CN103525849A - Recombinant plasmid for eliminating industrial wastewater mercury pollution, construction method, recombinant engineering bacterium and application - Google Patents
Recombinant plasmid for eliminating industrial wastewater mercury pollution, construction method, recombinant engineering bacterium and application Download PDFInfo
- Publication number
- CN103525849A CN103525849A CN201310507408.3A CN201310507408A CN103525849A CN 103525849 A CN103525849 A CN 103525849A CN 201310507408 A CN201310507408 A CN 201310507408A CN 103525849 A CN103525849 A CN 103525849A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- mercury
- gene
- enzyme
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a recombinant plasmid for eliminating industrial wastewater mercury pollution, a construction method, a recombinant engineering bacterium and an application. The recombinant plasmid is established by inserting tobacco chloroplast rrn16 gene strong promoter, ribosome binding site conserved sequence of 5'UTR sequence of escherichia coli T7 phage gene 10, 3'-end non-coding area of tobacco chloroplast rps16 gene, enterobacter aerogenes polyphosphate kinase gene ppk and pseudomonas K-62 strain on the basis of plasmid pET28a and by eliminating mer operon of merA and merG. Organic mercury and inorganic mercury in wastewater are transferred into bacterial cells through merT-merP, the organic mercury is degraded into divalent mercury through merB1 and merB2, the divalent mercury is chelated into the cells through ppk, the toxicity of mercury to the bacteria cells is reduced, mercury in the wastewater is accumulated inside the bacterial cells, and mercury pollution in the waster is eliminated through collecting the recombinant engineering bacteria.
Description
Technical field
The present invention relates to a kind ofly for removing the recombinant plasmid of trade effluent mercury pollution, also relate to the application of the construction process of this recombinant plasmid, the recombinant bacterial strain that comprises this recombinant plasmid and this recombinant bacterial strain simultaneously, belong to gene engineering technology field.
Background technology
Soil is one of mankind's Main Natural Resources of depending on for existence, is also the important component part of human ecological environment.Along with the increase of industry, the aggravation of municipal pollution and agrochemicals kind, quantity, heavy metal pollution of soil is day by day serious.Mercury is a kind of main heavy metal contaminants wherein.Agricultural soil heavy metal contamination mainly comes from sewage irrigation.The whole nation dirty irrigated area investigation of carrying out according to China Ministry of Agriculture, in the Irrigation District of Sewage of approximately 1,400,000 hectares, suffer the land area of heavy metal contamination to account for 64.8% of Irrigation District of Sewage area, wherein slight pollution accounts for 46.7%, intermediate pollution account for 9.7%, severe contamination account for 8.4%.Therefore, before discharging factory, go waste water mercury to process, for ensureing that human body health is extremely important.
Mercury in waste water mainly contains three kinds of forms: mercury metal, inorganic mercury and organic mercury, wherein organomercurial toxicity is maximum.Use biological method to process and the impact on surrounding environment can be reduced to minimum degree mercury-contaminated waste water.In at present known mercury being had in the biology of tolerance, pseudomonas (Pseudomonas) K-62 bacterial strain is the strongest to the tolerance of mercury, its to the tolerance of mercury than the high 1000 times of left and right of intestinal bacteria.This bacterium has two plasmid: pmr26 and the pmr28 that the extremely strong tolerance of mercury is mainly resulted from this mycetocyte.Pmr26 contains two anti-mercury operon mer, the 1kb left and right that is separated by between these two operons, and one of them operon makes this bacterium all have resistance to inorganic mercury and organic mercury, and another operon is very responsive to organic mercury.These two operons are inserted into respectively to plasmid pBluescript II, and called after pmra17 and pmrb01.After order-checking, find that operon pmra17 contains 6 open reading frame, wherein 5 are accredited as respectively merR, merT, merP, merA, merB1.Operon pmrb01 contains three open reading frame, is accredited as respectively merR, merB2, merD.MerR is a regulatory gene, and transcribing of structure gene carried out to positive regulation or negative regulation; MerD is relevant to the function of transcribing common regulation and control; MerT, merP, merA, merB encode respectively dimercurion translocator, dimercurion periplasm in conjunction with albumen, mercury ion reductase enzyme and organic mercury lyase.As a rule, merB is close to the downstream that is positioned at merA.PseudomonasK-62 mainly comes from the lyase of merB1 and merB2 coding to organomercurial resistance.MerB1 is responsible for methyl mercury to be converted into divalence mercury, and merB2 is responsible for phenyl mercury to be converted into divalence mercury, and merA is responsible for divalence mercury to be reduced to nonvalent mercury.Translocator merT and merP are responsible for organic mercury and inorganic mercury to be transported in cell, and nonvalent mercury is cleared out from periplasm.MerG is between merA and merB1, and the aminoacid sequence of its prediction contains a homing sequence, and this homing sequence comprises a hydrophilic region and a signal peptide shearing site; The homing sequence homology of this signal sequence and known outer born of the same parents' periplasm protein.MerG is positioned on outer born of the same parents' pericentral siphon; After merG is deleted, bacterium does not change to mercuric resistance, but the resistance of phenyl mercury has been died down; Delete merG for the also not impact of activity of the enzyme of merA and merB coding.Show that merG has only participated in the resistance to phenyl mercury, its mechanism may be to have reduced the permeability of cell to phenyl mercury.
In sum, the mechanism that Pseudomonas K-62 has extremely strong resistance to mercury is that it can be divalence mercury by intracellular organomercurial transformation, then divalence mercury is converted into nonvalent mercury, as follows:
The toxicity of nonvalent mercury is more much smaller than organic mercury and divalence mercury, and can vapor away.But this is not the basic way of dealing with problems, because evaporate into airborne nonvalent mercury, can reenter mercury circulation, continue human body to work the mischief.Therefore, best bet is that the mercury in surrounding environment is assembled and fixed, and does not allow them reenter mercury circulation.
Summary of the invention
The object of this invention is to provide a kind of for removing the recombinant plasmid of trade effluent mercury pollution.
The present invention also aims to provide a kind of for removing the construction process of the recombinant plasmid of trade effluent mercury pollution.
The present invention also aims to provide a kind of for removing the recombinant bacterial strain of trade effluent mercury pollution.
The present invention also aims to provide the application of a kind of recombinant bacterial strain aspect removing trade effluent mercury pollution.
