones, 24 DEG C of Dual culture 48h, screening positive clone also through PCR qualification, turns CBF1 gene viride engineering bacteria described in acquisition;
Described MM liquid nutrient medium is composed as follows: 10mM glucose, 0.5% glycerine, 200 μMs of Syringylethanones, 2.5mM NaCl, 2mM MgSO 4, 0.45mMCaCl 2, 9mM FeSO 4, 4mM (NH 4) 2sO 4, solvent is the phosphoric acid buffer of pH5.3; Described MM solid medium is composed as follows: 15g/L agar, 10mM glucose, 0.5% glycerine, 200 μMs of Syringylethanones, 2.5mM NaCl, 2mMMgSO 4, 0.45mM CaCl 2, 9mM FeSO 4, 4mM (NH 4) 2sO 4, solvent is the phosphoric acid buffer of pH5.3.
The transcription factor CBF1 gene of plant has been cloned in the present invention, construct the expressed in fungi binary vector of this gene, utilize agriculture bacillus mediated method to be transferred in viride (T.viride), the high temperature resistance ability of coercing turning the trichoderma viride strain of CBF1 gene of acquisition has had raising.So far, the relevant report that CBF1 gene improves wooden mould anti-adversity ability is not also applied.The present invention to improving the mould ability conformed of wood, and then improves biocontrol efficacy, expands the mould use in farmland of wood, has important application prospect.
Beneficial effect of the present invention is mainly reflected in: can implement genetically engineered to viride according to the inventive method and build the engineering bacteria turning CBF1 gene, the trichoderma viride turning CBF1 gene can improve the tolerance scope to temperature, and under high temperature, survival rate improves and produces spore ability and strengthens.Like this, turn the mould environment that just can expand its application of the wood of CBF gene, colonization ability and survival rate improve, and improve the effect of this bacterium in the biological control of Plant diseases, the biological restoration of soil and improvement, bio-feritlizer are prepared etc.
(4) accompanying drawing explanation
Fig. 1 is CBF1 gene PCR amplified fragments electrophoresis result figure;
Fig. 2 is ImpGWB502-CBF1 and vector construction schematic diagram;
Fig. 3 is CBF1 transformant PCR qualification result; M:DNA standard molecular weight; 1: wild type strain; 2 ~ 8: transformant bacterial strain;
Fig. 4 is CBF1 transformant and wild-type at 4 DEG C, growing state on PDA flat board; WT: wild-type; CBF1-4, CBF1-13: transformant;
Fig. 5 is that wild-type wood is mould with the product spore situation of transformant on PDA flat board; WT: wild-type; CBF1-4, CBF1-9, CBF1-12: transformant.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1:
One, the structure of CBF1 Gene clone and expression carrier
Extract Arabidopis thaliana mRNA, utilize round pcr to increase as template after reverse transcription becomes cDNA and obtain CBF1 gene fragment.According to ncbi database CBF1 gene (GenBank:FJ169262.1) primers, before the initiator codon of gene, add CACC nucleotide sequence, be convenient to clone.Primer pair is:
CBF1-F01 CACCATGAACTCATTTTCGACTTT，
CBF1-R642 TTAGTAACTCCAAAGTGACACGT
After pcr amplification reaction, the target clone CBF1 gene fragment length obtained is that 642bp(sequence is shown in SEQ ID No.1), PCR primer as Fig. 1, cuts glue recovery, purifying to object fragment through agarose gel electrophoresis result.Reclaim product and be used for next step.
Gene clone and vector construction adopt Gateway tMclone technology (Invitrogen company).The CBF1 gene fragment and carrier pENTR that obtain increasing tM/ (Invitrogen) mix rear 25 DEG C of incubation 5min, transformation of E. coli DH5 α competent cell, transformant, after order-checking confirms that sequence is correct, obtains pENTR-CBF1.
