CN103525849B - A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application - Google Patents
A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application Download PDFInfo
- Publication number
- CN103525849B CN103525849B CN201310507408.3A CN201310507408A CN103525849B CN 103525849 B CN103525849 B CN 103525849B CN 201310507408 A CN201310507408 A CN 201310507408A CN 103525849 B CN103525849 B CN 103525849B
- Authority
- CN
- China
- Prior art keywords
- plasmid
- mercury
- gene
- enzyme
- bacterial strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application, described recombinant plasmid be the ribosome bind site conserved sequence inserted on the basis of plasmid pET28a in 5 ' UTR sequence of tobacco chloroplast rrn16 gene strong promoter, intestinal bacteria T7 phage gene 10,3 ' end non-coding region of tobacco chloroplast rps16 gene, enteroaerogen gather phosphokinase gene ppk and pseudomonas K-62 bacterial strain remove merA, merG after mer operon build and form.Organic mercury in waste water and inorganic mercury are transported in bacterial cell by merT-merP by the present invention, by merB1 and merB2, organic mercury is degraded to bivalent mercury, by ppk, bivalent mercury is sequestered in cell, reduce mercury to the toxicity of bacterial cell, mercury in waste water is accumulated in bacterial cell, by collecting the mercury pollution in recombinant bacterial strain thalline removing waste water.
Description
Technical field
The present invention relates to a kind of recombinant plasmid for removing trade effluent mercury pollution, the application of the construction process simultaneously also relating to this recombinant plasmid, the recombinant bacterial strain comprising this recombinant plasmid and this recombinant bacterial strain, belongs to gene engineering technology field.
Background technology
Soil is one of mankind's Main Natural Resources of depending on for existence, is also the important component part of human ecological environment.Along with the increase of industry, the aggravation of municipal pollution and agrochemicals kind, quantity, heavy metal pollution of soil is day by day serious.Mercury is wherein a kind of main heavy metal contaminants.Agricultural soil heavy metal contamination mainly comes from sewage irrigation.According to the national irrigating region investigation that the Ministry of Agriculture of China carries out, in the Irrigation District of Sewage of about 1,400,000 hectares, suffer the land area of heavy metal contamination to account for 64.8% of Irrigation District of Sewage area, wherein slight pollution account for 46.7%, intermediate pollution account for 9.7%, severe contamination account for 8.4%.Therefore, before waste water discharges factory, carry out mercury process, extremely important for guarantee human body health.
Mercury in waste water mainly contains three kinds of forms: mercury metal, inorganic mercury and organic mercury, and wherein organomercurial toxicity is maximum.Use biological method to carry out process to mercury-contaminated waste water and can be reduced to minimum degree by the impact of surrounding environment.Have in the biology of tolerance known at present to mercury, pseudomonas (Pseudomonas) K-62 bacterial strain is the strongest to the tolerance of mercury, and it is higher than intestinal bacteria about 1000 times to the tolerance of mercury.This bacterium has two plasmid: pmr26 and pmr28 mainly resulted from this mycetocyte to the tolerance that mercury is extremely strong.Pmr26 contains two anti-mercury operon mer, and about 1kb of being separated by between these two operons, one of them operon makes this bacterium all have resistance to inorganic mercury and organic mercury, and another operon is then very responsive to organic mercury.These two operons are inserted into plasmid pBluescriptII respectively, and called after pmra17 and pmrb01.Find after order-checking that operon pmra17 contains 6 open reading frame, wherein 5 are accredited as merR, merT, merP, merA, merB1 respectively.Operon pmrb01 contains three open reading frame, is accredited as merR, merB2, merD respectively.MerR is a regulatory gene, carries out positive regulation or negative regulation to transcribing of structure gene; MerD is relevant to the function of transcribing common regulation and control; MerT, merP, merA, merB be encoding bivalent mercury ion translocator, dimercurion periplasm associated proteins, mercury ion reductase enzyme and organic mercury lyase respectively.As a rule, merB is close to the downstream being positioned at merA.PseudomonasK-62 mainly comes from the lyase of merB1 and merB2 coding to organomercurial resistance.MerB1 is responsible for methyl mercury to be converted into bivalent mercury, and merB2 is responsible for phenyl mercury to be converted into bivalent mercury, and merA is responsible for bivalent mercury to be reduced to nonvalent mercury.Translocator merT and merP is responsible for organic mercury and inorganic mercury to be transported in cell, and is cleared out from periplasm by nonvalent mercury.MerG is between merA and merB1, and the aminoacid sequence of its prediction contains a homing sequence, and this homing sequence comprises a hydrophilic region and a signal peptide shearing site; The homing sequence homology of this signal sequence and known outer born of the same parents' periplasm protein.MerG is positioned on outer born of the same parents' pericentral siphon; After being deleted by merG, bacterium does not change to mercuric resistance, but has died down to the resistance of phenyl mercury; The activity of deleting the enzyme that merG encodes for merA and merB does not also affect.Show that merG only take part in the resistance to phenyl mercury, its mechanism may be reduction of the permeability of cell to phenyl mercury.
In sum, PseudomonasK-62 is it to the mechanism that mercury has an extremely strong resistance can be bivalent mercury by intracellular organomercurial transformation, then bivalent mercury is converted into nonvalent mercury, as follows:
The toxicity ratio organic mercury of nonvalent mercury and bivalent mercury much smaller, and can to vapor away.But this is not the basic way of dealing with problems, because the nonvalent mercury evaporate in air can reenter mercury circulation, continue to work the mischief to human body.Therefore, best bet the mercury in surrounding environment is carried out gathering to fix, and do not allow them reenter mercury circulation.
Summary of the invention
The object of this invention is to provide a kind of recombinant plasmid for removing trade effluent mercury pollution.
The present invention also aims to the construction process that a kind of recombinant plasmid for removing trade effluent mercury pollution is provided.
The present invention also aims to provide a kind of recombinant bacterial strain for removing trade effluent mercury pollution.
The present invention also aims to provide a kind of recombinant bacterial strain removing the application in trade effluent mercury pollution.
