CN101186898B - Paracoccus and application thereof in nitrogenous heterocyclic compound degradation - Google Patents
Paracoccus and application thereof in nitrogenous heterocyclic compound degradation Download PDFInfo
- Publication number
- CN101186898B CN101186898B CN2007103039751A CN200710303975A CN101186898B CN 101186898 B CN101186898 B CN 101186898B CN 2007103039751 A CN2007103039751 A CN 2007103039751A CN 200710303975 A CN200710303975 A CN 200710303975A CN 101186898 B CN101186898 B CN 101186898B
- Authority
- CN
- China
- Prior art keywords
- paracoccus
- pyridine
- secondary coccus
- cgmcc
- degradation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention discloses paracoccus and the application for degrading azotic heterocyclic compound. The paracoccus is paracoccus sp. BW001 CGMCC No. 2225. The paracoccus sp. BW001 CGMCC No. 2225 of theinvention, on one hand, can grow into pyridine as the only carbon source and nitrogen source, which has a strong degradation activity (the degradation rate is 100%) for pyridine, is extremely suitablefor biologic control of organic wastewater (such as coking wastewater) which contains pollutant of pyridine category, and can be used as biological hardening agent in the biological control technolog y of organic persistent wastewater, and corresponding environmental biological agent is exploited, thereby having relatively high value of study, application and marketing.
Description
Technical field
The present invention relates to a Paracoccus and the application in nitrogenous heterocyclic compound degradation thereof.
Background technology
Opened in the biological treating of the earth " self-cleaning " process and had advantages such as cost is low, secondary pollution is light, Environmental compatibility is good, the research of microbial treatment waste water technology and utilize and more and more be subjected to people's attention.Important role is serving as in functional microorganism colony in this technology, traditional biological process is handled water reuse be nature or through certain acclimated microorganism flora, the degraded of giving free rein to, the degradation rate of pollutent is not high, can not adapt to current increasing trade effluent kind.Therefore, to separation, the screening of extraordinary microorganism, the separation of functional gene, extraction, and make up various environmental engineering bacterium whereby and become research focus in environmental science, the life science.
Biological reinforcing technology (the Bioaugmentation that arises at the historic moment, abbreviation BA technology), gene and strengthening technology (Gene-Enhanced-Technology, be called for short the GET technology) be the function stem/flora that in the pollution system, adds artificial culture, the import feature gene, with degraded, the conversion of target substrates in the enhancing system, and can improve the stability of biological treatment process.Biotechnology be the most ripe in the water pollution control also be the most challenging technology, many in the world Environmental Biotechnology achievements have entered commercialization, industrialized development.Some external scientific research institutions such as the U.S., Japan, Britain now successfully develop commercial environmental organism preparation, the wherein famous EM preparation that Japan is arranged, the AM preparation of the U.S..
Pyridine is colourless or faint yellow inflammable liquid, and foul smelling exists harm to human body and environment.But pyridine is again a widely used compound in the chemical industry, as the chemosynthesis monomer, is a kind of common toxic pollutent therefore, is the feature pollution factor of trade effluents such as coking, dyestuff, chemical industry, agricultural chemicals.Though, biodegradable research about pyridine just has relevant report as far back as the twenties in 20th century, but, because pyridine belongs to difficult degradation heterocyclic arene compound, occurring in nature is difficult to find the microorganism that can effectively degrade to it, so so far various countries will pyridine as in addition primary study and the processing of the priority pollutants in the pollution system and biodegradable organic compounds, wish to find some effective microorganisms that it is controlled, thereby guarantee that pyridine content is unlikely to environment is polluted in the trade effluent of various dischargings.The pollution condition of China is obviously different with other country, and the environment present situation of China is to have entered the new stage of " composite type circular environment pollution on a large scale ".Existing commercialization biotechnological formulation is difficult to play effective regulation effect to " three wastes ", and serious pollution condition needs to be resolved hurrily.
Summary of the invention
The purpose of this invention is to provide a Paracoccus and the application in nitrogenous heterocyclic compound degradation.
Secondary coccus provided by the present invention is secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225.
Described secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is a strain Gram-negative bacteria, and sphere or quarter butt are about 1.0 μ m, the about 0.5 μ m of diameter, Yi Judui, atrichia, no mobility; The aerobic respiration metabolism; Bacterium colony is faint yellow, circular in solid medium, and the edge is smooth; Cephalo, kantlex, Rifampin there are resistance,, can are unique carbon, nitrogenous source growth with pyridine, and have nitrogen fixation penbritin, paraxin, tsiklomitsin, spectinomycin sensitivity.Carry 2 big plasmids and 1 miniplasmids.