PENTR-CBF1 and two-element target expression vector ImpGWB502(Japan professor SumieIshiguro provides) between by LR recombining reaction (LR Mix, Invitrogen) by CBF1 transgenosis, LR reaction product and the mixing of colibacillary competent cell transform, obtain positive colony clone, extract plasmid and obtain expression vector ImpGWB502-CBF1 after order-checking confirms, this carrier is proceeded to Agrobacterium, carries out next step the mould transgenosis of agriculture bacillus mediated wood.
LR reaction system:
Temperature of reaction and time: 25 DEG C, 2h.
Above-mentioned two plasmid maps and LR reaction process are shown in Fig. 2 with the expression vector built.
Plasmid is proceeded to Agrobacterium, and step of converting is:
1. Agrobacterium (EHA105) competent cell that-80 DEG C are preserved is placed in ice and melts 10min.
2. in the Agrobacterium competent cell of 50 μ L, 2 ~ 3 μ L vector plasmid ImpGWB502-CBF1 are added, gently ice bath 30min after mixing.
3. 10min is placed for liquid nitrogen flash freezer 3 ~ 5min or-70 DEG C.
4., in 42 DEG C of water-baths after thermal shock 60s, in ice, 1 ~ 2min is placed immediately.
5. the LB liquid nutrient medium of 200 μ L28 DEG C of pre-temperature is added, 28 DEG C, renewal cultivation 2h
6. get 200 μ L to coat and be added with in corresponding anti-element (spectinomycin, 100 μ g/mL) plate culture medium, be inverted, 28 DEG C cultivate 2 ~ 3 days.
7. choose single bacterium colony and carry out PCR qualification, and preserve bacterial classification.
LB substratum: Tryptones (Tryptone) 10g, yeast extract (Yeast extract) 5g, sodium-chlor (NaCl) 10g, add water 1L, pH7.0 ~ 7.2.LB solid medium adds 15g agar again on LB liquid nutrient medium basis.
The genetic transformation of two, agriculture bacillus mediated CBF1 gene pairs viride
1) wooden mould recipient bacterium prepares
1. by viride bacterial classification (ACCC30552, Chinese agriculture Microbiological Culture Collection administrative center) on PDA solid medium 23 DEG C cultivate about 4 days, treat that flat board covers with green spore, with sterilized water, reesei spores is eluted from PDA flat board, filtered through gauze removes mycelia, blood counting chamber counting, is diluted to 1 × 10 by spore again 6~ 1 × 10 7individual/mL;
PDA liquid nutrient medium: peeled potatoes 200g, water 1000mL, boils 20min, adds 20g glucose, add water to 1000mL after filtered through gauze, pH nature.PDA solid medium adds 20g agar again on PDA liquid nutrient medium basis.
2. by with object plasmid ImpGWB502-CBF1 Agrobacterium 28 DEG C, LB substratum is (containing 100 μ g/mL spectinomycins, 50 μ g/mL Rifampins) cultivation 2 ~ 3 days on flat board, picking list bacterium colony is connected to 5mL LB(containing 100 μ g/mL spectinomycins, 50 μ g/mL Rifampins) in liquid nutrient medium, 28 DEG C, 200r/min cultivates 12h; At thalline OD 600when being about 1.0, with MM liquid nutrient medium by bacterium liquid dilution OD 600to about 0.15, add Syringylethanone (200 μm of ol/mL), in 28 DEG C, 200r/min inducing culture 5 ~ 6h, to OD 600be 0.5 ~ 0.6.
MM(Minimal Medium) liquid nutrient medium: 10mM glucose, 0.5%(v/v) glycerine, 200 μMs of Syringylethanones, 2.5mM NaCl, 2mM MgSO 4, 0.45mMCaCl 2, 9mM FeSO 4, 4m M (NH 4) 2sO 4, solvent is the phosphoric acid buffer of pH5.3.MM solid medium adds the agar of 15g/L again on MM liquid nutrient medium basis.
2) Agrobacterium and viride Dual culture
At IM culture medium flat plate (MM solid medium+200 μm of ol/mL Syringylethanones) upper berth one deck aseptic filter paper.100mL Agrobacterium is mixed with the reesei spores suspension that 100mL has diluted, coats on this foster base, 24 DEG C of Dual culture 48h;