In order to realize above object, the technical solution adopted in the present invention is to provide a kind of recombinant plasmid for removing trade effluent mercury pollution, described recombinant plasmid is on the basis of plasmid pET28a, insert tobacco chloroplast rrn16 gene strong promoter, 5 ' UTR(OlinsandRangwala.Anovelsequenceelementderivedfrombac teriophageT7mRNAactsasanenhanceroftranslationofthelacZge neinEscherichiacoli.TheJournalofBiologicalChemistry of intestinal bacteria T7 phage gene 10, 1989, 264 (29): 16973-16976) the ribosome bind site conserved sequence in sequence, 3 ' end non-coding region of tobacco chloroplast rps16 gene, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacteraerogenes) and pseudomonas (Pseudomonas) K-62 bacterial strain remove merA, mer operon after merG builds and forms.
Described recombinant plasmid includes the nucleotide sequence shown in SEQIDNO.1.
The technical solution adopted in the present invention is also the construction process providing a kind of recombinant plasmid for removing trade effluent mercury pollution, comprises the following steps:
(1) according to pseudomonas K-62 bacterial strain plasmid pmr26 and pmr28, synthesis artificial operons merT-merP-merB1-merB2, it is connected with plasmid pET28a, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p1;
(2) with enteroaerogen DNA for template, design primer, amplification ppk gene; Be connected after being cut with plasmid p1 enzyme by ppk gene, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p2;
(3) design primer, amplification contains the ribosome bind site conserved sequence in 5 ' UTR sequence of tobacco chloroplast rrn16 gene strong promoter and intestinal bacteria T7 phage gene 10;
(4) be connected after cutting with plasmid pET28a enzyme with the ribosome bind site conserved sequence in 5 ' UTR sequence of intestinal bacteria T7 phage gene 10 containing tobacco chloroplast rrn16 gene strong promoter, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p3;
(5) with plasmid p2 for template, design primer, amplification artificial operons merT-merP-merB1-merB2-ppk; Be connected after being cut with plasmid p3 enzyme by merT-merP-merB1-merB2-ppk, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p4;
(6) with tobacco chloroplast DNA for template, design primer, amplification rps163 ' hold non-coding region gene sequence; Be connected after being held by rps163 ' non-coding region gene to cut with plasmid p4 enzyme, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line is recombinant plasmid for removing trade effluent mercury pollution.
The technical solution adopted in the present invention is also to provide a kind of recombinant bacterial strain for removing trade effluent mercury pollution, described recombinant plasmid is on the basis of plasmid pET28a, insert tobacco chloroplast rrn16 gene strong promoter, ribosome bind site conserved sequence in 5 ' UTR sequence of intestinal bacteria T7 phage gene 10, 3 ' end non-coding region of tobacco chloroplast rps16 gene, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacteraerogenes) and pseudomonas (Pseudomonas) K-62 bacterial strain remove merA, mer operon after merG builds and forms.
The host of described recombinant bacterial strain is intestinal bacteria.
The technical solution adopted in the present invention is also to provide a kind of recombinant bacterial strain removing the application in trade effluent mercury pollution.
The present invention with tobacco chloroplast rrn16 gene promoter for High-expression promoter, 5 ' the UTR(g10 gene with intestinal bacteria T7 phage gene 10) ribosome bind site conserved sequence is for translational enhancer, tobacco chloroplast rsp16 gene 3 ' end non-coding region is strong terminator, build the recombinant expression system containing merT-merP-merB1-merB2-ppk, and by this System integration on the karyomit(e) of e. coli bl21, the bacterial strain of screening successful conversion, by rrn16 gene promoter, the effect of g10 gene ribosome binding site conserved sequence and rsp16 gene 3 ' end non-coding region improves the mer operon of transformation and the level of ppk protein expression, by merT-merP, the organic mercury in waste water and inorganic mercury are transported in bacterial cell, by merB1, methyl mercury is degraded to bivalent mercury, by merB2, phenyl mercury is degraded to bivalent mercury, by ppk, bivalent mercury is sequestered in cell, reduce mercury to the toxicity of bacterial cell, mercury in waste water is accumulated in bacterial cell, by collecting the mercury pollution in recombinant bacterial strain thalline removing waste water.
Advantage of the present invention is as follows:
1, add tobacco chloroplast rrn16 gene strong promoter in expressing gene upstream, the startup ability of this promotor to prokaryotic gene is more than 6 times that T7 promotor starts ability;
2, add g10 ribosome bind site at expressing gene upstream from start codon, after adding this site, the resistance to mercury ability of recombinant bacterial strain can improve about 5 times;
3, in expression plasmid, merB1 and merB2 is added, recombinant bacterial strain is 9 times of (Hidemitsuetal.PolyphosphateproducedinrecombinantEscheric hiacoliconfersmercury.FEMSMicrobiologyLetters of existing bibliographical information to the tolerance of phenyl mercury respectively, 2002,207 (2): 159-164), recombinant bacterial strain also improves 7 times than the numerical value of existing bibliographical information to the tolerance of inorganic mercury, recombinant bacterial strain increases substantially the mercury tolerance of various form, for its commercial applications is laid a good foundation;
4, recombined engineering mycetocyte mercury accumulation volume increases substantially, recombined engineering mycetocyte mercury accumulation volume is existing bibliographical information (Hidemitsuetal.PolyphosphateproducedinrecombinantEscheric hiacoliconfersmercury.FEMSMicrobiologyLetters, 2002,207 (2): 159-164) more than 5 times;
5, recombinant bacterial strain is when process waste water, cell mass, cell precipitation can be produced along with process progress, color gradually becomes dun, and these visual operators be changed in practical application bring great convenience, can judge that waste water goes the progress of mercury intuitively by observing.