Described secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225, be preserved in Chinese microorganism strain preservation board of trustee reason person on October 23rd, 2007 and understand common micro-organisms center (abbreviation CGMCC, the address is: No. 13, one in Zhong Guan-cun, Haidian District, BeiJing, China city north), preserving number is CGMCC № .2225.
Of the present invention from some gathered the long-term environment of contaminating of poisonous/objectionable impurities, separated, screening can be used for the functional microorganism of specific pollutants of degrading, and is further used in the improvement of specific difficult trade effluent.Therefore, carry out the research and development of BW001 about the biodegradability of pyridine, the biological treating that China is contained the pyridines organic wastewater with difficult degradation thereby is contributed to some extent.
Second purpose of the present invention provides cultural method and the application of secondary coccus (Paracoccus sp.) BW001.
Secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 can select substratum at 30～35 ℃ with common bacteria LB substratum or the inorganic salt that contain pyridine, cultivates under the 180rpm condition; It is to contain the 500mg pyridine in every 1000mL water that the described inorganic salt that contain pyridine are selected substratum; Na
2HPO
42H
2O, 1.42g; KH
2PO
4, 1.36g; MgSO
47H
2O, 0.216g; CaCl
22H
2O, 0.006g; H
3BO
3, 0.00116g; ZnSO
47H
2O, 0.00115g; MnSO
4H
2O, 0.00169g; CuSO
45H
2O, 0.00038g; CoCl
26H
2O, 0.00024g; Na
2MoO
42H
2O, 0.0000024g; FeSO
47H
2O, 0.00278g; PH 6.5.
Secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 in the LB substratum 30～35 ℃, 180rpm cultivates 20～24h, and viable count can reach 10
9～10
10Cfu/mL; Select in the substratum 30～35 ℃ at the inorganic salt that contain pyridine, 180rpm cultivates 20～24h, and viable count can reach 10
8～10
9Cfu/mL, the degradation rate of pyridine almost reaches 100%.
Secondary coccus of the present invention (Paracoccus sp.) BW001 CGMCC № .2225 can be used for the degraded of pyridine in the sewage system, concrete grammar can be secondary coccus (Paracoccus sp.) BW001CGMCC № .2225 is inoculated in the sewage that contains pyridine and/or its derivative, at 20～35 ℃, the pH value is to cultivate under 5～9 the condition, and the pH value is preferably 7～9.
For secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 keeps higher degrading activity, before disposing of sewage, the pyridine starting point concentration in the sewage can be adjusted to 91～2613mg/L.
With above-mentioned secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is that the bacteria agent of activeconstituents also belongs to protection scope of the present invention; Can add acceptable auxiliary as required in this microbial inoculum.
Secondary coccus of the present invention (Paracoccus sp.) BW001 CGMCC № .2225 can pyridine be sole carbon source, nitrogenous source growth, pyridine had very strong degrading activity (degradation rate reaches 100%), and it is simple that it has a cultural method, the advantage of fast growth.Biochemical functions from microorganism, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is the biological treating of the organic waste water (as coking chemical waste water) that is suitable for very much containing the pyridines pollutent, can be used as biological reinforced dose in organic used water difficult to degradate biological treating technology, and develop corresponding environment friendly biological preparation whereby, thereby secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 has higher research, application and marketable value.
Description of drawings
Fig. 1 is the electromicroscopic photograph of secondary coccus (Paracoccus sp.) BW001
Fig. 2 is degradation curve and the thalli growth curve of secondary coccus (Paracoccus sp.) BW001 to pyridine
Fig. 3 is the degraded situation (A, pyridine degradable curve, B, thalline long curve) of secondary coccus (Paracoccus sp.) BW001 to the different concns pyridine
Fig. 4 is the degraded situation of secondary coccus under the condition of different temperatures (Paracoccus sp.) BW001 to pyridine
Fig. 5 is the degraded situation of secondary coccus under the different pH condition (Paracoccus sp.) BW001 to pyridine
Fig. 6 is that the plasmid of secondary coccus (Paracoccus sp.) BW001 extracts electrophorogram
Embodiment
Method among the following embodiment if no special instructions, is ordinary method.
Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.