In order to realize above object, the technical solution adopted in the present invention is to provide a kind of for removing the recombinant plasmid of trade effluent mercury pollution, described recombinant plasmid is on the basis of plasmid pET28a, to insert tobacco chloroplast rrn16 gene strong promoter, 5 ' UTR(Olins and Rangwala.A novel sequence element derived from bacteriophage T7mRNA acts as an enhancer of translation of the lacZ gene in Escherichia coli.The Journal of Biological Chemistry of intestinal bacteria T7 phage gene 10, 1989, 264 (29): 16973-16976) the ribosome bind site conserved sequence in sequence, 3 ' end non-coding region of tobacco chloroplast rps16 gene, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacter aerogenes) and pseudomonas (Pseudomonas) K-62 bacterial strain remove merA, mer operon after merG builds and forms.
Described recombinant plasmid includes the nucleotide sequence shown in SEQ ID NO.1.
It is a kind of for removing the construction process of the recombinant plasmid of trade effluent mercury pollution that the technical solution adopted in the present invention is also to provide, and comprises the following steps:
(1) according to pseudomonas K-62 bacterial strain plasmid pmr26 and pmr28, the synthetic sub-merT-merP-merB1-merB2 of manual maneuvering, it is connected with plasmid pET28a, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p1;
(2) take enteroaerogen DNA as template, design primer, amplification ppk gene; After ppk gene is cut with plasmid p1 enzyme, be connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line, called after p2;
(3) design primer, the ribosome bind site conserved sequence in 5 ' the UTR sequence that amplification contains tobacco chloroplast rrn16 gene strong promoter and intestinal bacteria T7 phage gene 10;
(4) after being cut with plasmid pET28a enzyme, the ribosome bind site conserved sequence in 5 ' the UTR sequence that contains tobacco chloroplast rrn16 gene strong promoter and intestinal bacteria T7 phage gene 10 is connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p3;
(5) take plasmid p2 as template, design primer, the sub-merT-merP-merB1-merB2-ppk of amplification manual maneuvering; After merT-merP-merB1-merB2-ppk is cut with plasmid p3 enzyme, be connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line, called after p4;
(6) take tobacco chloroplast DNA as template, design primer, amplification rps163 ' end non-coding region gene sequence; After being cut with plasmid p4 enzyme, rps163 ' end non-coding region gene is connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line is for removing the recombinant plasmid of trade effluent mercury pollution.
It is a kind of for removing the recombinant bacterial strain of trade effluent mercury pollution that the technical solution adopted in the present invention is also to provide, described recombinant plasmid is on the basis of plasmid pET28a, to insert tobacco chloroplast rrn16 gene strong promoter, ribosome bind site conserved sequence in 5 ' UTR sequence of intestinal bacteria T7 phage gene 10, 3 ' end non-coding region of tobacco chloroplast rps16 gene, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacter aerogenes) and pseudomonas (Pseudomonas) K-62 bacterial strain remove merA, mer operon after merG builds and forms.
The host of described recombinant bacterial strain is intestinal bacteria.
The technical solution adopted in the present invention is also to provide the application of a kind of recombinant bacterial strain aspect removing trade effluent mercury pollution.
The present invention be take tobacco chloroplast rrn16 gene promoter as high expression level promotor, take 5 ' UTR(g10 gene of intestinal bacteria T7 phage gene 10) ribosome bind site conserved sequence is translational enhancer, tobacco chloroplast rsp16 gene 3 ' end non-coding region is strong terminator, build the recombinant expression system containing merT-merP-merB1-merB2-ppk, and by this System integration to the karyomit(e) of e. coli bl21, screen the bacterial strain successfully transforming, by rrn16 gene promoter, the effect of g10 gene ribosome bind site conserved sequence and rsp16 gene 3 ' end non-coding region improves the mer operon of transformation and the level of ppk protein expression, by merT-merP, the organic mercury in waste water and inorganic mercury are transported in bacterial cell, by merB1, methyl mercury is degraded to divalence mercury, by merB2, phenyl mercury is degraded to divalence mercury, by ppk, divalence mercury is sequestered in cell, reduce the toxicity of mercury to bacterial cell, mercury in waste water is accumulated in bacterial cell, by collecting recombinant bacterial strain thalline, remove the mercury pollution in waste water.
Advantage of the present invention is as follows:
1, in expressing gene upstream, add tobacco chloroplast rrn16 gene strong promoter, this promotor is that T7 promotor starts the more than 6 times of ability to the startup ability of prokaryotic gene;
2, at expressing gene upstream from start codon, add g10 ribosome bind site, add behind this site, the resistance to mercury ability of recombinant bacterial strain can improve 5 times of left and right;
3, in expression plasmid, add merB1 and merB2, recombinant bacterial strain is respectively 9 times of (Hidemitsu et al.Polyphosphate produced in recombinant Escherichia coli confers mercury.FEMS Microbiology Letters of existing bibliographical information to the tolerance of phenyl mercury, 2002, 207 (2): 159-164), recombinant bacterial strain has also improved 7 times than the numerical value of existing bibliographical information to the tolerance of inorganic mercury, recombinant bacterial strain increases substantially the mercury tolerance of various forms, for its commercial applications is laid a good foundation,
4, recombined engineering mycetocyte mercury accumulation volume increases substantially, recombined engineering mycetocyte mercury accumulation volume is existing bibliographical information (Hidemitsu et al.Polyphosphate produced in recombinant Escherichia coli confers mercury.FEMS Microbiology Letters, 2002,207 (2): 159-164) more than 5 times;
5, recombinant bacterial strain is when processing waste water, can produce cell mass, cell precipitation along with processing progress, color gradually becomes dun, and these visual operators that are changed in practical application bring great convenience, can by observation, judge that waste water goes the progress of mercury intuitively.