Accompanying drawing explanation
Fig. 1 be the present invention for removing the recombinant plasmid agarose gel electrophoresis figure of trade effluent mercury pollution, wherein;
L is DNAmarker, p5 is the recombinant plasmid that the present invention builds;
Fig. 2 is the expression analysis of ppk-rpsT gene in different strains; Wherein
1 is transform the e. coli bl21 (BL21-0) having empty plasmid vector pET28a,
2 is transform the e. coli bl21 (BL21-1) having plasmid p1-2,
3 is transform the e. coli bl21 (BL21-2) having plasmid p3-1,
4 is transform the e. coli bl21 (BL21-7) having recombinant plasmid of the present invention;
Fig. 3 is that the resistance to mercury ability of bacterial strain BL21-1 and BL21-2 compares; Wherein,
1-5 be respectively bacterial strain containing 0,5,10,20,40 μm of ol/L mercury chloride nutrient solution in cultivate 120h after OD
600value;
Fig. 4 is that recombinant bacterial strain of the present invention (BL21-7) is analyzed inorganic mercury tolerance; Wherein,
1-5 be respectively bacterial strain containing 0,5,10,20,40 μm of ol/L mercury chloride nutrient solution in cultivate 120h after OD
600value;
Fig. 5 is that recombinant bacterial strain of the present invention (BL21-7) is analyzed methyl mercury tolerance; Wherein,
1-5 be respectively bacterial strain containing 0,50,100,200, cultivate 120h in the nutrient solution of the Monomethyl mercury chloride of 400nmol/L after OD
600value;
Fig. 6 is that recombinant bacterial strain of the present invention (BL21-7) is analyzed phenyl mercury tolerance; Wherein,
1-5 be respectively bacterial strain containing 0,50,100,200, cultivate 120h in the nutrient solution of the phenylmercuric chloride of 400nmol/L after OD
600value;
Fig. 7 is recombinant bacterial strain of the present invention (BL21-7) after the LB nutrient solution of 20 μm of ol/l mercury chloride cultivates 72h, the mercury content of recombinant bacterial strain; Wherein,
1 is the e. coli bl21 (BL21-0) only containing pET28a empty carrier; 2 is recombinant bacterial strain of the present invention (BL21-7);
Fig. 8 forms cell mass and cell precipitation after recombinant bacterial strain grows 30h in the LB nutrient solution of the mercury chloride containing 80 μm of ol/l.
Embodiment
Embodiment 1
According to pseudomonas K-62 bacterial strain plasmid pmr26(GenBank accession number: D83080.2) and pmr28(GenBank accession number: AB013925.1), entrust TAKARA company synthesis artificial operons merT-merP-merB1-merB2, with NdeI and NotI to plasmid pET28a(purchased from Bei Nuo bio tech ltd, Shanghai) carry out enzyme and cut, then reclaim, use In-FusionHDCloningKit(Clontech, article No.: 639633) artificial operons merT-merP-merB1-merB2 is inserted into plasmid pET28a(purchased from Bei Nuo bio tech ltd, Shanghai) region between NdeI and NotI, specific operation process is see In-FusionHDCloningKitUserManual(Clontech, Protocolnumber:PT5162-1), with connecting product, escherichia coli DH5a is transformed, screening has the positive colony incubated overnight of resistance to kantlex, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p1.
Embodiment 2
Utilize common LB culture medium culturing enteroaerogen (Enterobacteraerogenes) (purchased from Bei Nuo bio tech ltd, Shanghai), culture condition is 37 DEG C, 180rpm shaking culture 72h.
According to enteroaerogen (Enterobacteraerogenes) ppk gene order (GenBank accession number: D14445.1), design primer, extract enteroaerogen genomic dna, specifically can refer to a day root bacterial genomes DNA extraction kit specification sheets (article No.: DP302-02).With enteroaerogen genomic dna for template, amplification ppk gene.Primer is as follows:
PPPKF:5 '-ATAAGAAT
gCGGCCGCaTTTACCACGTCCTGTGATT-3 ' (underscore is designated as NotI restriction enzyme site)
PPPKR:5 '-CCGATCCG
cTCGAGgGTTAATCGGGTTGCTCGAG-3 ' (underscore is designated as XhoI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer PPPKF1pmol, primer PPPKR1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C, 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1.5min) 40 circulations, 72 DEG C of 10min.
Carry out after enzyme cuts back to close to the gene fragment amplified and plasmid p1 NotI and XhoI, 4 DEG C of connections are spent the night, with connecting product conversion escherichia coli DH5a, picking positive colony carries out incubated overnight, extract plasmid, carry out enzyme with NotI and XhoI and cut qualification, to checking order by the enzyme plasmid that cuts out about 2kb fragment, will check order right-on plasmid called after p2.
Embodiment 3
According to 5 ' UTR sequence (the OlinsandRangwala.Anovelsequenceelementderivedfrombacteri ophageT7mRNAactsasanenhanceroftranslationofthelacZgenein Escherichiacoli.TheJournalofBiologicalChemistry of tobacco chloroplast genomic dna sequence (GenBank accession number: Z00044.2) and intestinal bacteria T7 phage gene 10,1989,264 (29): 16973-16976), entrust TAKARA company synthetic primer
P1F:5 '-CGA
cATATGgCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAG GGGGCAGGGATGGCTATATTTCTGGGAGCGAACTCCGGGCGAATACGAAGCGCTTG GATACAGTTGTAGGGAGGGATTTATCTTTTAACTTTAAGAAGGAG
tGGCCAaGCGCTATTCGATC
gAATTC(tilted letter is depicted as 5 ' end UTR sequence of intestinal bacteria T7 phage gene 10 to GGAC-3 '; Underscore is labeled as NdeI, BalI and EcoRI restriction enzyme site)
P1R:5 '-GTCC
gAATTCgATCGAATAGCGCT
tGGCCAcTCCTTCTTAAAGTTAAAAGATAAATCCCTCCCTACAACTGTATCCAAGCGCTTCG TATTCGCCCGGAGTTCGCTCCCAGAAATATAGCCATCCCTGCCCCCTCACGTCAAT CCCACGAGCCTCTTATCCATTCTCATTGAACGACGGCGGGGGAGC
cATATG(tilted letter is depicted as 5 ' end UTR sequence of intestinal bacteria T7 phage gene 10 to TCG-3 '; Underscore is labeled as EcoRI, BalI and NdeI restriction enzyme site).