Separation, purifying and the evaluation thereof of embodiment 1, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225
1, separation, purifying and the evaluation of secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225
Secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 gathers active sludge from the wastewater treatment plant aeration tank of wuhan iron ﹠ steel croup co. subordinate coke-oven plant, active sludge tamed after the cultivation therefrom separate, a strain gram negative bacterium that purifying obtains, concrete enrichment, separation, purge process are as follows:
Under the condition of selective pressure pyridine 500mg/L, promptly with pyridine as sole carbon source and nitrogenous source, from the active sludge of raising and train for a long time, obtain secondary coccus (Paracoccus sp.) BW001 through steps such as enrichments, separation, screening, purifying.Concrete sepn process is as described below:
The active sludge sample of being gathered is inoculated into liquid MSM is housed selects shaking in the bottle of substratum (in the MSM inorganic salt solution, adding pyridine) as sole carbon source and nitrogenous source, 30 ℃, three cycles of shaking culture under the 180rpm, about 5d of each cycle, the final concentration of the pyridine that adds is respectively 200mg/L, 500mg/L, 500mg/L, obtains pregnant solution.
Pregnant solution is diluted to 10
-6Doubly be applied to and contain on the solid MSM minimal medium that final concentration is the 500mg/L pyridine, 30 ℃ of constant temperature culture are until growing obvious visible bacterium colony.Picking list bacterium colony adopts the plate streaking method of purification that bacterial classification is carried out purifying and observes colonial morphology and record.Detecting purity, is the purebred bacterial strain of sole carbon source and nitrogenous source growth with the pyridine until having obtained a strain, with its called after BW001.
The MSM minimal medium consists of: every L contains Na
2HPO
42H
2O, 1.42g; KH
2PO
4, 1.36g; MgSO
47H
2O, 0.216g; CaCl
22H
2O, 0.006g; H
3BO
3, 0.00116g; ZnSO
47H
2O, 0.00115g; MnSO
4H
2O, 0.00169g; CuSO
45H
2O, 0.00038g; CoCl
26H
2O, 0.00024g; Na
2MoO
42H
2O, 0.0000024g; FeSO
47H
2O, 0.00278g; Regulate pH to 6.5.
Secondary coccus (Paracoccus sp.) BW001 in the LB substratum 30～35 ℃, 180rpm cultivates 20～24h, and viable count can reach 10
9～10
10Cfu/mL; Select in the substratum 30～35 ℃ at the inorganic salt that contain pyridine, 180rpm cultivates 20～24h, and viable count can reach 10
8～10
9Cfu/mL, the degradation rate of pyridine almost reaches 100%.
The bacterial strain BW001 that is obtained is carried out morphologic observation and Physiology and biochemistry evaluation, the result shows that this bacterial strain BW001 can add pyridine (500mg/L pyridine) at common bacteria LB substratum and inorganic salt and select to grow on the substratum, bacterium colony is faint yellow, rounded, and the edge is smooth, and bacterial strain is G
-Sphere or tyrothricin are about 1.0 μ m, the about 0.5 μ m of diameter, and Yi Judui, atrichia does not move.Aerobic, respiratory metabolism, and have nitrogen fixation.The stereoscan photograph of this bacterial strain BW001 as shown in Figure 1.
Again the 16S rRNA of this bacterial strain is checked order behind PCR in addition and obtain the 16S rRNA sequence of BW001, concrete grammar is:
Extract the genomic dna of BW001 bacterium with TIANGEN bacterial genomes DNA extraction test kit, as the template of PCR reaction, the design primer carries out the amplification of PCR segment genome.The upstream and downstream primer sequence is respectively:
27F：5’AGAGTTTGATCATGGCTCAG?3’
1492R：5’TACGGTTACCTTGTTACGACTT?3’
The PCR setting program is: 94 ℃ of pre-sex change 2min of elder generation; 94 ℃ of sex change 1min then, 55 ℃ of annealing 1min, 72 ℃ are extended 1min, totally 30 circulations; Last 72 ℃ are extended 15min, 4 ℃ of preservations eventually.The PCR product separates with 0.8% sepharose, purifying and the order-checking of recovery back.The nucleotide sequence that the 16S rRNA of sequencing result BW001 bacterium has sequence 1 in the sequence table.
The 16S rRNA sequence of the BW001 of above-mentioned acquisition has been carried out sequence homology relatively through BLAST software in GenBank, last comprehensive morphological feature, physiological and biochemical property and 16S rRNA sequence signature are secondary coccus (Paracoccus sp.) with this identification of strains.With secondary coccus (Paracoccus sp.) BW001 of this bacterial strain called after.
Described secondary coccus Paracoccus sp.BW001, be preserved in Chinese microorganism strain preservation board of trustee reason person on October 23rd, 2007 and understand common micro-organisms center (abbreviation CGMCC, the address is: No. 13, one in Zhong Guan-cun, Haidian District, BeiJing, China city north), preserving number is CGMCC № .2225.