Accompanying drawing explanation
Fig. 1 is that the present invention is for removing the recombinant plasmid agarose gel electrophoresis figure of trade effluent mercury pollution, wherein;
L is DNA marker, and p5 is the recombinant plasmid that the present invention builds;
Fig. 2 is the expression analysis of ppk-rpsT gene in different strains; Wherein
1 for transforming the e. coli bl21 (BL21-0) that is free plasmid vector pET28a,
2 for transforming the e. coli bl21 (BL21-1) that has plasmid p1-2,
3 for transforming the e. coli bl21 (BL21-2) that has plasmid p3-1,
4 for transforming the e. coli bl21 (BL21-7) that has recombinant plasmid of the present invention;
Fig. 3 is the resistance to mercury ability comparison of bacterial strain BL21-1 and BL21-2; Wherein,
1-5 is respectively bacterial strain and in the nutrient solution of the mercury chloride that contains 0,5,10,20,40 μ mol/L, cultivates the OD after 120h
600value;
Fig. 4 is that recombinant bacterial strain of the present invention (BL21-7) is analyzed inorganic mercury tolerance; Wherein,
1-5 is respectively bacterial strain and in the nutrient solution of the mercury chloride that contains 0,5,10,20,40 μ mol/L, cultivates the OD after 120h
600value;
Fig. 5 is that recombinant bacterial strain of the present invention (BL21-7) is analyzed methyl mercury tolerance; Wherein,
1-5 is respectively bacterial strain and cultivates the OD after 120h containing 0,50,100,200, in the nutrient solution of the Monomethyl mercury chloride of 400nmol/L
600value;
Fig. 6 is that recombinant bacterial strain of the present invention (BL21-7) is analyzed phenyl mercury tolerance; Wherein,
1-5 is respectively bacterial strain and cultivates the OD after 120h containing 0,50,100,200, in the nutrient solution of the phenylmercuric chloride of 400nmol/L
600value;
Fig. 7 is that recombinant bacterial strain of the present invention (BL21-7) is cultivated after 72h at the LB nutrient solution of 20 μ mol/l mercury chloride, the mercury content of recombinant bacterial strain; Wherein,
1 is the e. coli bl21 (BL21-0) that only contains pET28a empty carrier; 2 is recombinant bacterial strain of the present invention (BL21-7);
Fig. 8 is that recombinant bacterial strain is grown after 30h and formed cell mass and cell precipitation in the LB of the mercury chloride that contains 80 μ mol/l nutrient solution.
Embodiment
According to pseudomonas K-62 bacterial strain plasmid pmr26(GenBank accession number: D83080.2) and pmr28(GenBank accession number: AB013925.1), entrust the synthetic sub-merT-merP-merB1-merB2 of manual maneuvering of TAKARA company, with Nde I and Not I to plasmid pET28a(purchased from Bei Nuo bio tech ltd, Shanghai) carry out enzyme and cut, then reclaim, use In-Fusion HD Cloning Kit(Clontech, article No.: 639633) the sub-merT-merP-merB1-merB2 of manual maneuvering is inserted into plasmid pET28a(purchased from Bei Nuo bio tech ltd, Shanghai) region between Nde I and Not I, specific operation process is referring to In-Fusion HD Cloning Kit User Manual(Clontech, Protocol number:PT5162-1), with connecting product, escherichia coli DH5a is transformed, screening has the positive colony incubated overnight of resistance to kantlex, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p1.
Utilize common LB culture medium culturing enteroaerogen (Enterobacter aerogenes) (purchased from Bei Nuo bio tech ltd, Shanghai), culture condition is 37 ℃, 180rpm shaking culture 72h.
According to enteroaerogen (Enterobacter aerogenes) ppk gene order (GenBank accession number: D14445.1), design primer, extract enteroaerogen genomic dna, specifically can be with reference to sky root bacterial genomes DNA extraction test kit specification sheets (article No.: DP302-02).Take enteroaerogen genomic dna as template, amplification ppk gene.Primer is as follows:
PPPKF:5 '-ATAAGAAT
gCGGCCGCaTTTACCACGTCCTGTGATT-3 ' (underscore is designated as Not I restriction enzyme site)
PPPKR:5 '-CCGATCCG
cTCGAGgGTTAATCGGGTTGCTCGAG-3 ' (underscore is designated as Xho I restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer PPPKF 1pmol, primer PPPKR 1pmol, H
2o22 μ l, DNA 1 μ l.
PCR response procedures: 94 ℃, 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5min) 40 circulations, 72 ℃ of 10min.
The gene fragment amplifying and plasmid p1 are carried out after enzyme cuts back to close with Not I and Xho I, 4 ℃ of connections are spent the night, with connecting product, transform escherichia coli DH5a, picking positive colony carries out incubated overnight, extract plasmid, with Not I and Xho I, carry out enzyme and cut evaluation, to can enzyme cutting out the plasmid of about 2kb fragment, check order, right-on plasmid called after p2 will check order.
According to tobacco chloroplast genomic dna sequence (GenBank accession number: Z00044.2) and 5 ' UTR sequence (the Olins and Rangwala.A novel sequence element derived from bacteriophage T7 mRNA acts as an enhancer of translation of the lacZ gene in Escherichia coli.The Journal of Biological Chemistry of intestinal bacteria T7 phage gene 10,1989,264 (29): 16973-16976), entrust TAKARA company synthetic primer
P1F:5 '-CGA
cATATGgCTCCCCCGCCGTCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAG GGGGCAGGGATGGCTATATTTCTGGGAGCGAACTCCGGGCGAATACGAAGCGCTTG GATACAGTTGTAGGGAGGGATTTATCTTTTAACTTTAAGAAGGAG
tGGCCAaGCGCTATTCGATC
gAATTC(tilted letter is depicted as 5 ' end UTR sequence of intestinal bacteria T7 phage gene 10 to GGAC-3 '; Underscore is labeled as Nde I, Bal I and Eco RI restriction enzyme site)
P1R:5 '-GTCC
gAATTCgATCGAATAGCGCT
tGGCCAcTCCTTCTTAAAGTTAAAAGATAAATCCCTCCCTACAACTGTATCCAAGCGCTTCG TATTCGCCCGGAGTTCGCTCCCAGAAATATAGCCATCCCTGCCCCCTCACGTCAAT CCCACGAGCCTCTTATCCATTCTCATTGAACGACGGCGGGGGAGC
cATATG(tilted letter is depicted as 5 ' end UTR sequence of intestinal bacteria T7 phage gene 10 to TCG-3 '; Underscore is labeled as Eco RI, Bal I and Nde I restriction enzyme site).
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer P1F 1pmol, primer P1R 1pmol, H
2o 23 μ l.
PCR response procedures: 94 ℃ of 7min, 1-2 ℃/min is cooled to 25 ℃.
On PCR instrument, anneal, obtain the sequence fragment that contains rrn16 gene promoter and g10 gene translation enhanser.With Nde I and Eco RI, this fragment being carried out to enzyme cuts back to close.