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer P1F1pmol, primer P1R1pmol, H
2o23 μ l.
PCR response procedures: 94 DEG C of 7min, 1-2 DEG C/min are cooled to 25 DEG C.
PCR instrument is annealed, obtains the sequence fragment containing rrn16 gene promoter and g10 gene translation enhanser.Carry out enzyme with NdeI and EcoRI to this fragment to cut back to close.
The intestinal bacteria DH10B(of cultivation containing pET28a is purchased from Bei Nuo bio tech ltd, Shanghai), extract plasmid, carry out enzyme with NdeI and EcoRI and cut, and reclaim.The fragment containing rrn16 gene promoter and g10 translational enhancer after pET28a after cutting enzyme cuts with above-mentioned enzyme is connected, transformation of E. coli DH5a.Select positive colony, 37 DEG C of incubated overnight, extract plasmid, carry out enzyme with NdeI and EcoRI and cut qualification, to carrying out sequence verification by the enzyme plasmid that cuts out about 150bp fragment.The plasmid called after p3 that the result is correct.
Embodiment 4
With plasmid p2 for template, design primer, amplification artificial operons merT-merP-merB1-merB2-ppk, primer is as follows:
P2F:5 '-CGG
tGGCCAgTATGTCTGAACCACAAAAACG-3 ' (underscore is designated as BalI restriction enzyme site)
P2R:5 '-CGC
gAATTCtTATCATTTATCGGCATAGGT-3 ' (underscore is designated as EcoRI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer P2F1pmol, primer P2R1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C, 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 5min) 40 circulation, 72 DEG C of 10min.
PCR reaction product is reclaimed, then under 37 DEG C of conditions, carries out enzyme with BalI and EcoRI and cut, then reclaim.
Cultivate the intestinal bacteria containing plasmid p3, extract plasmid, under 37 DEG C of conditions, enzyme is carried out to plasmid p3 with BalI and EcoRI and cut, then reclaim.P3 and merT-merP-merB1-merB2-ppk after being cut back to close by enzyme carries out 24h with T4DNA ligase enzyme and connects under 4 DEG C of conditions.Then with connecting product, escherichia coli DH5a is transformed.Picking positive colony carries out incubated overnight.Under 37 DEG C of conditions, carry out enzyme with BalI and EcoRI after extracting plasmid and cut qualification.To carrying out order-checking qualification, plasmid called after p4 correct after qualification by the enzyme plasmid that cuts out about 4kb Insert Fragment.
Embodiment 5
Cultivate tobacco NC89 to three leaf wholeheartedly, extract tobacco chloroplast DNA, the document that concrete grammar is delivered with reference to Sun Xiaorong etc. carries out (Sun Xiaorong etc., optimization Southwestern Normal University journal (natural science edition) of triploid loquats chloroplast DNA extracting method, 2012,37(2): 93-96), with tobacco chloroplast DNA for template, design primer, the 3 ' UTR of amplification rsp16, primer is as follows:
P3F:5 '-CCG
gAATTCtCAACCGAAATTCAATTAAG-3 ' (underscore is designated as EcoRI restriction enzyme site)
P3R:5 '-CCG
gAATTCaAGAAAATATCGAAGAAAAAT-3 ' (underscore is designated as EcoRI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer P3F1pmol, primer P3R1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C, 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min) 40 circulation, 72 DEG C of 10min.
Amplified production is carried out purifying recovery, then carries out enzyme with EcoRI and cut, then purifying reclaims.Carry out enzyme to plasmid p4 EcoRI to cut, purifying reclaims.Plasmid p4 after cutting enzyme with calf intestine alkaline phosphatase (TAKARA) carries out dephosphorylation process.Rsp163 ' UTR after cutting enzyme with T4DNA ligase enzyme and the p4 after dephosphorylation process carry out 24h and are connected under 4 DEG C of conditions.With connecting product, e. coli bl21 (purchased from Bei Nuo bio tech ltd, Shanghai) is transformed.Picking positive colony carries out incubated overnight, carries out enzyme cut qualification after extracting plasmid with EcoRI.To checking order by the enzyme plasmid that cuts out about 0.5kb fragment.Sequencing result display direction of insertion is that forward inserts and the right-on plasmid called after of sequence p5(or pET28a-P16S-g10-merT-merP-merB1-merB2-ppk-rspT), be the recombinant plasmid for removing trade effluent mercury pollution, as Fig. 1.E. coli bl21 called after BL21-7 containing this plasmid, is the recombinant bacterial strain for removing trade effluent mercury pollution.
Comparative example 1
1, take p2 as template, design primer, amplification g10-ppk gene.Primer is as follows:
PGKF:5 '-CGA
cATATGtTAACTTTAAGAAGGAGTGGCCAAGCGCTATTCGATCATTTACCACGTCCTGTGAT T-3 ' (underscore is designated as NdeI restriction enzyme site)
PGKR:5 '-CCG
gAATTCgGTTAATCGGGTTGCTCGAGTGATTTGATATAGTCGTAAATCGCCAGTTGCGACCG C-3 ' (underscore is designated as EcoRI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer PGKF1pmol, primer PGKR1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C of 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1.5min) 40 circulations, 72 DEG C of 10min.
Rear NdeI and EcoRI of PCR primer recovery carries out enzyme and cuts, plasmid pET28a also carries out enzyme with NdeI and EcoRI and cuts, after recovery, the two is carried out 24h with T4DNA ligase enzyme under 4 DEG C of conditions to connect, connect product conversion escherichia coli DH5a, select positive colony incubated overnight, extract plasmid to carry out enzyme and cut qualification, to checking order by the enzyme plasmid that cuts out about 2kb fragment, sequence right-on plasmid called after p1-1 after order-checking.
