CN103525853A - Application of CBF1 gene for improving high-temperature tolerance of trichoderma viride - Google Patents

Abstract

The invention provides an applicaton of a CBF1 gene for improving high-temperature tolerance of trichoderma viride and futher provides a construction method for a CBF1 gene-transferring trichoderma viride engineering bacterium. According to the application, a transcription factor CBF1 gene of a plant is cloned, and a fungus expression dual-element carrier of the gene is constructed and is transferred into the trichoderma viride with an agrobacterium mediating method, so that the CBF1 gene-transferring trichoderma viride is obtained, and the high temperature stress resistance is improved. The applicaton of the CBF1 gene for improving high-temperature tolerance of the trichoderma viride can improve the adaptability to the environment, further improve the biological prevention and control capacity and enlarge the usage of the trichoderma viride in a farmland, and has an important application prospect.

Description

The application of CBF1 gene in the high temperature tolerance that improves viride

(1) technical field

The present invention relates to CBF1 gene in the application that improves the high temperature tolerance of viride (Trichoderma viride), and a kind of construction process that turns CBF1 gene viride engineering bacteria.

(2) background technology

Wood mould (Trichoderma spp.) belongs to Deuteromycotina Moniliaceae, be a kind of multi-functional filamentous fungus, in the biological control of Plant diseases, edatope, the decomposition of the degraded of toxic substance and soil remediation, the soil organism is become thoroughly decomposed and there is purposes widely Micro Ecosystem improvement, the production of cellulase and the aspects such as utilization of cellulosic material.

Wood is mould is to apply up to now the most successfully Plant diseases biocontrol fungi, and common wood is mould viride (T.viride), trichoderma harziarum (T.hazinum), healthy and free from worry wood mould (T.konigii).Some trichoderma strains have been widely used in the biological control of Plant diseases, the fungus-caused soil such as control sickle-like bacteria (Fusarium spp.), dry thread Pyrenomycetes (Rhizoctonia solani), Verticillium (Verticillia dahelia), Sclerotium rolfsii (Sclerotium rolfsii) bacterium pass root disease as root rot, blight, canker, verticillium, southern blight etc., also can prevent and treat the fungus-caused leaf such as Botrytis cinerea (Botrytis cinerea) portion gray mold etc., effect is remarkable.The mould biological control mechanism of action of wood mainly comprises that competition, superparasitism, antagonism, generation antibacterial substance, induction host produce several aspects such as disease resistance.The mould growth of wood is rapid, low to nutritive substance requirement, secretes abundant cellulase system, can containing in organic habitat, by mycelial growth and propagative spore, survive at plant residue, soil etc.The mould mycelia that also can take other fungi of wood is food, colonizes on some mycomas, causes that host mycelia is cleared up, death.The antimicrobial substance of the mould generation of wood comprises trichodermin, wood glue mycin etc., can suppress other microbial growths.In addition, wood is mould can also inducing plant generation system obtain disease resistance and Promoting plant growth.Therefore, the mould several formulations such as spore powder that have been made into of wood, are widely used in disease flocking biocontrol, and business-like wooden removing mildew at present on sale is existing multiple.