The intestinal bacteria DH10B(that cultivation contains pET28a is purchased from Bei Nuo bio tech ltd, Shanghai), extract plasmid, with Nde I and Eco RI, carry out enzyme and cut, and reclaim.The fragment containing rrn16 gene promoter and g10 translational enhancer after pET28a after enzyme is cut cuts with above-mentioned enzyme is connected, and transforms escherichia coli DH5a.Select positive colony, 37 ℃ of incubated overnight, extract plasmid, carry out enzyme cut evaluation with Nde I and Eco RI, to can enzyme cutting out the plasmid of about 150bp fragment, carry out sequence verification.The plasmid called after p3 that the result is correct.
Take plasmid p2 as template, design primer, the sub-merT-merP-merB1-merB2-ppk of amplification manual maneuvering, primer is as follows:
P2F:5 '-CGG
tGGCCAgTATGTCTGAACCACAAAAACG-3 ' (underscore is designated as Bal I restriction enzyme site)
P2R:5 '-CGC
gAATTCtTATCATTTATCGGCATAGGT-3 ' (underscore is designated as Eco RI restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer P2F1pmol, primer P2R1pmol, H
2o 22 μ l, DNA 1 μ l.
PCR response procedures: 94 ℃, 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 5min) 40 circulations, 72 ℃ of 10min.
PCR reaction product is reclaimed, then with Bal I and Eco RI, under 37 ℃ of conditions, carry out enzyme and cut, then reclaim.
The intestinal bacteria that cultivation contains plasmid p3, extract plasmid, under 37 ℃ of conditions, plasmid p3 is carried out to enzyme cut with Bal I and Eco RI, then reclaim.P3 after enzyme is cut back to close and merT-merP-merB1-merB2-ppk carry out 24h connection with T4DNA ligase enzyme under 4 ℃ of conditions.Then with connecting product, escherichia coli DH5a is transformed.Picking positive colony carries out incubated overnight.After extraction plasmid, with Bal I and Eco RI, under 37 ℃ of conditions, carry out enzyme and cut evaluation.To can enzyme cutting out the evaluation of checking order of the plasmid of about 4kb Insert Fragment, correct plasmid called after p4 after identifying.
Cultivate tobacco NC89 to three leaf wholeheartedly, extract tobacco chloroplast DNA, the document that concrete grammar is delivered with reference to Sun Xiaorong etc. carries out (Sun Xiaorong etc., the optimization Southwestern Normal University journal (natural science edition) of triploid loquats chloroplast DNA extracting method, 2012,37(2): 93-96), take tobacco chloroplast DNA as template, design primer, the 3 ' UTR of amplification rsp16, primer is as follows:
P3F:5 '-CCG
gAATTCtCAACCGAAATTCAATTAAG-3 ' (underscore is designated as Eco RI restriction enzyme site)
P3R:5 '-CCG
gAATTCaAGAAAATATCGAAGAAAAAT-3 ' (underscore is designated as Eco RI restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer P3F1pmol, primer P3R1pmol, H
2o 22 μ l, DNA 1 μ l.
PCR response procedures: 94 ℃, 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min) 40 circulations, 72 ℃ of 10min.
Amplified production is carried out to purifying recovery, then with Eco RI, carry out enzyme and cut, then purifying reclaims.Plasmid p4 is carried out to enzyme with Eco RI and cut, purifying reclaims.Plasmid p4 after enzyme being cut with calf intestine alkaline phosphatase (TAKARA) carries out dephosphorylation processing.P4 after rsp 16 3 ' UTR after enzyme being cut with T4 DNA ligase and dephosphorylation are processed carries out 24h connection under 4 ℃ of conditions.With connecting product, e. coli bl21 (purchased from Bei Nuo bio tech ltd, Shanghai) is transformed.Picking positive colony carries out incubated overnight, carries out enzyme cut evaluation after extraction plasmid with Eco RI.To can enzyme cutting out the plasmid of about 0.5kb fragment, check order.Sequencing result shows that direction of insertion is that forward inserts and sequence right-on plasmid called after p5(or pET28a-P16S-g10-merT-merP-merB1-merB2-ppk-rspT), be for removing the recombinant plasmid of trade effluent mercury pollution, as Fig. 1.The e. coli bl21 called after BL21-7 that contains this plasmid, is for removing the recombinant bacterial strain of trade effluent mercury pollution.
Comparative example 1
1, take p2 as template, design primer, amplification g10-ppk gene.Primer is as follows:
PGKF:5 '-CGA
cATATGtTAACTTTAAGAAGGAGTGGCCAAGCGCTATTCGATCATTTACCACGTCCTGTGAT T-3 ' (underscore is designated as Nde I restriction enzyme site)
PGKR:5 '-CCG
gAATTCgGTTAATCGGGTTGCTCGAGTGATTTGATATAGTCGTAAATCGCCAGTTGCGACCG C-3 ' (underscore is designated as Eco RI restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer PGKF1pmol, primer PGKR1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 ℃ of 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5min) 40 circulations, 72 ℃ of 10min.
PCR product carries out enzyme with Nde I and Eco RI after reclaiming and cuts, plasmid pET28a also carries out enzyme with Nde I and Eco RI and cuts, after recovery, the two is carried out to 24h connection with T4DNA ligase enzyme under 4 ℃ of conditions, connect product and transform escherichia coli DH5a, select positive colony incubated overnight, extract plasmid and carry out enzyme and cut evaluation, to can enzyme cutting out the plasmid of about 2kb fragment, check order, the right-on plasmid called after of sequence p1-1 after order-checking.
2, cultivate tobacco NC89 to three leaf wholeheartedly, extract tobacco chloroplast DNA, take tobacco chloroplast DNA as template, design primer, the 3 ' UTR of amplification rsp16, primer is as follows:
P3F:5 '-CCG
gAATTCtCAACCGAAATTCAATTAAG-3 ' (underscore is designated as Eco RI restriction enzyme site)
P3R:5 '-CCG
gAATTCaAGAAAATATCGAAGAAAAAT-3 ' (underscore is designated as Eco RI restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer P3F1pmol, primer P3R1pmol, H
2o22 μ l, DNA1 μ l.
PCR response procedures: 94 ℃ of 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min) 40 circulations, 72 ℃ of 10min.