2, cultivate tobacco NC89 to three leaf wholeheartedly, extract tobacco chloroplast DNA, with tobacco chloroplast DNA for template, design primer, the 3 ' UTR of amplification rsp16, primer is as follows:
P3F:5 '-CCG
gAATTCtCAACCGAAATTCAATTAAG-3 ' (underscore is designated as EcoRI restriction enzyme site)
P3R:5 '-CCG
gAATTCaAGAAAATATCGAAGAAAAAT-3 ' (underscore is designated as EcoRI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer P3F1pmol, primer P3R1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C of 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min) 40 circulations, 72 DEG C of 10min.
Amplified production is carried out purifying recovery, then carries out enzyme with EcoRI and cut, then purifying reclaims.Carry out enzyme to plasmid p1-1 EcoRI to cut, purifying reclaims.Plasmid p1-1 after cutting enzyme with calf intestine alkaline phosphatase (TAKARA) carries out dephosphorylation process.Rsp163 ' UTR after cutting enzyme with T4DNA ligase enzyme and the p1-1 after dephosphorylation process carry out 24h and are connected under 4 DEG C of conditions.With connecting product, e. coli bl21 is transformed.Picking positive colony carries out incubated overnight, carries out enzyme cut qualification after extracting plasmid with EcoRI.To checking order by the enzyme plasmid that cuts out about 0.5kb fragment.Sequencing result display direction of insertion is that forward inserts and the right-on plasmid called after of sequence p1-2(or pET28a-T7-g10-ppk-rspT).E. coli bl21 called after BL21-1 containing this plasmid.
Comparative example 2
1, utilize common LB culture medium culturing enteroaerogen (Enterobacteraerogenes) (purchased from Bei Nuo bio tech ltd, Shanghai), culture condition is 37 DEG C, 180rpm shaking culture 72h.
According to enteroaerogen (Enterobacteraerogenes) ppk gene order (GenBank accession number: D14445.1), design primer, extract enteroaerogen genomic dna, specifically can refer to a day root bacterial genomes DNA extraction kit specification sheets (article No.: DP302-02).With enteroaerogen genomic dna for template, amplification ppk gene.Primer is as follows:
PPPK1F:5 '-CCG
gAATTCaTTTACCACGTCCTGTGATT-3 ' (underscore is designated as EcoRI restriction enzyme site)
PPPK1R:5 '-CCG
gAATTCgGTTAATCGGGTTGCTCGAG-3 ' (underscore is designated as EcoRI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer PPPKF1pmol, primer PPPKR1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C of 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1.5min) 40 circulations, 72 DEG C of 10min.
Use EcoRI to carry out enzyme to plasmid p3 to cut, process with calf intestine alkaline phosphatase after recovery, then reclaim; Carry out enzyme to the gene fragment EcoRI amplified to cut back to close, then the two is carried out 4 DEG C and connect 24h, with connecting product conversion escherichia coli DH5a, picking positive colony carries out incubated overnight, extract plasmid, carry out enzyme with EcoRI and cut qualification, to checking order by the enzyme plasmid that cuts out about 2kb fragment, will check order right-on plasmid called after p2-1.
2, cultivate tobacco NC89 to three leaf wholeheartedly, extract tobacco chloroplast DNA, with tobacco chloroplast DNA for template, design primer, the 3 ' UTR of amplification rsp16, primer is as follows:
P3F:5 '-CGC
gAGCTCtCAACCGAAATTCAATTAAG-3 ' (underscore is designated as SacI restriction enzyme site)
P3R:5 '-CGC
gAGCTCaAGAAAATATCGAAGAAAAAT-3 ' (underscore is designated as SacI restriction enzyme site)
PCR reaction system: 2 × PfuMasterMix(Beijing CoWin Bioscience Co., Ltd., article No.: CW0686A) 25 μ l, primer P3F1pmol, primer P3R1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 DEG C of 5min, (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min) 40 circulation, 72 DEG C of 10min.
Amplified production is carried out purifying recovery, then carries out enzyme with SacI and cut, then purifying reclaims.Carry out enzyme to plasmid p2-1 SacI to cut, purifying reclaims.Plasmid p2-1 after cutting enzyme with calf intestine alkaline phosphatase (TAKARA) carries out dephosphorylation process.Rsp163 ' UTR after cutting enzyme with T4DNA ligase enzyme and the p2-1 after dephosphorylation process carry out 24h and are connected under 4 DEG C of conditions.With connecting product, e. coli bl21 is transformed.Picking positive colony carries out incubated overnight, carries out enzyme cut qualification after extracting plasmid with SacI.To checking order by the enzyme plasmid that cuts out about 0.5kb fragment.Sequencing result display direction of insertion is that forward inserts and the right-on plasmid called after of sequence p3-1(or pET28a-P16S-g10-ppk-rspT).E. coli bl21 called after BL21-2 containing this plasmid.
Experimental example 1
Real-time PCR Analysis is carried out to coli strain BL21-1, BL21-2 and BL21-7, and with the cDNA of the intestinal bacteria (called after BL21-0) only containing pET28a empty carrier in contrast.By coli strain used in LB nutrient solution, cultivate 16h for 37 DEG C.
Get 1mL bacterium RNeasyMinikit(Qiagen) extract intestinal bacteria total serum IgE.With the DNAse that final concentration is 100 μ g/ml, RNA sample is processed, remove DNA contained in sample.With AccuScriptcDNAkit(Stratagene) reverse transcription is carried out to RNA.With MJMiniOpticonreal-timePCRsystem(BioRad) real-time quantitative PCR is carried out to cDNA sample.After amplification, melt curve analysis two step amplification programs carry out.With PPK-rpsT gene for experimental subjects.In order to the impact expressed except self PPK that degerms, real-time quantitative PCR the primer is across PPK and rpsT.Upstream primer in PPK region, downstream primer be the sequence of rpsT.Can ensure so only can be detected from foreign transforming gene.Upstream primer and downstream primer are respectively PPRF(5 '-AACTTTATCGAAAACCCGTACCGTC-3 ') and PPRR(5 '-ATTTATTTAATCCATAATGGATTCA-3 ').In order to obtain quantitation curves, primer concentration dilution is from 1 × 10
7copies/ μ l is to 1 × 10
2the gradient concentration of copies/ μ l.