But, at wooden removing mildew, being applied in the process of biocontrol of plant disease, prevention effect is subject to the impact of envrionment conditions larger.Wood is mould inevitably will face some adverse environments, and as high temperature, low temperature and high salt and arid etc., this directly affects wooden mould existence.Concerning biological control, first wood is mould must be able to adapt to residing ecological environmental condition and can survive and surely grow well, then just can demonstrate effect.Manyly in laboratory, show good bacterial strain, while applying in field, often can not conform, can not effectively surely grow, thereby cause that preventive effect declines.Especially under lower, too high or too low for temperature, the higher disadvantageous edatope conditions such as high osmotic pressure that cause of salinity of some humidity, wooden removing mildew significantly declines at the disease-controlling effect in field, and major cause is exactly that survival rate is too low.Temperature as lower in winter becomes the key factor of the wooden mould existence of impact, during this period, and the mould disease may the cold-resistant strain plant pathogenic fungi of protective plant causing of application wood.The control of the snow mold that for example, high latitude area cereal crop in winter and turfgrass occur.American Studies person has developed the cold-resistant trichoderma strain of a strain and has applied for United States Patent (USP) (5418165), and bacterial strain product spore ability at low temperatures strengthens, can be for the control of plant disease of low temp area.Wood as biocontrol agent application is mould, and another maximally related limiting factor is that they are impatient at dry condition.Soil moisture is the important factor of the wooden mould activity of impact, as spore germination, and germ tube growth and mycelial growth, moisture has shown the conclusive effect of the mould saprophytic ability of wood.Yet, even if some plant pathogenic fungis also can grow up and cause Plant diseases at dry soil.In addition, arid is often followed with the edatope of high osmotic pressure, research is found to cause that Fusarium oxysporum (F.oxysporum) spore germination under salt stress of tomato wilt disease could start, and just can infect tomato and form the symptoms such as wilting and yellow under high salt levels.

Therefore, improve the mould adaptive faculty to adverse environment of wood, as improve mould low temperature resistant or high temperature and the tolerance to salt stress and high osmotic pressure of wood, and just can improve its adaptive faculty to poor environment, this is for significant the mould application in biological control of wood.Utilize genetic engineering technique to the mould genetic improvement that carries out of wood, improving its resistance is a very potential approach.But, at present the genetically engineered improvement of trichoderma strain is mainly concentrated on to the expression that improves the mould relevant lytic enzyme of wood, as chitinase (chitinases), cellulase (cellulases), zytase (xylanase), dextranase (glucanase) and proteolytic enzyme (proteinases) etc., the improvement of the mould resistance of wood aspect is not almost had.

(3) summary of the invention

The object of the invention is to provide CBF1 gene in the application that improves the high temperature tolerance of viride (Trichoderma viride), and the construction process that turns CBF1 gene viride engineering bacteria that a kind of high temperature tolerance is good is provided.

The application of CBF1 gene in the high temperature tolerance that improves viride (Trichoderma viride).Viride is well-grown within the scope of 20～30 ℃ generally, can produce abundant spore, and under the high temperature of 37 ℃ of left and right, growth weakens, and produces spore ability and declines.The CBF1 gene viride engineering bacteria that turns in the present invention is cultivated after processing under 37 ℃ of high temperature, than the non-transgenic starting strain of wild-type, has obviously improved product spore ability.

Concrete, described CBF1 gene order is as shown in SEQ ID No.1:

1 atgaactcat tttcagcttt ttctgaaatg tttggctccg attacgagcc tcaaggcgga

61 gattattgtc cgacgttggc cacgagttgt ccgaagaaac cggcgggtcg taagaagttt

121 cgtgaaactc gtcacccaat ttacagagga gttcgtcaaa gaaactccgg taagtgggtg

181 tctgaagtga gagagccaaa caagaaaacg aggatttggc tcgggacttt ccaaaccgct

241 gagatggcag ctcgtgctca cgacgtcgct gcattagccc tccgtggccg atcagcatgt

301 ctcaacttcg ctgactcggc ttggcggcta cgaatccctg agtcaacatg cgccaaggat

361 atccaaaaag cggctgctga agcggcgttg gcttttcaag atgagacgtg tgatacgacg

421 accacggatc atggcctgga catggaggag acgatggtgg aagctattta tacaccggaa

481 cagagcgaag gtgcgtttta tatggatgag gagacaatgt ttgggatgcc gagtttgttg

541 gataatatgg ctgaaggcat gcttttaccg ccgccgtctg ttcagtggaa tcataattat

601 gacggcgaag gagatggtga cgtgtcactt tggagttact aa

The construction process that the invention still further relates to a kind of CBF1 of turning gene viride engineering bacteria, described method comprises:

(1) by sequence, the CBF1 gene as shown in SEQ ID No.1 mixes with carrier pENTR, transforms bacillus coli DH 5 alpha competent cell, and transformant, after order-checking confirms that sequence is correct, obtains pENTR-CBF1;

(2) pENTR-CBF1 and carrier ImpGWB502 are passed through to LR recombining reaction by CBF1 transgenosis, after order-checking is confirmed, obtain expression vector ImpGWB502-CBF1;

(3) expression vector ImpGWB502-CBF1 is proceeded to Agrobacterium, through PCR, identify, obtain the Agrobacterium with object plasmid ImpGWB502-CBF1;

(4) Agrobacterium with object plasmid ImpGWB502-CBF1 is inoculated in to the LB solid medium containing 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, cultivate after 2～3 days for 28 ℃, picking list bacterium colony is connected to containing in the LB liquid nutrient medium of 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, and 28 ℃, 200r/min are cultured to thalline OD ₆₀₀be 1.0 o'clock, with MM liquid nutrient medium, bacterium liquid diluted to OD ₆₀₀to 0.15, then add the Syringylethanone of 200 μ mol/mL, in 28 ℃, 200r/min inducing culture 5～6h, to OD ₆₀₀be 0.5～0.6, obtain Agrobacterium bacterium liquid;

(5) step (4) gained Agrobacterium bacterium liquid and isopyknic concentration are 1 * 10 ⁶～1 * 10 ⁷after the viride spore suspension of individual/mL mixes, coat containing on the MM solid medium of 200 μ mol/mL Syringylethanones, cultivate altogether 48h for 24 ℃, screening positive clone also identifies through PCR, turns CBF1 gene viride engineering bacteria described in acquisition;

Described MM liquid nutrient medium is composed as follows: 10mM glucose, 0.5% glycerine, 200 μ M Syringylethanones, 2.5mM NaCl, 2mM MgSO ₄, 0.45mM CaCl ₂, 9mM FeSO ₄, 4mM (NH ₄) ₂sO ₄, the phosphoric acid buffer that solvent is pH5.3; Described MM solid medium is composed as follows: 15g/L agar, 10mM glucose, 0.5% glycerine, 200 μ M Syringylethanones, 2.5mM NaCl, 2mM MgSO ₄, 0.45mM CaCl ₂, 9mM FeSO ₄, 4mM (NH ₄) ₂sO ₄, the phosphoric acid buffer that solvent is pH5.3.

In the present invention, cloned the transcription factor CBF1 gene of plant, built the expressed in fungi binary vector of this gene, utilize agriculture bacillus mediated method to be transferred in viride (T.viride), the high temperature resistance ability of coercing of the trichoderma viride strain that turns CBF1 gene of acquisition has had raising.So far, also do not apply the relevant report that CBF1 gene improves wooden mould anti-adversity ability.The present invention is to improving the mould ability conforming of wood, and then raising biocontrol efficacy, expands the mould use in farmland of wood, has important application prospect.

Beneficial effect of the present invention is mainly reflected in: according to the inventive method, can implement genetically engineered and build the engineering bacteria that turns CBF1 gene viride, the trichoderma viride that turns CBF1 gene can improve the tolerance scope to temperature, and under high temperature, survival rate improves and the enhancing of product spore ability.Like this, turn the mould environment that just can expand its application of wood of CBF gene, colonization ability and survival rate improve, and improve this bacterium in the biological control of Plant diseases, the biological restoration of soil and improvement, bio-feritlizer such as prepare at the effect of aspect.