3) screening of wooden mould transformant obtains
1. filter paper is cut into strip, is laid in PDA(containing cynnematin 200 μ g/mL and hygromycin B 100 μ g/mL) in flat board, 23 DEG C of cultivations, the appearance of observation transformant.
2. picking transformant, the three generations that transfers continuously containing the PDA flat board of hygromycin B (200 μ g/mL), carries out single spore separation cultivation after obtaining the transformant of genetic stability and preserves bacterial strain, carrying out Molecular Identification further.
3. transformant is carried out to the Molecular Identification of CBF gene.Transformant and wild-type wood is mould carry out liquid culture 2 ~ 3d after get mycelia and extract genomic dna and (utilize fungal genomic DNA to extract test kit Biospin Fungus Genomic DNA extraction Kit, Hangzhou Bo scientific & technical corporation), take genomic dna as template, PCR qualification is carried out with CBF1 gene specific primer, pcr amplification through agarose gel electrophoresis, result shows that wild type strain does not amplify target fragment, and transformant has all occurred illustrating that CBF1 gene has been inserted in viride genomic dna by the CBF1 gene fragment band of expecting.Fig. 3 shows the PCR qualification result of Partial Conversion.
Three, the mould phenotype qualification of wood of CBF1 gene is turned
1) the low temperature resistant research of transformant
First on PDA flat board, activate wooden mould wild-type and transformant bacterial strain, cultivate 2 ~ 3 days for 23 DEG C, make wild-type homogeneous with the mould growing way of transformant wood, re-use the punch tool punching uniform bacterium block of preparation and to transfer to other PDA flat board central.The flat board being connected to bacterium block is placed in 4 DEG C of incubators and places about 10d, then take out (now wooden mould not growth), be placed in 23 DEG C of incubators after continuing to cultivate 3d, measure colony growth diameter.The subzero treatment growing state of Partial Conversion and wild type strain is shown in Fig. 4.
Found that the large 0.4cm of transformant growth diameter average specific wild-type, but the significance of difference is not high, after showing to turn CBF1 gene, slightly can improves the anti-seismic design that wood is mould, but not remarkable.
2) the high temperature resistant research of transformant
According to the method described above, the bacterium block that mould for wood transformant and wild-type punch is seeded in the dull and stereotyped central authorities of PDA, is placed in 37 DEG C of incubators and processes 24h, then after flat board being transferred to 23 DEG C of incubators continuation cultivation 4d, measure the growth diameter of bacterium colony.After the pyroprocessing of wild-type and Partial Conversion, growth and product spore situation are shown in Fig. 5.
Found that, after pyroprocessing, transformant starts very fast than the growth of wild-type, and sporulation quantity is large.Cultivate after 4d at 23 DEG C, the growth diameter of transformant comparatively wild-type is compared and is wanted high, and a minimum strain is 2cm larger than wild-type also, reaches 42%, overall conversion daughter colony diameter mean value 2.7cm larger than wild-type, nearly 60%.Wherein grow the fastest strain transformant CBF1-12 3cm larger than wild-type, namely 65%.These results suggest that the high-temperature resistance of wooden mould CBF1 transformant has obvious enhancing compared with wild-type.