2, the resistance spectrum of secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 detects
During the resistance of secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 detects, investigated it respectively to cephamycin, kantlex, Rifampin, penbritin, paraxin, tsiklomitsin, seven kinds of antibiotic resistances of spectinomycin, adopt the dilution coating method to be inoculated in the cephamycin that concentration is 100mg/L respectively by pair coccus (Paracoccus sp.) BW001 CGMCC № .2225, the kantlex of 50mg/L, the Rifampin of 100mg/L, the penbritin of 60mg/L, the paraxin of 170mg/L, in the LB solid medium of the tsiklomitsin of 40mg/L or the spectinomycin of 100mg/L, 30 ℃ leave standstill about one week of cultivation, observe thalline forms bacterium colony on media surface situation.The result shows that secondary coccus (Paracoccus sp.) BW001 is except that cephamycin, kantlex, 3 kinds of antibiosis of Rifampin are have the resistance, to all the other antibiotic sensitive.
Embodiment 2, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 are to the biodegradable detection and the degradation condition screening of pyridine
1, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 detects the biological degradation of pyridine
1) preparation of secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 bacteria suspension
Secondary coccus (Paracoccus sp.) the BW001 bacterium of picking 2 ring slant culture is inoculated in the 250mL triangular flask that 50mL LB liquid nutrient medium is housed, in 30 ℃, and 180rpm shaking culture 36h, the centrifugal 10min of 4000rpm collects thalline; And then wash this bacterium liquid with stroke-physiological saline solution, and centrifugal again, so repeatedly twice, centrifugal condition also is 4000rpm, 10min; At last that the gained thalline is resuspended with the MSM aqueous solution, (concentration is 10 to be prepared into bacteria suspension
8～10
9Cfu/mL).
2) biological degradation of pyridine to be detected secondary coccus (Paracoccus sp.) the BW001 bacteria suspension that will prepare in the step 1) be that the amount of 0.03g/L is inoculated in and contains in the MSM minimal medium of pyridine that final concentration is 493.4mg/L according to inoculum size to secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225, the initial pH value that makes substratum is 6.5, get 100mL and place a 250mL triangular flask, at 30 ℃, shaking culture on the 180rpm constant temperature shaking table (experimental group among Fig. 2), so that being housed, 100mL contains the 250mL triangular flask of MSM minimal medium that final concentration is the pyridine of 493.4mg/L, at 30 ℃, shaking culture is as blank (control group among Fig. 2) on the 180rpm constant temperature shaking table.In the culturing process, be taken at the reaction solution of experimental group and blank group at interval in 1～2 hour respectively, measure pyridine concentration and bacterium liquid absorbancy.Detection method is as described below:
Bacterium liquid absorbancy: with Tianjin, island UV2401 type ultraviolet-visible spectrophotometer, in the absorbancy of wavelength 602nm place assaying reaction liquid.
High performance liquid chromatography (HPLC) method is adopted in the detection of pyridine.Sample preparation: in the aerobic degradation process, extracted reaction solution every 1～2 hour, (chromatographic instrument is Tianjin, island SHIMADZU with carrying out the HPLC quantitative analysis behind the membrane filtration of 0.45 μ m, LC-VP series, chromatographic column is Diamosil (TM) diamond C18 post, 250mm * 4.6mm, and granularity is 5 μ m; Moving phase is the methanol aqueous solution of 80% (v/v), and flow rate of mobile phase is 1.0mL/min.Measure wavelength 254nm) mensuration pyridine concentration.
Found that secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 has degradation effect preferably to pyridine, at 33h the degradation rate of examination concentration pyridine is almost reached 100%, drawn secondary coccus (Paracoccussp.) BW001 CGMCC № .2225 under this concentration to the Error bar graphic representation of pyridine degradable, the result is as shown in Figure 2.
As seen from Figure 2, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 only is suppressed at the initial stage that adds into reaction system, but inhibition period the very short 8h that is about, enter quick degradation period subsequently.Be accompanied by the degraded of pyridine, the nectar degree also should have tangible increase mutually.Behind 30h, pyridine is almost degraded fully.Degradation curve to the BW001 bacterium after will getting rid of inhibition period fits, and found that at quick degradation period pyridine degradable curve to meet the zeroth order reaction dynamic law substantially.