Amplified production is carried out to purifying recovery, then with Eco RI, carry out enzyme and cut, then purifying reclaims.Plasmid p1-1 is carried out to enzyme with EcoRI and cut, purifying reclaims.Plasmid p1-1 after enzyme being cut with calf intestine alkaline phosphatase (TAKARA) carries out dephosphorylation processing.P1-1 after rsp163 ' UTR after enzyme being cut with T4DNA ligase enzyme and dephosphorylation are processed carries out 24h connection under 4 ℃ of conditions.With connecting product, e. coli bl21 is transformed.Picking positive colony carries out incubated overnight, carries out enzyme cut evaluation after extraction plasmid with Eco RI.To can enzyme cutting out the plasmid of about 0.5kb fragment, check order.Sequencing result shows that direction of insertion is that forward inserts and sequence right-on plasmid called after p1-2(or pET28a-T7-g10-ppk-rspT).The e. coli bl21 called after BL21-1 that contains this plasmid.
Comparative example 2
1, utilize common LB culture medium culturing enteroaerogen (Enterobacter aerogenes) (purchased from Bei Nuo bio tech ltd, Shanghai), culture condition is 37 ℃, 180rpm shaking culture 72h.
According to enteroaerogen (Enterobacter aerogenes) ppk gene order (GenBank accession number: D14445.1), design primer, extract enteroaerogen genomic dna, specifically can be with reference to sky root bacterial genomes DNA extraction test kit specification sheets (article No.: DP302-02).Take enteroaerogen genomic dna as template, amplification ppk gene.Primer is as follows:
PPPK1F:5 '-CCG
gAATTCaTTTACCACGTCCTGTGATT-3 ' (underscore is designated as Eco RI restriction enzyme site)
PPPK1R:5 '-CCG
gAATTCgGTTAATCGGGTTGCTCGAG-3 ' (underscore is designated as Eco RI restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer PPPKF 1pmol, primer PPPKR 1pmol, H
2o 22 μ l, DNA 1 μ l.
PCR response procedures: 94 ℃ of 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5min) 40 circulations, 72 ℃ of 10min.
To plasmid p3, use Eco RI to carry out enzyme and cut, after recovery, with calf intestine alkaline phosphatase, process, then reclaim; The gene fragment amplifying is carried out to enzyme with Eco RI to be cut back to close, then the two is carried out to 4 ℃ and connect 24h, with connecting product, transform escherichia coli DH5a, picking positive colony carries out incubated overnight, extract plasmid, with Eco RI, carry out enzyme and cut evaluation, to can enzyme cutting out the plasmid of about 2kb fragment, check order, right-on plasmid called after p2-1 will check order.
2, cultivate tobacco NC89 to three leaf wholeheartedly, extract tobacco chloroplast DNA, take tobacco chloroplast DNA as template, design primer, the 3 ' UTR of amplification rsp16, primer is as follows:
P3F:5 '-CGC
gAGCTCtCAACCGAAATTCAATTAAG-3 ' (underscore is designated as Sac I restriction enzyme site)
P3R:5 '-CGC
gAGCTCaAGAAAATATCGAAGAAAAAT-3 ' (underscore is designated as Sac I restriction enzyme site)
PCR reaction system: Kang Wei century bio tech ltd, 2 * Pfu MasterMix(Beijing, article No.: CW0686A) 25 μ l, primer P3F 1pmol, primer P3R 1pmol, H
2o 22 μ l, DNA 1 μ l.
PCR response procedures: 94 ℃ of 5min, (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min) 40 circulations, 72 ℃ of 10min.
Amplified production is carried out to purifying recovery, then with Sac I, carry out enzyme and cut, then purifying reclaims.Plasmid p2-1 is carried out to enzyme with Sac I and cut, purifying reclaims.Plasmid p2-1 after enzyme being cut with calf intestine alkaline phosphatase (TAKARA) carries out dephosphorylation processing.P2-1 after rsp163 ' UTR after enzyme being cut with T4DNA ligase enzyme and dephosphorylation are processed carries out 24h connection under 4 ℃ of conditions.With connecting product, e. coli bl21 is transformed.Picking positive colony carries out incubated overnight, carries out enzyme cut evaluation after extraction plasmid with Sac I.To can enzyme cutting out the plasmid of about 0.5kb fragment, check order.Sequencing result shows that direction of insertion is that forward inserts and sequence right-on plasmid called after p3-1(or pET28a-P16S-g10-ppk-rspT).The e. coli bl21 called after BL21-2 that contains this plasmid.
Experimental example 1
Coli strain BL21-1, BL21-2 and BL21-7 are carried out to Real-time PCR Analysis, and with only contain pET28a empty carrier intestinal bacteria (called after BL21-0) cDNA in contrast.Coli strain used, in LB nutrient solution, is cultivated to 16h for 37 ℃.
Get RNeasy Mini kit(Qiagen for 1mL bacterium) the total RNA of extraction intestinal bacteria.The DNAse that with final concentration is 100 μ g/ml processes RNA sample, removes DNA contained in sample.With AccuScript cDNA kit(Stratagene) RNA is carried out to reverse transcription.With MJ MiniOpticon real-time PCR system(BioRad) cDNA sample is carried out to real-time quantitative PCR.After amplification, melt curve analysis carries out with two step amplification programs.Take PPK-rpsT gene as experimental subjects.For the impact of expressing except self PPK of degerming, real-time quantitative PCR the primer is across PPK and rpsT.Upstream primer is in PPK region, and what downstream primer was used is the sequence of rpsT.Can guarantee that like this gene only transforming from external source can be detected.Upstream primer and downstream primer are respectively PPRF(5 '-AACTTTATCGAAAACCCGTACCGTC-3 ') and PPRR(5 '-ATTTATTTAATCCATAATGGATTCA-3 ').In order to obtain quantitative criterion curve, primer concentration dilution is from 1 * 10
7copies/ μ l to 1 * 10
2the gradient concentration of copies/ μ l.
Result demonstration, the transcripton of ppk-rpsT is respectively 1373copies/ng, 8245copies/ng and 8326copies/ng in the quantity of coli strain BL21-1, BL21-2 and BL21-7, as Fig. 2.The transcripton of ppk-rpsT in BL21-7 is more than 6 times of analog value in BL21-1.The sign that does not have ppk-rpsT to express in contrast BL21-0.The carrier that this explanation the present invention builds can provide enough transcriptions.Enough transcriptions are the important factors of bacterium regulation and control synthetic protein, and the transgenosis mRNA protein common and high-content of high-content is proportionate.Result also shows simultaneously, and it is the key that obtains effective mercury tolerance that correct promotor and regulatory factor combine.The tolerance of e. coli bl21-2 of containing P16S-g10-ppk-rpst pair mercury at least improves 5 times (Fig. 3) than e. coli bl21-1 of containing T7-g10-ppk-rpst, and the latter is regulated and controled by a weak promoter T7.Resistance to mercury level is like this existing report (Hidemitsu et al.Polyphosphate produced in recombinant Escherichia coli confers mercury.FEMS Microbiology Letters, 2002,207 (2): conversion 159-164) has 7 times of the resistance to inorganic mercury ability of the intestinal bacteria of ppk gene.