Result shows, and the transcripton of ppk-rpsT is respectively 1373copies/ng, 8245copies/ng and 8326copies/ng, as Fig. 2 in the quantity of coli strain BL21-1, BL21-2 and BL21-7.The transcripton of ppk-rpsT in BL21-7 is more than 6 times of analog value in BL21-1.The sign not having ppk-rpsT to express in contrast BL21-0.This illustrates that the carrier that the present invention builds can provide enough transcriptions.Enough transcriptions are the important factors of bacterial regulatory synthetic protein, and the transgenosis mRNA of high-content protein that is usual and high-content is proportionate.Result also shows simultaneously, and it is the key obtaining effective mercury tolerance that correct promotor and regulatory factor combine.The tolerance of e. coli bl21-2 pairs of mercury containing P16S-g10-ppk-rpst at least improves 5 times (Fig. 3) than the e. coli bl21-1 containing T7-g10-ppk-rpst, the latter regulate and control by the weak promoter T7.Resistance to mercury level is like this existing report (Hidemitsuetal.PolyphosphateproducedinrecombinantEscheric hiacoliconfersmercury.FEMSMicrobiologyLetters, 2002,207 (2): 159-164) conversion has 7 times of the resistance to inorganic mercury ability of the intestinal bacteria of ppk gene.
Experimental example 2
By only transforming the e. coli bl21-0 and the recombinant bacterial strain BL21-7 37 DEG C of shaking culture 16h in LB nutrient solution that there are empty plasmid pET28a, then carry out the detection of mercury tolerance.Experimental technique is specific as follows:
Inorganic mercury: the LB nutrient solution getting 5mL fresh is placed in vitro a series of respectively, adds mercury chloride, makes final concentration be respectively 0,5,10,20,40 μm of ol/l.
Methyl mercury: the LB nutrient solution getting 5mL fresh is placed in vitro a series of respectively, adds Monomethyl mercury chloride, make final concentration be respectively 0,50,100,200,400nmol/l.
Phenyl mercury: the LB nutrient solution getting 5mL fresh is placed in vitro a series of respectively, adds phenylmercuric chloride, make final concentration be respectively 0,50,100,200,400nmol/l.
In above-mentioned nutrient solution, add final concentration is respectively that the IPTG of 0.8mmol/L induces, and adds the bacterium liquid of e. coli bl21-0 and recombinant bacterial strain BL21-7 simultaneously, makes its final concentration be OD
600=0.01.Test tube is 300rpm shaking culture 16-120h under 37 DEG C of conditions.Measure the light absorption value of culture at 600nm place.Often group has 3 parallel samples, averages, and result as shown in Figure 4,5, 6.
Fig. 4 result shows, and e. coli bl21-0 can only tolerate the mercury chloride of 5 μm of ol/l, but even if in the LB nutrient solution of 5 μm of ol/l mercury chloride, the colibacillary speed of growth is still lower than the colibacillary speed of growth in the LB nutrient solution of not chloride containing mercury.And containing in 10 μm of ol/l mercury chloride even LB nutrient solutions of greater concn, e. coli bl21-0 is complete suppressed, observes after cultivating 16-120h, and the E. CoIi content in nutrient solution does not increase.
The mercury chloride of recombinant bacterial strain BL21-7 to 20 μm of ol/l has good tolerance.After IPTG induces 120h, this bacterium to reach capacity state in the LB nutrient solution of the mercury chloride containing 20 μm of ol/l, OD value measured under this state of saturation and the intestinal bacteria grown in not mercurous LB nutrient solution reach capacity state time OD value closely.
Fig. 5 result shows, recombinant bacterial strain BL21-7 can grow very well in the LB nutrient solution of the methyl mercury containing 100nmol/l, in the LB nutrient solution of the methyl mercury of the methyl mercury containing 200nmol/l and 400nmol/l, also have the growth of certain degree, and the e. coli bl21-0 only containing pET28a empty carrier grows in the LB nutrient solution of the methyl mercury containing 100nmol/l and is just totally constrained.
Fig. 6 result shows, recombinant bacterial strain BL21-7 can grow very well in the LB nutrient solution of the phenyl mercury of the phenyl mercury containing 200nmol/l and 400nmol/l, and the e. coli bl21-0 only containing pET28a empty carrier grows and is just totally constrained in the LB nutrient solution of the phenyl mercury containing 50nmol/l.
Therefore known, recombinant bacterial strain BL21-7 has the tolerance of very high level to inorganic mercury and organic mercury, it is bivalent mercury that recombinant bacterial strain BL21-7 can pass through transformed foreign gene by organomercurial transformation, then by poly-phosphorus compound, bivalent mercury chelating is got up, reach the toxicity reducing mercury, strengthen the object to mercury tolerance.
Experimental example 3
E. coli bl21-0 is cultivated respectively in not mercurous LB nutrient solution, LB nutrient solution containing 20 μm of ol/l mercury chloride and LB process nutrient solution.The preparation method of LB process nutrient solution is as follows: in fresh LB nutrient solution, add mercury chloride make its final concentration be 20 μm of ol/l, then add recombinant bacterial strain BL21-7, cultivates 120h.The centrifugal 2min of 13000rpm, collects supernatant liquor again, is that the filter membrane of 0.22 μm carries out filtration sterilization to supernatant liquor with aperture.Its final concentration OD is made with LB process nutrient solution inoculation e. coli bl21-0 bacterium liquid
600=0.1, cultivate 16h.With the contrast of LB process nutrient solution as growth response not adding bacterium liquid.Result shows, and e. coli bl21-0 all to reach capacity value cultivate 16h in not mercurous LB nutrient solution and in LB process nutrient solution after.E. coli bl21-0 can not grow in containing the nutrient solution of 20 μm of ol/l mercury chloride.These results show, recombinant bacterial strain BL21-7 can not only improve the mercury tolerance of bacterium, and the mercury in nutrient solution can be scavenged into the level that can allow the intestinal bacteria normal growth only transforming empty plasmid pET28a.