2, the pyridine starting point concentration detects the biodegradable influence of pyridine secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225
The secondary coccus for preparing in the step 1) with step 1 (Paracoccus sp.) BW001 CGMCC № .2225 bacteria suspension is that the amount of 0.03g/L is inoculated in respectively and contains different final concentration (90.9mg/L according to inoculum size, 393mg/L, 922mg/L, 1919mg/L or 2613mg/L) in the MSM minimal medium of pyridine, the initial pH value that makes substratum is 6.5, get 100mL respectively, place 5 250mL triangular flasks respectively, at 30 ℃, shaking culture (A among Fig. 3 on the 180rpm constant temperature shaking table, pyridine starting point concentration 90.9mg/L among the B, pyridine starting point concentration 393mg/L, pyridine starting point concentration 922mg/L, pyridine starting point concentration 1919mg/L or pyridine starting point concentration 2613mg/L), containing the pyridine final concentration with nonvaccinated 100mL is the MSM minimal medium of the 2613mg/L 250mL triangular flask of packing into, cultivate under the same conditions, as blank (blank of A among Fig. 3).In the culturing process according to the step 2 of step 1) described nectar degree (OD602) detection method detects the nectar degree and the pyridine concentration of different incubation times with the pyridine concentration detection method, and draws nectar degree change curve (B among Fig. 3) and pyridine concentration curve (A among Fig. 3).
The result as shown in Figure 3, the result shows that the right pyridine of secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 has degradation effect preferably, is that degraded is fully in each test group 30h below the 2000mg/L to the pyridine starting point concentration; Being 2613mg/L when the 37.5h to starting point concentration, the pyridine degradable rate reaches 68.5% (A among Fig. 3), and corresponding bacterium amount rises to 0.12g/L (B among Fig. 3) by 0.03g/L, and the pyridine degradable rate almost reached 100% (A among Fig. 3) when degraded proceeded to 50h.
In sum, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 has good effect for the pyridine degradable in the pyridine pollutant effluents, high-purity pyridine waste water there is very strong degradation capability, substantially can in a short period of time pyridine be dropped to can emission standards, shows that secondary coccus (Paracoccus sp.) BW001CGMCC № .2225 has the biodegradable great potential of the pollution of being used for system pyridines heterogeneous ring compound.
3, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is to the biodegradable optimal temperature conditions screening of pyridine
The secondary coccus for preparing in the step 1) with step 1 (Paracoccus sp.) BW001 bacteria suspension is that the amount of 0.03g/L is inoculated in and contains in the MSM minimal medium that the pyridine final concentration is 487.0mg/L according to inoculum size, the initial pH value that makes substratum is 6.5, get 100mL respectively and place 4 250mL triangular flasks, place 20 ℃ (20 ℃ of Fig. 4) respectively, 25 ℃ (among Fig. 4 25 ℃), 30 ℃ (among Fig. 4 30 ℃), or 35 ℃ (among Fig. 4 35 ℃), shaking culture on the 180rpm constant temperature shaking table, so that being housed, 100mL contains the 250mL triangular flask that the pyridine final concentration is the MSM minimal medium of 487.0mg/L, at 30 ℃, shaking culture is as blank (Fig. 4 empty) on the 180rpm constant temperature shaking table.In the culturing process according to the step 2 of step 1) described pyridine concentration detection method detects the pyridine concentration of different incubation times, and draws pyridine concentration curve (Fig. 4).
The result as shown in Figure 4, the result shows, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is under 30 ℃ of temperature and 35 ℃ of conditions, in the 12h that the pyridine degradable of 487.0mg/L is complete, the time spent is the shortest, and thalline has obvious growth.Test-results shows that the suitableeest growth and breeding temperature of secondary coccus under this experiment condition (Paracoccus sp.) BW001CGMCC № .2225 is 30～35 ℃, and bacterial classification can be brought into play degradation property better in this temperature range.
4, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is to the biodegradable optimal ph conditional filtering of pyridine
The secondary coccus for preparing in the step 1) with step 1 (Paracoccus sp.) BW001 CGMCC № .2225 bacteria suspension is that the amount of 0.04g/L is inoculated in and contains in the MSM minimal medium that the pyridine final concentration is 513.3mg/L according to inoculum size, get 100mL respectively and place 7 250mL triangular flasks, regulating the medium pH value respectively is 4,5,6,7,8,9 or 10, at 30 ℃, shaking culture on the 180rpm constant temperature shaking table.In the culturing process according to the step 2 of step 1) described pyridine concentration detection method detects the pyridine concentration of different incubation times, and draws pyridine concentration curve (the pH value is that the pyridine concentration curve under 4,5,6,7,8,9 or 10 conditions is respectively shown in pH=4 among Fig. 5, pH=5, pH=6, pH=7, pH=8, pH=9 or the pH=10).
The result as shown in Figure 5, the result shows that secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 is when degraded proceeds to 9.5h, the pyridine degradable rate of pH value 7,8,9 correspondences is respectively 65.1%, 69.2%, 67.1%.The pH value is 4 or 10 o'clock, and bacterial strain is not seen obvious growth in culturing process, and it is lower that pyridine is removed efficient.Test-results shows that the pH value scope of secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 suitable growth is 7～9, and optimum value is 8.