Experimental example 2
By only transforming e. coli bl21-0 and the recombinant bacterial strain BL21-7 37 ℃ of shaking culture 16h in LB nutrient solution that have empty plasmid pET28a, then carry out the detection of mercury tolerance.Experimental technique is specific as follows:
Inorganic mercury: get LB nutrient solution that 5mL is fresh and be placed on respectively in vitro a series ofly, add mercury chloride, make final concentration be respectively 0,5,10,20,40 μ mol/l.
Methyl mercury: get LB nutrient solution that 5mL is fresh and be placed on respectively in vitro a series ofly, add Monomethyl mercury chloride, make that final concentration is respectively 0,50,100,200,400nmol/l.
Phenyl mercury: get LB nutrient solution that 5mL is fresh and be placed on respectively in vitro a series ofly, add phenylmercuric chloride, make that final concentration is respectively 0,50,100,200,400nmol/l.
In above-mentioned nutrient solution, adding respectively final concentration is that the IPTG of 0.8mmol/L induces, and adds the bacterium liquid of e. coli bl21-0 and recombinant bacterial strain BL21-7 simultaneously, and making its final concentration is OD
600=0.01.Test tube is 300rpm shaking culture 16-120h under 37 ℃ of conditions.Measure culture at the light absorption value at 600nm place.Every group has 3 parallel samples, averages, and result as shown in Figure 4,5, 6.
Fig. 4 result shows, e. coli bl21-0 can only tolerate the mercury chloride of 5 μ mol/l, even if but in the LB nutrient solution of 5 μ mol/l mercury chloride, the colibacillary speed of growth is still lower than the colibacillary speed of growth in the LB nutrient solution of chloride containing mercury not.And containing 10 μ mol/l mercury chloride even in the LB nutrient solution of greater concn, and e. coli bl21-0 is item complete suppressed, observes after cultivating 16-120h, and the intestinal bacteria content in nutrient solution does not increase.
Recombinant bacterial strain BL21-7 has good tolerance to the mercury chloride of 20 μ mol/l.After IPTG induction 120h, this bacterium state that reaches capacity in the LB of the mercury chloride that contains 20 μ mol/l nutrient solution, OD value when measured OD value reaches capacity state with the intestinal bacteria that grow in not mercurous LB nutrient solution under this state of saturation is very approaching.
Fig. 5 result shows, recombinant bacterial strain BL21-7 can finely grow in the LB of the methyl mercury that contains 100nmol/l nutrient solution, in the LB nutrient solution of the methyl mercury of the methyl mercury that contains 200nmol/l and 400nmol/l, also have the growth of certain degree, and grow in the LB of the methyl mercury that contains 100nmol/l nutrient solution and just suppressed completely in e. coli bl21-0 of only containing pET28a empty carrier.
Fig. 6 result shows, recombinant bacterial strain BL21-7 can finely grow in the LB of the phenyl mercury of the phenyl mercury that contains 200nmol/l and 400nmol/l nutrient solution, and grows and just suppressed completely in e. coli bl21-0 of only containing pET28a empty carrier in the LB of the phenyl mercury that contains 50nmol/l nutrient solution.
Therefore known, recombinant bacterial strain BL21-7 has the very tolerance of high level to inorganic mercury and organic mercury, it is divalence mercury by organomercurial transformation that recombinant bacterial strain BL21-7 can pass through transformed foreign gene, then by poly-phosphorus compound, divalence mercury chelating is got up, reach the toxicity that reduces mercury, strengthen the object to mercury tolerance.
Experimental example 3
At not mercurous LB nutrient solution, the LB nutrient solution that contains 20 μ mol/l mercury chloride and LB, process in nutrient solution and cultivate respectively e. coli bl21-0.The preparation method that LB processes nutrient solution is as follows: in fresh LB nutrient solution, adding mercury chloride to make its final concentration is 20 μ mol/l, then adds recombinant bacterial strain BL21-7, cultivates 120h.The centrifugal 2min of 13000rpm, collects supernatant liquor again, is that the filter membrane of 0.22 μ m carries out filtration sterilization to supernatant liquor with aperture.With LB, process nutrient solution inoculation e. coli bl21-0 bacterium liquid and make its final concentration OD
600=0.1, cultivate 16h.With the LB that does not add bacterium liquid, process nutrient solution as the contrast of growth response.Result shows, e. coli bl21-0 in not mercurous LB nutrient solution and LB process in nutrient solution, cultivate 16h after values of reaching capacity all.Can not grow in e. coli bl21-0 in the nutrient solution that contains 20 μ mol/l mercury chloride.These results show, recombinant bacterial strain BL21-7 not only can improve the mercury tolerance of bacterium, and the mercury in nutrient solution can be scavenged into the level of the intestinal bacteria normal growth that can allow only to transform empty plasmid pET28a.
Experimental example 4
Recombinant bacterial strain BL21-7 is cultivated respectively to 72h and 120h in the LB nutrient solution that contains 20 μ mol/l mercury chloride, then get 5mL culture and carry out centrifugally, obtain cell precipitation, by fresh LB nutrient solution flushing three times for cell precipitation.Then under 95 ℃ of conditions, add 70%(v/v) nitric acid, 30% hydrogen peroxide (v/v) and concentrated hydrochloric acid.Reference literature (Hidemitsu etal.Polyphosphate produced in recombinant Escherichia coli confers mercury.FEMS Microbiology Letters, 2002,207 (2): 159-164), the mercury accumulation volume of measuring bacterium, result as shown in Figure 7.Fig. 7 result shows, cultivates after 72h, and the mercury content of recombinant bacterial strain has reached 87.5+/-12.1 μ mol/l; Cultivate after 120h, recombinant bacterial strain mercury content reaches 115.6+/-11.7 μ mol/l.Show that recombinant bacterial strain BL21-7 can effectively absorb mercury, the liquid of mercury pollution is carried out to biological restoration, remove the mercury wherein polluting.