Claims (2)

1. cBF1gene raising viride ( trichoderma viride) high temperature resistance in application, described in cBF1gene order is as shown in SEQ ID No.1.
2. one kind turns cBF1the construction process of gene viride engineering bacteria, described method comprises:
(1) by sequence as shown in SEQ ID No.1 cBF1gene mixes with carrier pENTR, transformation of E. coli DH5 α competent cell, and transformant, after order-checking confirms that sequence is correct, obtains pENTR-CBF1;
(2) pENTR-CBF1 and carrier ImpGWB502 being passed through LR recombining reaction will cBF1transgenosis, after order-checking confirms, obtains expression vector ImpGWB502-CBF1;
(3) expression vector ImpGWB502-CBF1 is proceeded to Agrobacterium, through PCR qualification, obtain the Agrobacterium with object plasmid ImpGWB502-CBF1;
(4) by the Agrobacterium inoculation with object plasmid ImpGWB502-CBF1 in containing the LB solid medium of 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, cultivate after 2 ~ 3 days for 28 DEG C, picking list bacterium colony is connected in the LB liquid nutrient medium containing 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, 28 DEG C, 200r/min is cultured to thalline OD 600when being 1.0, with MM liquid nutrient medium by bacterium liquid dilution OD 600to 0.15, then add the Syringylethanone of 200 μm of ol/mL, in 28 DEG C, 200r/min inducing culture 5 ~ 6h, to OD 600be 0.5 ~ 0.6, obtain Agrobacterium bacterium liquid;
(5) step (4) gained Agrobacterium bacterium liquid and isopyknic concentration are 1 × 10 6~ 1 × 10 7after the viride spore suspension mixing of individual/mL, coat on the MM solid medium containing 200 μm of ol/mL Syringylethanones, 24 DEG C of Dual culture 48h, screening positive clone also through PCR qualification, obtains described turning cBF1gene viride engineering bacteria;
Described MM liquid nutrient medium is composed as follows: 10mM glucose, 0.5% glycerine, 200 μMs of Syringylethanones, 2.5mM NaCl, 2mM MgSO 4, 0.45mM CaCl 2, 9mM FeSO 4, 4mM (NH 4) 2sO 4, solvent is the phosphoric acid buffer of pH 5.3; Described MM solid medium is composed as follows: 15g/L agar, 10mM glucose, 0.5% glycerine, 200 μMs of Syringylethanones, 2.5mM NaCl, 2mM MgSO 4, 0.45mMCaCl 2, 9mM FeSO 4, 4mM (NH 4) 2sO 4, solvent is the phosphoric acid buffer of pH 5.3.
CN201310456814.1A 2013-09-29 2013-09-29 The application of CBF1 gene in the high temperature resistance improving viride Active CN103525853B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310456814.1A CN103525853B (en) 2013-09-29 2013-09-29 The application of CBF1 gene in the high temperature resistance improving viride