(4) accompanying drawing explanation

Fig. 1 is CBF1 gene PCR amplified fragments electrophoresis result figure;

Fig. 2 is ImpGWB502-CBF1 and vector construction schematic diagram;

Fig. 3 is CBF1 transformant PCR qualification result; M:DNA standard molecular weight; 1: wild type strain; 2～8: transformant bacterial strain;

The growing state that Fig. 4 is CBF1 transformant and wild-type on 4 ℃, PDA flat board; WT: wild-type; CBF1-4, CBF1-13: transformant;

Fig. 5 is the wooden mould and product spore situation of transformant on PDA flat board of wild-type; WT: wild-type; CBF1-4, CBF1-9, CBF1-12: transformant.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1:

One, the structure of CBF1 gene clone and expression vector

Extract Arabidopis thaliana mRNA, reverse transcription utilizes round pcr amplification to obtain CBF1 gene fragment as template after becoming cDNA.According to ncbi database CBF1 gene (GenBank:FJ169262.1) primers, before the initiator codon of gene, add CACC nucleotide sequence, be convenient to clone.Primer pair is:

CBF1-F01 CACCATGAACTCATTTTCGACTTT，

CBF1-R642 TTAGTAACTCCAAAGTGACACGT

After pcr amplification reaction, the target clone CBF1 gene fragment length obtaining is that 642bp(sequence is shown in SEQ ID No.1), PCR product as Fig. 1, is cut glue recovery, purifying to object fragment through agarose gel electrophoresis result.Reclaim product for next step.

Gene clone and vector construction adopt Gateway ^tMclone technology (Invitrogen company).The CBF1 gene fragment that amplification is obtained and carrier pENTR ^tM/

(Invitrogen) mix rear 25 ℃ of incubation 5min, transform bacillus coli DH 5 alpha competent cell, transformant, after order-checking confirms that sequence is correct, obtains pENTR-CBF1.

PENTR-CBF1 and two-element target expression vector ImpGWB502(Japan Sumie professor Ishiguro provides) between by LR recombining reaction (LR Mix, Invitrogen) by CBF1 transgenosis, LR reaction product and colibacillary competent cell mix conversion, obtain positive colony clone, extract plasmid and obtain expression vector ImpGWB502-CBF1 after order-checking is confirmed, this carrier is proceeded to Agrobacterium, carry out next step the mould transgenosis of agriculture bacillus mediated wood.

LR reaction system:

Temperature of reaction and time: 25 ℃, 2h.

Above-mentioned two plasmid maps and LR reaction process and the expression vector building are shown in Fig. 2.

Plasmid is proceeded to Agrobacterium, and step of converting is:

1. the Agrobacterium of-80 ℃ of preservations (EHA105) competent cell is placed in to ice and melts 10min.

2. in the Agrobacterium competent cell of 50 μ L, add 2～3 μ L vector plasmid ImpGWB502-CBF1, mix gently rear ice bath 30min.

3. liquid nitrogen flash freezer 3～5min or-70 ℃ are placed 10min.

4. in 42 ℃ of water-baths after thermal shock 60s, in ice, place immediately 1～2min.

5. the LB liquid nutrient medium that adds 200 μ L28 ℃ of pre-temperature, 28 ℃, renewal cultivation 2h

6. get 200 μ L and coat and be added with in corresponding anti-element (spectinomycin, 100 μ g/mL) plate culture medium, be inverted, 28 ℃ cultivate 2～3 days.

7. choose single bacterium colony and carry out PCR evaluation, and preserve bacterial classification.

LB substratum: Tryptones (Tryptone) 10g, yeast extract (Yeast extract) 5g, sodium-chlor (NaCl) 10g, add water to 1L, pH7.0～7.2.LB solid medium adds 15g agar on LB liquid nutrient medium basis again.

Two, the genetic transformation of agriculture bacillus mediated CBF1 gene pairs viride

1) wooden mould recipient bacterium is prepared

1. by viride bacterial classification (ACCC30552, Chinese agriculture microbial strains preservation administrative center) on PDA solid medium 23 ℃ cultivate about 4 days, treat that flat board covers with green spore, with sterilized water, the mould spore of wood is eluted from PDA flat board, filtered through gauze is removed mycelia, blood counting chamber counting, is diluted to 1 * 10 by spore again ⁶～1 * 10 ⁷individual/mL;

PDA liquid nutrient medium: peeled potatoes 200g, water 1000mL, boils 20min, adds 20g glucose after filtered through gauze, adds water to 1000mL, pH nature.PDA solid medium adds 20g agar on PDA liquid nutrient medium basis again.

2. by the Agrobacterium with object plasmid ImpGWB502-CBF1 at 28 ℃, LB substratum (containing 100 μ g/mL spectinomycins, 50 μ g/mL Rifampins) on flat board, cultivate 2～3 days, picking list bacterium colony is connected to 5mL LB(containing 100 μ g/mL spectinomycins, 50 μ g/mL Rifampins), in liquid nutrient medium, 28 ℃, 200r/min are cultivated 12h; At thalline OD ₆₀₀while being 1.0 left and right, with MM liquid nutrient medium, bacterium liquid is diluted to OD ₆₀₀to 0.15 left and right, add Syringylethanone (200 μ mol/mL), in 28 ℃, 200r/min inducing culture 5～6h, to OD ₆₀₀be 0.5～0.6.

MM(Minimal Medium) liquid nutrient medium: 10mM glucose, 0.5%(v/v) glycerine, 200 μ M Syringylethanones, 2.5mM NaCl, 2mM MgSO ₄, 0.45mM CaCl ₂, 9mM FeSO ₄, 4m M (NH ₄) ₂sO ₄, the phosphoric acid buffer that solvent is pH5.3.MM solid medium adds the agar of 15g/L on MM liquid nutrient medium basis again.

2) Agrobacterium and viride are cultivated altogether

At IM culture medium flat plate (MM solid medium+200 μ mol/mL Syringylethanone) upper berth one deck aseptic filter paper.The mould spore suspension of wood that 100mL Agrobacterium has been diluted with 100mL mixes, and coats on this foster base, cultivates altogether 48h for 24 ℃;

3) screening of wooden mould transformant obtains

1. filter paper is cut into strip, is laid in PDA(containing cynnematin 200 μ g/mL and hygromycin B 100 μ g/mL) in flat board, 23 ℃ of cultivations, the appearance of observation transformant.

2. picking transformant, the dull and stereotyped switching continuously of the PDA containing hygromycin B (200 μ g/mL) three generations, carries out monospore separation and Culture and preserves bacterial strain after the transformant of acquisition genetic stability, further carries out Molecular Identification.

3. transformant is carried out the Molecular Identification of CBF gene.Transformant and wild-type wood is mould to be carried out getting after liquid culture 2～3d mycelia and extracts genomic dna and (utilize fungal genomic DNA to extract test kit Biospin Fungus Genomic DNA extraction Kit, Hangzhou Bo scientific & technical corporation), take genomic dna as template, with CBF1 gene specific primer, carry out PCR evaluation, pcr amplification through agarose gel electrophoresis, result shows that wild type strain does not amplify target fragment, and transformant has all occurred illustrating that CBF1 gene has been inserted in viride genomic dna by the CBF1 gene fragment band of expection.Fig. 3 has shown the PCR qualification result of Partial Conversion.

Three, the mould phenotype of wood that turns CBF1 gene is identified

1) the low temperature resistant research of transformant

First on PDA flat board, activate wooden mould wild-type and transformant bacterial strain, cultivate 2～3 days for 23 ℃, make wild-type and the mould growing way homogeneous of transformant wood, re-use the punch tool punching uniform bacterium piece of preparation and transfer to the dull and stereotyped central authorities of other PDA.The flat board that is connected to bacterium piece is placed in to 4 ℃ of incubators and places about 10d, then take out (now wooden mould not growth), after being placed into and continuing to cultivate 3d in 23 ℃ of incubators, measure colony growth diameter.The subzero treatment growing state of Partial Conversion and wild type strain is shown in Fig. 4.

Found that the large 0.4cm of transformant growth diameter average specific wild-type, but the significance of difference is not high, show to turn can slightly improve after CBF1 gene wood mould anti-low temperature ability, but not remarkable.

2) the high temperature resistant research of transformant

According to the method described above, the bacterium piece of the mould transformant of wood and wild-type punching is seeded in to the dull and stereotyped central authorities of PDA, is placed in 37 ℃ of incubators and processes 24h, then flat board is transferred to 23 ℃ of incubators and continue to cultivate after 4d, measure the growth diameter of bacterium colony.After the pyroprocessing of wild-type and Partial Conversion, growth and product spore situation are shown in Fig. 5.

Found that, after process pyroprocessing, transformant starts very fast than the growth of wild-type, and sporulation quantity is large.At 23 ℃, cultivate after 4d, the growth diameter of transformant is compared and is wanted high compared with wild-type, and a minimum strain, also than the large 2cm of wild-type, reaches 42%, and overall transformant colony diameter mean value is than the large 2.7cm of wild-type, nearly 60%.Wherein the fastest strain transformant CBF1-12 of growth is than the large 3cm of wild-type, and 65%.The high-temperature resistance that these results suggest that wooden mould CBF1 transformant has been compared obvious enhancing with wild-type.

Claims (3)

1. The application of 1.CBF1 gene in the high temperature tolerance that improves viride (Trichoderma viride).
2. 2. application as claimed in claim 1, is characterized in that described CBF1 gene order is as shown in SEQ ID No.1.
3. 3. a construction process that turns CBF1 gene viride engineering bacteria, described method comprises:

   (1) by sequence, the CBF1 gene as shown in SEQ ID No.1 mixes with carrier pENTR, transforms bacillus coli DH 5 alpha competent cell, and transformant, after order-checking confirms that sequence is correct, obtains pENTR-CBF1;

   (2) pENTR-CBF1 and carrier ImpGWB502 are passed through to LR recombining reaction by CBF1 transgenosis, after order-checking is confirmed, obtain expression vector ImpGWB502-CBF1;

   (3) expression vector ImpGWB502-CBF1 is proceeded to Agrobacterium, through PCR, identify, obtain the Agrobacterium with object plasmid ImpGWB502-CBF1;

   (4) Agrobacterium with object plasmid ImpGWB502-CBF1 is inoculated in to the LB solid medium containing 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, cultivate after 2～3 days for 28 ℃, picking list bacterium colony is connected to containing in the LB liquid nutrient medium of 100 μ g/mL spectinomycin+50 μ g/mL Rifampins, and 28 ℃, 200r/min are cultured to thalline OD ₆₀₀be 1.0 o'clock, with MM liquid nutrient medium, bacterium liquid diluted to OD ₆₀₀to 0.15, then add the Syringylethanone of 200 μ mol/mL, in 28 ℃, 200r/min inducing culture 5～6h, to OD ₆₀₀be 0.5～0.6, obtain Agrobacterium bacterium liquid;

   (5) step (4) gained Agrobacterium bacterium liquid and isopyknic concentration are 1 * 10 ⁶～1 * 10 ⁷after the viride spore suspension of individual/mL mixes, coat containing on the MM solid medium of 200 μ mol/mL Syringylethanones, cultivate altogether 48h for 24 ℃, screening positive clone also identifies through PCR, turns CBF1 gene viride engineering bacteria described in acquisition;

   Described MM liquid nutrient medium is composed as follows: 10mM glucose, 0.5% glycerine, 200 μ M Syringylethanones, 2.5mM NaCl, 2mM MgSO ₄, 0.45mM CaCl ₂, 9mM FeSO ₄, 4mM (NH ₄) ₂sO ₄, the phosphoric acid buffer that solvent is pH5.3; Described MM solid medium is composed as follows: 15g/L agar, 10mM glucose, 0.5% glycerine, 200 μ M Syringylethanones, 2.5mM NaCl, 2mM MgSO ₄, 0.45mM CaCl ₂, 9mM FeSO ₄, 4mM (NH ₄) ₂sO ₄, the phosphoric acid buffer that solvent is pH5.3.

Images