3 and 4 test-results to sum up, secondary coccus (Paracoccus sp.) BW001 CGMCC № .2225 for the best degradation condition of pyridine is: 30～35 ℃ of temperature, pH value 7～9.
The plasmid of embodiment 3, secondary coccus (Paracoccus sp.) BW001 detects
Adopt improved alkaline denaturation, extract plasmid from the nutrient solution of BW001 bacterium, concrete plasmid leaching process is as follows:
1, material therefor:
(1) substratum: LB substratum
(2) plasmid extracts used solution:
P1: dissolving 6.06g Tris base, 3.72g Na
2EDTA2H
2O adjusts pH to 8.0 with HCl in 800mL distilled water, be settled to 1L with distilled water, adds 100mg RNase A.
P2: in 950mL distilled water, dissolve 8.0gNaOH, the SDS of 50mL20% (w/v) solution, distilled water is settled to 1L.
P3: dissolving 294.5g Potassium ethanoate in 500mL distilled water.Adjust pH to 5.5 with Glacial acetic acid (about 110mL), distilled water is settled to 1L.
TE buffer: every liter of distilled water adds 1.576g TrisCl, adjusts pH to 8.0; Add 0.3722gEDTANa
2
2, plasmid extracts: adopt gentle alkaline lysis, concrete steps are as follows:
The recovery of the preparation of bacterial cell, the cracking of cell and plasmid DNA.Concrete experimental procedure is as follows:
(1) secondary coccus (Paracoccus sp.) the BW001 thalli growth of LB culture medium culturing is to OD
602Be about at 3 o'clock, get 3mL left and right sides bacteria suspension, the centrifugal 5min of 8000rpm removes residual liquid.
(2) add solution P1 300 μ L, thalline is thoroughly suspended.
(3) add 300 μ L solution P2, softly put upside down up and down 5～6 times, room temperature is placed 5min then.
(4) add 300 μ L solution P3, softly put upside down up and down 5～6 times, ice bath 10min is the centrifugal 10min of 13000rpm then.
(5) move supernatant to another clean EP pipe, add equal-volume phenol and chloroform-primary isoamyl alcohol mixed solution (volume ratio of chloroform and primary isoamyl alcohol is 24: 1) (about each 0.4mL) extracting, softly put upside down and shake up, then the centrifugal 5min of 13000rpm.
(6) move supernatant to another clean EP pipe, add 0.7 volume Virahol (about 600 μ L), put upside down mixing gently, precipitate nucleic acids from supernatant, the centrifugal 10～20min of 13000rpm.
(7) pour out supernatant, the EP pipe is inverted the residual liquid that drains off, add 1mL 70% (volumn concentration) ethanol then, sedimentary nucleic acid is dissolved fully, reclaim plasmid DNA, the centrifugal 10min of 13000rpm.
(8) pour out supernatant, dry unnecessary liquid, the plasmid DNA precipitation is with 20 μ L TE buffer dissolving, in-20 ℃ of preservations.
(9) electrophoresis detection
Experimental result: the detected through gel electrophoresis of extraction plasmid as shown in Figure 6.Secondary coccus (Paracoccus sp.) BW001 has three plasmids, is respectively two big plasmids, a miniplasmids.The big plasmid of cause has exceeded linear calibration's scope of 2-Log Ladder, so its size can not accurately pick out in the drawings.The size of miniplasmids is about 4.5～5kb, and is less because of it, is suitable for having the advantage and the potentiality that become clone/expression vector as the genetic manipulation plasmid vector on geometric scale.Swimming lane 1 is a 2-Log Ladder molecular weight standard among Fig. 6, and swimming lane 2 is the electrophorogram that secondary coccus (Paracoccus sp.) BW001 plasmid extracts.
Sequence table
<160>1
<210>1
<211>1425
<212>DNA
＜213〉secondary coccus (Paracoccus sp.)