Experimental example 4
Recombinant bacterial strain BL21-7 is cultivated 72h and 120h respectively in containing the LB nutrient solution of 20 μm of ol/l mercury chloride, then gets 5mL culture and carry out centrifugal, obtain cell precipitation, the fresh LB nutrient solution of cell precipitation is rinsed three times.Then under 95 DEG C of conditions, add 70%(v/v) nitric acid, the hydrogen peroxide (v/v) of 30% and concentrated hydrochloric acid.Reference literature (Hidemitsuetal.PolyphosphateproducedinrecombinantEscheric hiacoliconfersmercury.FEMSMicrobiologyLetters, 2002,207 (2): 159-164), measure the mercury accumulation volume of bacterium, result as shown in Figure 7.Fig. 7 result shows, and after cultivating 72h, namely the mercury content of recombinant bacterial strain has reached 87.5+/-12.1 μm ol/l; After cultivating 120h, recombinant bacterial strain mercury content reaches 115.6+/-11.7 μm ol/l.Show that recombinant bacterial strain BL21-7 effectively can absorb mercury, biological restoration is carried out to the liquid of mercury pollution, remove the mercury wherein polluted.
Experimental example 5
After recombinant bacterial strain BL21-7 cultivates the sufficiently long time in the nutrient solution containing high density mercury, cell mass can be formed.Grow 30h in the LB nutrient solution containing the mercury chloride of 80 μm of ol/l or the mercury chloride of greater concn after, cell mass and cell precipitation can be observed, as Fig. 8.This phenomenon does not observe in the LB nutrient solution of lower concentration Hg chloride content.When Hg chloride content is more than 40 μm of ol/l, recombinant bacterial strain culture presents dun.The appearance of this phenomenon depends on recombinant bacterial strain to the tolerance of mercury and accumulation.Colour-change in recombinant bacterial strain repair process can as a mark, and assessment recombinant bacterial strain biological restoration reaches the concrete progress of repair process.After cultivating for some time, the cell mass precipitated and cell precipitation are filtered out, the precipitated cell mass got off of a large amount of mercury carries away, thus performs the task of removing mercury.
Application experiment example
Sample from the waste water that Changsha chlor-alkali plant is discharged.Water sample leaves standstill 15min in indoor, filters, finally use the membrane filtration of 0.45 μm with Medium speed filter paper, and add mercury chloride, methyl mercury, phenyl mercury, its final concentration is respectively 20 μm of ol/l, 200nmol/l and 400noml/l.Then add IPTG respectively in waste water after the treatment to induce, and add recombinant bacterial strain BL21-7 bacterium liquid, make its final concentration be OD
600=0.01,300rpm shaking culture under 37 DEG C of conditions.
Experimental result finds, recombinant bacterial strain BL21-7 has good tolerance to the waste water (20 μm of ol/l mercury chloride, 200nmol/l Monomethyl mercury chloride and 400noml/l phenylmercuric chlorides) after process.Induce after 180h at IPTG, reach capacity in this bacterium waste water after treatment state, this bacterium grown in OD value measured under this state of saturation and waste water before treatment reach capacity state time OD value close.
Recombinant bacterial strain BL21-7 is cultivated 72h and 180h respectively in the waste water (20 μm of ol/l mercury chloride, 200nmol/l Monomethyl mercury chloride and 400noml/l phenylmercuric chlorides) after process, then getting 5mL culture carries out centrifugal, obtain cell precipitation, the fresh LB nutrient solution of cell precipitation is rinsed three times.Then under 95 DEG C of conditions, add 70%(v/v) nitric acid, the hydrogen peroxide (v/v) of 30% and concentrated hydrochloric acid.Reference literature (Hidemitsuetal.PolyphosphateproducedinrecombinantEscheric hiacoliconfersmercury.FEMSMicrobiologyLetters, 2002,207 (2): 159-164) the mercury accumulation volume of bacterium, is measured.Result shows, and after cultivating 72h, namely the mercury content of recombinant bacterial strain has reached 60.3+/-12.5 μm ol/l; After cultivating 180h, bacterium mercury content can reach 70.2+/-14.3 μm ol/l.After cultivating 180h, bacterium mercury content is higher than the value of 72h owing to there being more recombined engineering bacteria growing, or after growth time prolongation, has more mercury to have the sufficient time to be transported in cell.These results prove that recombinant bacterial strain BL21-7 can growth and breeding in the waste water containing organic mercury and inorganic mercury further, can carry out absorption and accumulation, can remove the mercury pollution in waste water to the organic mercury in waste water and inorganic mercury.
Claims (4)
1., for removing a recombinant plasmid for trade effluent mercury pollution, it is characterized in that: described recombinant plasmid is the ribosome bind site conserved sequence inserted on the basis of plasmid pET28a in 5 ' UTR sequence of tobacco chloroplast rrn16 gene strong promoter, intestinal bacteria T7 phage gene 10,3 ' end non-coding region of tobacco chloroplast rps16 gene, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacteraerogenes) and pseudomonas (Pseudomonas) K-62 bacterial strain remove merA, merG after mer operon build and form; Described mer operon is merT-merP-merB1-merB2; Described recombinant plasmid contains the nucleotide sequence shown in SEQIDNO.1.
2. as claimed in claim 1 for removing a construction process for the recombinant plasmid of trade effluent mercury pollution, it is characterized in that: comprise the following steps:
(1) according to pseudomonas K-62 bacterial strain plasmid pmr26 and pmr28, synthesis artificial operons merT-merP-merB1-merB2, it is connected with plasmid pET28a, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p1;
(2) with enteroaerogen DNA for template, design primer, amplification ppk gene; Be connected after being cut with plasmid p1 enzyme by ppk gene, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p2;
(3) design primer, amplification contains the ribosome bind site conserved sequence in 5 ' UTR sequence of tobacco chloroplast rrn16 gene strong promoter and intestinal bacteria T7 phage gene 10;
(4) be connected after cutting with plasmid pET28a enzyme with the ribosome bind site conserved sequence in 5 ' UTR sequence of intestinal bacteria T7 phage gene 10 containing tobacco chloroplast rrn16 gene strong promoter, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p3;
(5) with plasmid p2 for template, design primer, amplification artificial operons merT-merP-merB1-merB2-ppk; Be connected after being cut with plasmid p3 enzyme by merT-merP-merB1-merB2-ppk, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p4;
(6) with tobacco chloroplast DNA for template, design primer, amplification rps163 ' hold non-coding region gene sequence; Be connected after being held by rps163 ' non-coding region gene to cut with plasmid p4 enzyme, connect product conversion escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line is recombinant plasmid for removing trade effluent mercury pollution.
3. for removing a recombinant bacterial strain for trade effluent mercury pollution, it is characterized in that: obtained by recombinant plasmid transformed e. coli bl21 according to claim 1.
4. a recombinant bacterial strain as claimed in claim 3 is removing the application in trade effluent mercury pollution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310507408.3A CN103525849B (en) | 2013-10-24 | 2013-10-24 | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310507408.3A CN103525849B (en) | 2013-10-24 | 2013-10-24 | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103525849A CN103525849A (en) | 2014-01-22 |
| CN103525849B true CN103525849B (en) | 2016-01-20 |
Family
ID=49928197
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310507408.3A Expired - Fee Related CN103525849B (en) | 2013-10-24 | 2013-10-24 | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103525849B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114107075A (en) * | 2021-11-29 | 2022-03-01 | 浙江大学 | Method for enhancing reduction capability of fungus demethylated mercuric methyl and/or divalent mercury, recombinant fungus and application |
| CN114774452B (en) * | 2022-04-29 | 2023-12-26 | 天津大学 | Construction method and application of engineering escherichia coli for adsorbing mercury ions in solution |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1614024A (en) * | 2003-11-06 | 2005-05-11 | 中国科学院上海生命科学研究院 | Transgened-tobacco for degrading organic mercury pollution |
| CN102753691A (en) * | 2009-08-20 | 2012-10-24 | 泛美波多黎各大学 | Heavy metal remediation system |
-
2013
- 2013-10-24 CN CN201310507408.3A patent/CN103525849B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1614024A (en) * | 2003-11-06 | 2005-05-11 | 中国科学院上海生命科学研究院 | Transgened-tobacco for degrading organic mercury pollution |
| CN102753691A (en) * | 2009-08-20 | 2012-10-24 | 泛美波多黎各大学 | Heavy metal remediation system |
Non-Patent Citations (3)
| Title |
|---|
| Polyphosphate produced in recombinant Escherichia coli confers mercury resistance;Hidemitsu Pan-Hou等;《FEMS Microbiology Letters》;20020123;159页摘要，160页2.1-2.2节，161页3.3-3.4节 * |
| Roles of the Tn2l merT, merP, and merC Gene Products in Mercury Resistance and Mercury Binding;NANCY V. HAMLETT等;《JOURNAL OF BACTERIOLOGY》;19921031;第174卷(第20期);6377-6385 * |
| 细菌的汞抗性基因及其在生物修复中的应用;林宇岚 等;《海峡预防医学杂志》;20061231;第12卷(第1期);16-18页，2.1-2.6节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103525849A (en) | 2014-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101186898B (en) | Paracoccus and application thereof in nitrogenous heterocyclic compound degradation | |
| CN103834589A (en) | Achromobacter xylosoxidans and application thereof | |
| Zhang et al. | Identification of a new microcystin-degrading bacterium isolated from Lake Chaohu, China | |
| CN102002485A (en) | Pyrophosphatase of ammopiptanthus mongolicus, and coding gene and application thereof | |
| CN103103202A (en) | Harpin coding gene (i) hrpZPsgS1(/i) or application of harpinZPsgS1 protein expressed by Harpin coding gene (i) hrpZPsgS1(/i) | |
| CN103525849B (en) | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application | |
| CN102586160A (en) | Stenotrophomonas maltophilia DS4 | |
| CN103160283A (en) | Heavy metal pollution prothetic composition of soil and water body and application | |
| CN106190871A (en) | A kind of method that compound thread fungal organism drip leaching with straw as carbon source processes heavy-metal contaminated soil | |
| CN107022015B (en) | Iris lactea heavy metal ATP enzyme transport protein IlHMA2 and coding gene and application thereof | |
| CN102583780A (en) | Application of Stenotrophomonas maltophilia DS4 for degrading organic pollutants in saponin waste water | |
| CN109880829B (en) | Barley HvPAA1 gene and application thereof | |
| Li et al. | Treatment of high-concentration chromium-containing wastewater by sulfate-reducing bacteria acclimated with ethanol | |
| Zhang et al. | Heavy metal bioremediation using microbially induced carbonate precipitation: Key factors and enhancement strategies | |
| CN109576160B (en) | Chlorella W3 capable of removing heavy metals in water with high heavy metal content and application thereof | |
| CN104593296B (en) | Paper waste dirt fills reed Tanaka's typical bacteria --- screening of spindle lysine bacillus and application thereof | |
| CN107974415A (en) | Application of one plant of arsenic oxidizing bacteria in terms of rice field trivalent arsenic pollution is repaired | |
| Chen et al. | Diversity and community structure of ammonia-oxidizing archaea in rhizosphere soil of four plant groups in Ebinur Lake wetland | |
| CN108165559B (en) | C2H2 type transcription factor gene and application thereof | |
| CN112931304B (en) | Method for improving attachment of coral larvae | |
| CN102604901B (en) | Heavy-metal mercury-resistance related protein DbsMerA and encoding genes and application thereof | |
| CN101955944B (en) | Rice copper transporter gene OsCtr5 and application thereof in copper polluted soil and water restoration | |
| CN1539959A (en) | Method for inserting gene of pseudomonas fluorescens M18 into mutation strain H18G | |
| CN113583897A (en) | Bacillus aryabhattai FL05 and application thereof | |
| CN102603873A (en) | Heavy metal cadmium resistance related protein DbsCzcA as well as coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160120 Termination date: 20171024 |