Experimental example 5
Recombinant bacterial strain BL21-7 cultivates sufficiently long after the time in the nutrient solution that contains high density mercury, can form cell mass.In the LB nutrient solution that contains 80 mercury chloride of μ mol/l or the mercury chloride of greater concn, grow after 30h, can observe cell mass and cell precipitation, as Fig. 8.This phenomenon does not observe in the LB nutrient solution of lower concentration chlorination mercury content.When mercury chloride content surpasses 40 μ mol/l, recombinant bacterial strain culture presents dun.The appearance of this phenomenon depends on recombinant bacterial strain to the tolerance of mercury and accumulation.Colour-change in recombinant bacterial strain repair process can be used as a mark, and assessment recombinant bacterial strain biological restoration reaches the concrete progress of repair process.Cultivate after for some time, the cell mass precipitating and cell precipitation are filtered out, the precipitated cell mass getting off of a large amount of mercury carries away, thereby carries out the task of removing mercury.
Application experiment example
The waste water of discharging from Changsha chlor-alkali plant, sample.Water sample, at indoor standing 15min, filters with Medium speed filter paper, finally uses the membrane filtration of 0.45 μ m, adds mercury chloride, methyl mercury, phenyl mercury, and its final concentration is respectively 20 μ mol/l, 200nmol/l and 400noml/l.Then in the waste water after above-mentioned processing, add respectively IPTG to induce, and add recombinant bacterial strain BL21-7 bacterium liquid, making its final concentration is OD
600=0.01,300rpm shaking culture under 37 ℃ of conditions.
Experimental result discovery, recombinant bacterial strain BL21-7 has good tolerance to the waste water (20 μ mol/l mercury chloride, 200nmol/l Monomethyl mercury chloride and 400noml/l phenylmercuric chloride) after processing.After IPTG induction 180h, the state that reaches capacity in the waste water of this bacterium after processing, OD value when this bacterium growing in measured OD value and waste water before processing under this state of saturation reaches capacity state is approaching.
By recombinant bacterial strain BL21-7 to cultivating respectively 72h and 180h in the waste water (20 μ mol/l mercury chloride, 200nmol/l Monomethyl mercury chloride and 400noml/l phenylmercuric chloride) after processing, then getting 5mL culture carries out centrifugal, obtain cell precipitation, cell precipitation is rinsed three times with fresh LB nutrient solution.Then under 95 ℃ of conditions, add 70%(v/v) nitric acid, 30% hydrogen peroxide (v/v) and concentrated hydrochloric acid.Reference literature (Hidemitsu etal.Polyphosphate produced in recombinant Escherichia coli confers mercury.FEMS Microbiology Letters, 2002,207 (2): 159-164), measure the mercury accumulation volume of bacterium.Result shows, cultivates after 72h, and the mercury content of recombinant bacterial strain has reached 60.3+/-12.5 μ mol/l; Cultivate after 180h, bacterium mercury content can reach 70.2+/-14.3 μ mol/l.After cultivating 180h, bacterium mercury content is higher owing to there being more recombined engineering bacteria growing than the value of 72h, or after growth time prolongation, has more mercury to have the sufficient time to be transported in cell.These results further prove that recombinant bacterial strain BL21-7 can growth and breeding in the waste water that contains organic mercury and inorganic mercury, can carry out absorption and accumulation to the organic mercury in waste water and inorganic mercury, can remove the mercury pollution in waste water.
Claims (6)
1. one kind for removing the recombinant plasmid of trade effluent mercury pollution, it is characterized in that, described recombinant plasmid is that 3 ' the end non-coding region, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacter aerogenes) and pseudomonas (Pseudomonas) the K-62 bacterial strain that insert ribosome bind site conserved sequence in 5 ' UTR sequence of tobacco chloroplast rrn16 gene strong promoter, intestinal bacteria T7 phage gene 10, tobacco chloroplast rps16 gene on the basis of plasmid pET28a removes mer operon after merA, merG and build and form.
2. according to claim 1ly for removing the recombinant plasmid of trade effluent mercury pollution, it is characterized in that, include the nucleotide sequence shown in SEQ ID NO.1.
3. for removing a construction process for the recombinant plasmid of trade effluent mercury pollution, it is characterized in that, comprise the following steps:
(1) according to pseudomonas K-62 bacterial strain plasmid pmr26 and pmr28, the synthetic sub-merT-merP-merB1-merB2 of manual maneuvering, it is connected with plasmid pET28a, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p1;
(2) take enteroaerogen DNA as template, design primer, amplification ppk gene; After ppk gene is cut with plasmid p1 enzyme, be connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line, called after p2;
(3) design primer, the ribosome bind site conserved sequence in 5 ' the UTR sequence that amplification contains tobacco chloroplast rrn16 gene strong promoter and intestinal bacteria T7 phage gene 10;
(4) after being cut with plasmid pET28a enzyme, the ribosome bind site conserved sequence in 5 ' the UTR sequence that contains tobacco chloroplast rrn16 gene strong promoter and intestinal bacteria T7 phage gene 10 is connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extract plasmid, enzyme is cut and the qualification result that checks order plasmid in line, called after p3;
(5) take plasmid p2 as template, design primer, the sub-merT-merP-merB1-merB2-ppk of amplification manual maneuvering; After merT-merP-merB1-merB2-ppk is cut with plasmid p3 enzyme, be connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line, called after p4;
(6) take tobacco chloroplast DNA as template, design primer, amplification rps163 ' end non-coding region gene sequence; After being cut with plasmid p4 enzyme, rps163 ' end non-coding region gene is connected, connect product and transform escherichia coli DH5a, screening positive clone incubated overnight, extracts plasmid, and enzyme is cut and the qualification result that checks order plasmid in line is for removing the recombinant plasmid of trade effluent mercury pollution.
4. one kind for removing the recombinant bacterial strain of trade effluent mercury pollution, it is characterized in that, described recombinant plasmid is that 3 ' the end non-coding region, the poly-phosphokinase gene ppk of enteroaerogen (Enterobacter aerogenes) and pseudomonas (Pseudomonas) the K-62 bacterial strain that insert ribosome bind site conserved sequence in 5 ' UTR sequence of tobacco chloroplast rrn16 gene strong promoter, intestinal bacteria T7 phage gene 10, tobacco chloroplast rps16 gene on the basis of plasmid pET28a removes mer operon after merA, merG and build and form.
5. according to claim 4ly for removing the recombinant bacterial strain of trade effluent mercury pollution, it is characterized in that, the host of described recombinant bacterial strain is e. coli bl21.
6. a recombinant bacterial strain as claimed in claim 4 is in the application of removing aspect trade effluent mercury pollution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310507408.3A CN103525849B (en) | 2013-10-24 | 2013-10-24 | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310507408.3A CN103525849B (en) | 2013-10-24 | 2013-10-24 | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103525849A true CN103525849A (en) | 2014-01-22 |
| CN103525849B CN103525849B (en) | 2016-01-20 |
Family
ID=49928197
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310507408.3A Expired - Fee Related CN103525849B (en) | 2013-10-24 | 2013-10-24 | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103525849B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114774452A (en) * | 2022-04-29 | 2022-07-22 | 天津大学 | Construction method and application of engineering escherichia coli for adsorbing mercury ions in solution |
| WO2023092655A1 (en) * | 2021-11-29 | 2023-06-01 | 浙江大学 | Method and recombinant strain for enhancing methyl mercury demethylation and/or divalent mercury reduction abilities of fungus, and use |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1614024A (en) * | 2003-11-06 | 2005-05-11 | 中国科学院上海生命科学研究院 | Transgened-tobacco for degrading organic mercury pollution |
| CN102753691A (en) * | 2009-08-20 | 2012-10-24 | 泛美波多黎各大学 | Heavy metal remediation system |
-
2013
- 2013-10-24 CN CN201310507408.3A patent/CN103525849B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1614024A (en) * | 2003-11-06 | 2005-05-11 | 中国科学院上海生命科学研究院 | Transgened-tobacco for degrading organic mercury pollution |
| CN102753691A (en) * | 2009-08-20 | 2012-10-24 | 泛美波多黎各大学 | Heavy metal remediation system |
Non-Patent Citations (3)
| Title |
|---|
| HIDEMITSU PAN-HOU等: "Polyphosphate produced in recombinant Escherichia coli confers mercury resistance", 《FEMS MICROBIOLOGY LETTERS》, 23 January 2002 (2002-01-23) * |
| NANCY V. HAMLETT等: "Roles of the Tn2l merT, merP, and merC Gene Products in Mercury Resistance and Mercury Binding", 《JOURNAL OF BACTERIOLOGY》, vol. 174, no. 20, 31 October 1992 (1992-10-31), pages 6377 - 6385 * |
| 林宇岚 等: "细菌的汞抗性基因及其在生物修复中的应用", 《海峡预防医学杂志》, vol. 12, no. 1, 31 December 2006 (2006-12-31) * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023092655A1 (en) * | 2021-11-29 | 2023-06-01 | 浙江大学 | Method and recombinant strain for enhancing methyl mercury demethylation and/or divalent mercury reduction abilities of fungus, and use |
| CN114774452A (en) * | 2022-04-29 | 2022-07-22 | 天津大学 | Construction method and application of engineering escherichia coli for adsorbing mercury ions in solution |
| CN114774452B (en) * | 2022-04-29 | 2023-12-26 | 天津大学 | Construction method and application of engineering escherichia coli for adsorbing mercury ions in solution |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103525849B (en) | 2016-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nguyen et al. | Isolation and characterization of antimony-reducing bacteria from sediments collected in the vicinity of an antimony factory | |
| RU2571222C2 (en) | Heavy metal remediation system | |
| ES2396765B1 (en) | Recombinant bacterium capable of removing chemical species of mercury (II); Cadmium and copper in the presence of other heavy metals from contaminated sites; product for bioremediation; product obtaining process and method of application for bioremediation. | |
| Heidari et al. | Optimization study of nickel and copper bioremediation by Microbacterium oxydans strain CM3 and CM7 | |
| Stout et al. | Phytoprotective influence of bacteria on growth and cadmium accumulation in the aquatic plant Lemna minor | |
| CN101186898B (en) | Paracoccus and application thereof in nitrogenous heterocyclic compound degradation | |
| Shah et al. | Enhanced arsenic accumulation in Saccharomyces cerevisiae overexpressing transporters Fps1p or Hxt7p | |
| CN103834589A (en) | Achromobacter xylosoxidans and application thereof | |
| CN113481126B (en) | Herbicide propanil specific degrading strain, degrading amidase gene and application | |
| Zhang et al. | Identification of a new microcystin-degrading bacterium isolated from Lake Chaohu, China | |
| CN103160283A (en) | Heavy metal pollution prothetic composition of soil and water body and application | |
| Ramírez-Rodríguez et al. | Arsenic removal using Chlamydomonas reinhardtii modified with the gene acr3 and enhancement of its performance by decreasing phosphate in the growing media | |
| CN107022015B (en) | Iris lactea heavy metal ATP enzyme transport protein IlHMA2 and coding gene and application thereof | |
| CN103525849B (en) | A kind of recombinant plasmid for removing trade effluent mercury pollution, construction process, recombinant bacterial strain and application | |
| Li et al. | Treatment of high-concentration chromium-containing wastewater by sulfate-reducing bacteria acclimated with ethanol | |
| CN109880829B (en) | Barley HvPAA1 gene and application thereof | |
| Srinivasan et al. | Production of bioflocculant from Klebsiella pneumoniae: evaluation of fish waste extract as substrate and flocculation performance | |
| L’haridon et al. | Marinitoga lauensis sp. nov., a novel deep-sea hydrothermal vent thermophilic anaerobic heterotroph with a prophage | |
| CN107974415A (en) | Application of one plant of arsenic oxidizing bacteria in terms of rice field trivalent arsenic pollution is repaired | |
| Tripti et al. | Evaluation of arsenic removal potential of arsenic resistant bacteria with the role of physiological and genomic factors | |
| AU2002355148B2 (en) | Adaption of bacteria for use in leaching | |
| CN102604901B (en) | Heavy-metal mercury-resistance related protein DbsMerA and encoding genes and application thereof | |
| Zhao et al. | Nitrogen in landfills: Sources, environmental impacts and novel treatment approaches | |
| CN108218970B (en) | Recombinant protein and preparation method and application thereof | |
| CN108624570B (en) | Hexavalent chromium reductase and application thereof in treatment of chromium pollution of water body |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160120 Termination date: 20171024 |