<400>1
agagtttgat?catggctcag?aacgaacgct?ggcggcaggc?ctaacacatg?caagtcgagc 60
gcaccttcgg?gtgagcggcg?gacgggtgag?taacgcgtgg?gaatatgccc?tttggtacgg 120
aatagtcctg?ggaaactggg?ggtaataccg?tatgcgccct?tcgggggaaa?gatttatcgc 180
caaaggatta?gcccgcgttg?gattaggtag?ttggtggggt?aatggcctac?caagccgacg 240
atccatagct?ggtttgagag?gatgatcagc?cacactggga?ctgagacacg?gcccagactc 300
ctacgggagg?cagcagtggg?gaatcttaga?caatgggggc?aaccctgatc?tagccatgcc 360
gcgtgagtga?tgaaggccct?agggttgtaa?agctctttca?gctgggaaga?taatgacggt 420
accagcagaa?gaagccccgg?ctaactccgt?gccagcagcc?gcggtaatac?ggagggggct 480
agcgttgttc?ggaattactg?ggcgtaaagc?gcacgtaggc?ggaccggaaa?gttgggggtg 540
aaatcccggg?gctcaacccc?ggaactgcct?tcaaaactat?cggtctggag?ttcgagagag 600
gtgagtggaa?ttccgagtgt?agaggtgaaa?ttcgtagata?ttcggaggaa?caccagtggc 660
gaaggcggct?cactggctcg?atactgacgc?tgaggtgcga?aagcgtgggg?agcaaacagg 720
attagatacc?ctggtagtcc?acgccgtaaa?cgatgaatgc?cagtcgtcgg?gcagcatgct 780
gttcggtgac?acacctaacg?gattaagcat?tccgcctggg?gagtacggtc?gcaagattaa 840
aactcaaagg?aattgacggg?ggcccgcaca?agcggtggag?catgtggttt?aattcgaagc 900
aacgcgcaga?accttaccaa?cccttgacat?cccaggaccg?gcccggagac?gggtctttca 960
cttcggtgac?ctggagacag?gtgctgcatg?gctgtcgtca?gctcgtgtcg?tgagatgttc 1020
ggttaagtcc?ggcaacgagc?gcaacccaca?cttccagttg?ccatcatttg?gttgggcact 1080
ctggaagaac?tgccgatgat?aagtcggagg?aaggtgtgga?tgacgtcaag?tcctcatggc 1140
ccttacgggt?tgggctacac?acgtgctaca?atggtggtga?cagtgggtta?atccccaaaa 1200
gccatctcag?ttcggattgg?ggtctgcaac?tcgaccccat?gaagttggaa?tcgctagtaa 1260
tcgcggaaca?gcatgccgcg?gtgaatacgt?tcccgggcct?tgtacacacc?gcccgtcaca 1320
ccatgggagt?tgggtctacc?cgacggccgt?gcgctaacca?gcaatggggg?cagcggacca 1380
cggtaggctc?agcgactggg?gtgaagtcgt?aacaaggtaa?ccgta 1425
Claims (6)
1. secondary coccus (Paracoccus sp.) BW001CGMCC № .2225.
2. the application of secondary coccus (Paracoccus sp.) BW001CGMCC № .2225 in nitrogenous heterocyclic compound degradation; Described nitrogen-containing heterocycle compound is a pyridine.
3. application according to claim 2, it is characterized in that: described nitrogenous heterocyclic compound degradation is the pyridine in the degradation of sewage, concrete grammar is for to be suspended in secondary coccus (Paracoccus sp.) BW001CGMCC № .2225 in the sewage that contains pyridine, at 20-35 ℃, the pH value is cultivated under the condition of 5-9.
4. application according to claim 3 is characterized in that: the temperature that described secondary coccus (Paracoccus sp.) BW001CGMCC № .2225 is suspended in the sewage cultivation that contains pyridine is 30-35 ℃, and the pH value is 7-9.
5. application according to claim 4 is characterized in that: the pyridine starting point concentration of described sewage is 91-2613mg/L.