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310456814.1A CN103525853B (en) 2013-09-29 2013-09-29 The application of CBF1 gene in the high temperature resistance improving viride

Publications (2)

Publication Number Publication Date
CN103525853A CN103525853A (en) 2014-01-22
CN103525853B true CN103525853B (en) 2015-08-05

Family

ID=49928201

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310456814.1A Active CN103525853B (en) 2013-09-29 2013-09-29 The application of CBF1 gene in the high temperature resistance improving viride

Country Status (1)

Country Link
CN (1) CN103525853B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100095406A1 (en) * 2008-06-16 2010-04-15 Academia Sinica Method of Controlling Plant Growth and Architecture by Controlling Expression of Gibberellin 2-Oxidase
CN102234320A (en) * 2010-04-27 2011-11-09 中国农业科学院作物科学研究所 Plant stress-tolerant associated protein TaDREB4B and encoding gene and application thereof
CN102234323A (en) * 2010-04-27 2011-11-09 中国农业科学院作物科学研究所 Plant stress-tolerance-associated protein TaDREB3A and coding gene and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100095406A1 (en) * 2008-06-16 2010-04-15 Academia Sinica Method of Controlling Plant Growth and Architecture by Controlling Expression of Gibberellin 2-Oxidase
CN102234320A (en) * 2010-04-27 2011-11-09 中国农业科学院作物科学研究所 Plant stress-tolerant associated protein TaDREB4B and encoding gene and application thereof
CN102234323A (en) * 2010-04-27 2011-11-09 中国农业科学院作物科学研究所 Plant stress-tolerance-associated protein TaDREB3A and coding gene and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants;M.AKHTAR等;《Journal of Genetics》;20121231;第91卷(第3期);385-395 *
FJ169262.1;Zhen,Y.等;《GenBank》;20081202;核酸序列表 *
根癌农杆菌介导转化获得耐逆性增强的高羊茅转基因植物;吴关庭 等;《中国农业科学》;20051231;第38卷(第12期);2395-2402 *
转DREB1A基因地被菊耐旱节水性;于洋 等;《东北林业大学学报》;20110831;第39卷(第8期);33-35，39 *

Also Published As

Publication number Publication date
CN103525853A (en) 2014-01-22

Similar Documents

Publication Publication Date Title
Ren et al. Biocontrol potential of an endophytic Bacillus pumilus JK-SX001 against poplar canker
CN102071145B (en) Trichoderma viride fungi and preparation and application of fungicide thereof
CN104498386B (en) The preparation method and application of raw Bacillus amyloliquefaciens strain SZ23 and zymotic fluid in wild jujube
CN104531559B (en) Bacillus amyloliquefaciens Lh 1 and its application
CN104946567B (en) The brown bacillus of one plant of depth and its application
CN101144066B (en) Burkholderia multifunctional engineering strain and construction method thereof
CN101525587B (en) Streptomyces strain and application thereof
CN104403962B (en) Application in terms of one plant of Te Jila bacillus and its prevention and treatment Fusarium graminearum
CN107099467B (en) Pseudomonas aeruginosa XCS007 and application thereof in prevention and treatment of tobacco black shank
CN105734000A (en) Paenibacillus polymyxa NSY50 with capabilities of promoting growth and preventing diseases
CN104988077B (en) A kind of production high temperature fiber element enzyme and the fine penicillium of zytase and application
CN106479943A (en) The Java Isaria BE01 of one plant height effect preventing and treating fall webworms and its application
CN111518704A (en) Biological control type strain TF-08, culture method and application thereof
CN100569080C (en) The compounded pesticides of paecilomyces fumosoroseus and Imidacloprid
Babu et al. Molecular characterization and functional properties of deep-soil-inhabiting actinobacteria for combating Fusarium dieback disease in tea crop
Essghaier et al. In vivo and in vitro evaluation of antifungal activities from a halotolerant Bacillus subtilis strain J9
CN101492646B (en) Trichoderma viride engineering bacterium and uses thereof
CN109295031A (en) A kind of antifungal protein beta-1,3-glucanase and engineering bacteria and its application containing the gene
CN107586735B (en) Biocontrol strain CH01 for efficiently preventing and treating citrus canker and application thereof
CN101724573A (en) Trichoderma biocontrol recombinant engineering bacteria for efficiently expressing chitinase coding gene and Beta-1,3-glucanase coding gene as well as application thereof
CN103525853B (en) The application of CBF1 gene in the high temperature resistance improving viride
CN101812475A (en) Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof
CN107502562B (en) Recombinant metarhizium anisopliae and preparation method and application thereof
CN108384736A (en) A kind of bacterium and its screening technique having inhibiting effect to citrus rubber germ
CN103484487B (en) A kind of small cabbage moth N,O-Diacetylmuramidase II and preparation method thereof and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20190729

Address after: Room 805, Chengtou Business Center, 546 Qinglin Road, Longgang District, Shenzhen City, Guangdong Province

Patentee after: Shenzhen Hemin Biotechnology Co., Ltd.

Address before: 310014 Hangzhou city in the lower reaches of the city of Zhejiang Wang Road, No. 18

Patentee before: Zhejiang University of Technology