6. be the bacteria agent of activeconstituents with secondary coccus (Paracoccus sp.) BW001CGMCC № .2225.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007103039751A CN101186898B (en) | 2007-12-24 | 2007-12-24 | Paracoccus and application thereof in nitrogenous heterocyclic compound degradation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007103039751A CN101186898B (en) | 2007-12-24 | 2007-12-24 | Paracoccus and application thereof in nitrogenous heterocyclic compound degradation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101186898A CN101186898A (en) | 2008-05-28 |
| CN101186898B true CN101186898B (en) | 2010-04-07 |
Family
ID=39479511
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007103039751A Expired - Fee Related CN101186898B (en) | 2007-12-24 | 2007-12-24 | Paracoccus and application thereof in nitrogenous heterocyclic compound degradation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101186898B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102465104B (en) * | 2010-11-04 | 2013-03-20 | 中国石油化工股份有限公司 | Aerobic denitrifying Paracoccus denitrificans and application thereof |
| CN102268396B (en) * | 2011-07-25 | 2013-04-10 | 南京农业大学 | Amidase gene dimtH for degrading dimethoate, chlorpropham and propanil amide, and encoded protein and application thereof |
| CN105316267B (en) * | 2015-12-08 | 2018-09-25 | 河北大学 | A kind of total eclipse pair meningitidis strains and its application |
| CN106282069B (en) * | 2016-09-30 | 2019-02-05 | 福建省微生物研究所 | A kind of pair coccus and the application in sewage purification |
| CN106834165B (en) * | 2016-12-27 | 2020-03-03 | 河北科技大学 | Paracoccus capable of degrading penicillin, cell fraction and composition thereof |
| CN106754574B (en) * | 2017-03-06 | 2020-06-19 | 曲阜师范大学 | Paracoccus and application thereof in degrading resorcinol |
| CN110184205B (en) * | 2018-02-23 | 2022-09-27 | 河北科技大学 | Fermentation method of penicillin degradation strain |
| CN114410545B (en) * | 2022-02-23 | 2023-07-28 | 中国科学院微生物研究所 | Paracoccus GN-9 and application thereof |
| CN114621899B (en) * | 2022-04-19 | 2023-08-22 | 浙江工业大学 | Kang Dela Paracoccus and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1869199A (en) * | 2006-05-23 | 2006-11-29 | 北京未名凯拓农业生物技术有限公司 | A strain denitrogen paracoccus and its culturing method and application |
-
2007
- 2007-12-24 CN CN2007103039751A patent/CN101186898B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1869199A (en) * | 2006-05-23 | 2006-11-29 | 北京未名凯拓农业生物技术有限公司 | A strain denitrogen paracoccus and its culturing method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101186898A (en) | 2008-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101186898B (en) | Paracoccus and application thereof in nitrogenous heterocyclic compound degradation | |
| Lin et al. | Use of ammoniacal nitrogen tolerant microalgae in landfill leachate treatment | |
| CN105255782B (en) | There is fiber bacterium and the purposes of reducing power to Cr VI | |
| CN103243060B (en) | Quinclorac degrading bacteria and application thereof | |
| CN100552019C (en) | One strain denitrogen paracoccus and cultural method thereof and application | |
| CN101255403B (en) | Pyridine degradation bacterium strain and uses thereof | |
| CN111733113B (en) | COD (chemical oxygen demand) degrading strain and application thereof | |
| CN106399176B (en) | One Bacillus species and its application in terms of purifying water body | |
| Mangimbulude et al. | Microbial nitrogen transformation potential in surface run-off leachate from a tropical landfill | |
| Kesserű et al. | Investigation of the denitrification activity of immobilized Pseudomonas butanovora cells in the presence of different organic substrates | |
| JP7062322B2 (en) | Use in the treatment of membrane concentrates of Pseudomonas balealica and its debris leachate | |
| CN104357035A (en) | Biological bactericide for preventing and controlling SRB (sulfate reducing bacteria) in high-temperature water body and SRB inhibition method of bactericide | |
| CN113046262B (en) | Stenotrophomonas-cauiu-1 and uses thereof | |
| Pinpatthanapong et al. | Propionate-cultured sludge bioaugmentation to enhance methane production and micropollutant degradation in landfill leachate treatment | |
| CN116004485B (en) | Pseudomonas, microbial inoculum and method and device for treating dye wastewater by using same | |
| CN109280631B (en) | Sulfadimidine degrading bacterium S-2 and application thereof | |
| CN115386520B (en) | Rhodococcus pyridine-philic RL-GZ01 strain and application thereof | |
| CN110229766A (en) | Aoxidize microbacterium and its application in degradable organic pollutant | |
| CN115353210B (en) | Application of bacillus pumilus LZP02 in treatment of pig raising wastewater | |
| CN102367423B (en) | Carbazole-degrading bacterium and its culture method | |
| CN101195812B (en) | Pseudomonas and application of the same in biological removal of nitrogenous heterocyclic compounds | |
| CN110407338B (en) | Low-temperature denitrification and dephosphorization bacteria and application thereof | |
| CN110184223B (en) | Arthrobacter calsium capable of removing ammonia nitrogen in culture sewage and application thereof | |
| CN102206605A (en) | Exiguobacterium sp. with alga-lysing activity and application thereof in cyanobacterial bloom control | |
| Dong et al. | Degradation of isatin and anthranilic acid by Achromobacter xylosoxidans N4 isolated from denim-manufacturing mill sludge |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Zhejiang Xinhui Synthetic New Materials Co.,Ltd. Assignor: Peking University Contract record no.: 2011330000918 Denomination of invention: Paracoccus and application thereof in nitrogenous heterocyclic compound degradation Granted publication date: 20100407 License type: Exclusive License Open date: 20080528 Record date: 20110708 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100407 Termination date: 20161224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |