CN103497252A

CN103497252A - Single-domain heavy chain antibody L5-78 for Listeria monocytogenes

Info

Publication number: CN103497252A
Application number: CN201310430970.0A
Authority: CN
Inventors: 涂追; 陈奇; 陶勇; 熊勇华; 许杨
Original assignee: Nanchang University
Current assignee: Nanchang University
Priority date: 2013-09-22
Filing date: 2013-09-22
Publication date: 2014-01-08
Anticipated expiration: 2033-09-22
Also published as: CN103497252B

Abstract

The invention relates to a single-domain heavy chain antibody and polypeptide for Listeria monocytogenes. The antibody has the protein or polypeptide with the amino acid sequence disclosed as SEQ ID NO:1, and can be used in the fields of immune detection, antigen enrichment purification and the like. The amino acid sequence provided by the invention can be used as a precursor, can be modified by using a random or site-directed mutagenesis technique to obtain a mutant with better properties (affinity, specificity, stability and the like), and is used for developing proteins or polypeptides which are further used in medicine, industry and agriculture.

Description

Single domain heavy chain antibody L5-78 for Listeria monocytogenes

Technical field

The present invention relates to single domain heavy chain antibody technology (claiming again the nano antibody technology), and the genetic engineering antibody technology, particularly for single domain heavy chain antibody or the polypeptide of Listeria monocytogenes.

Technical background

Single domain antibody refers to the genetic engineering antibody be comprised of common antibody variable region (VH or VL).The single domain heavy chain antibody (is called again nano antibody, VHH antibody, variable domain of heavy chain of heavy-chain antibody) refer to the genetic engineering antibody only formed by heavy chain antibody (heavy-chain antibody) variable region (Variable region), wherein, heavy chain antibody (heavy-chain antibody) is a kind of antibody that is present in natural disappearance light chain in the animal bodies such as camel, shark.The single domain heavy chain antibody has the characteristics such as molecular weight is little, good penetrability, has been widely used at present the fields such as fundamental research, medical diagnosis and detection, antibody drug exploitation.

Listeria monocytogenes ( listeria monocytogenesbe called for short Listeria monocytogenes, LM), belong to listeria, on etiology, by the world, generally being known as at present is a kind of pathogenic bacteria that can cause zoonosis and food origin disease, in nineteen twenty-six, by Murray etc., from separating in the rabbit body, is obtained at first, can cause the listeriosis of people, animal and bird, this sick clinical manifestation is behaved and animal meningitis, septicemia and pregnant woman's miscarriage etc., with pregnancy women, newborn infant and immunologic hypofunction person easy infection.The people causes listeriosis by animal foods such as the edible Milk and milk products polluted, meats.Although the incidence of the Liszt's disease caused by Listeria monocytogenes is not high, due to its lethality rate, up to more than 30%, to the patient of immunodeficiency, lethality rate is even up to 70%.

At present, existing for the polyclonal antibody of Listeria monocytogenes, the open report of monoclonal antibody.With the single domain heavy chain antibody, compare, these antibody exist production cost relatively high, the shortcomings such as preparation process complexity.The single domain heavy chain antibody has the character such as molecular weight is little, good penetrability, demonstrates wide application prospect.

Summary of the invention

The purpose of this invention is to provide single domain heavy chain antibody (comprising the protein or the polypeptide that contain all or part of functional area of described single domain heavy chain antibody) and aminoacid sequence thereof for Listeria monocytogenes, can be used to reagent and instrument that preparation detects Listeria monocytogenes.

The invention provides the single domain heavy chain antibody for Listeria monocytogenes, there is the aminoacid sequence shown in SEQ ID NO.:1.

The IMGT numbering of its aminoacid sequence and the division of structural domain are as shown in Figure 1.

Single domain heavy chain antibody provided by the present invention comprises respectively four framework regions (Framework region, FR) and three complementary determining regions (Complementarity-determining region, CDR).In SEQ ID NO.:1, framework region (FR1-FR4) is selected from respectively 1 ~ 25,34 ~ 50,59 ~ 96,114 ~ 124 aminoacid sequences, and complementary determining region (CDR1-CDR3) is selected from respectively 26 ~ 33,51 ~ 58 and 97 ~ 113 aminoacid sequences (seeing sequence table).Complementary determining region mainly is responsible for the identification of antigen, and the framework region structure is relatively stable, mainly plays a part to support the Protein requirement structure.

The invention provides a nucleic acid molecule, coding SEQ ID NO.:1, can obtain the concrete sequence of this nucleic acid molecule at any time by genetic codon.

Described nucleic acid molecule is preferably SEQ ID NO.:2 sequence.

Nucleotide sequence provided by the present invention can be expressed to obtain corresponding protein or polypeptide by appropriate expression system.These expression systems comprise bacterium, yeast, filamentous fungus, zooblast, insect cell, vegetable cell, or Cell free expression system.

The present invention also provides a kind of carrier, comprises described nucleotide sequence.

The present invention also provides a kind of host cell, comprises described protein or expression vector.

The present invention also provides a kind of method that detects Listeria monocytogenes, it is characterized in that containing above-mentioned protein or polypeptide.Ability based on protein provided by the invention or polypeptide and Listeria monocytogenes specific binding, set up the detection method of Listeria monocytogenes.Wherein, preferred method comprises that enzyme connects immunoabsorption (Enzyme-linked immunosorbent assay, ELISA), fluorescent immune method (Fluoroimmunoassay, FIA), immuno-chip method, affinity chromatography and immunochromatographic method.

The invention still further relates to this application of the heavy chain antibody of single domain for Listeria monocytogenes in Listeria monocytogenes immunodetection, thalline or antigen enrichment and purification method.

Aminoacid sequence provided by the present invention can be used as precursor, by random or site-directed mutagenesis technique, transformed, can obtain better mutant of character (water-soluble, stability, avidity and specificity etc.), be used for development to be further used for protein or the polypeptide of medicine, industry, agricultural.

Some terms that the present invention narrates have following implication:

Homology: the similarity degree of describing two or more aminoacid sequences, between first aminoacid sequence and second aminoacid sequence, the per-cent of homology can calculate being multiplied by [100%] divided by [amino acid sum in first aminoacid sequence] by [quantity of the amino-acid residue identical with the aminoacid sequence of corresponding position in second aminoacid sequence in first aminoacid sequence], and wherein certain amino acid whose disappearance, insertion, replacement or the interpolation (comparing with first amino acid) in second aminoacid sequence is considered to that difference is arranged.Alternatively, percent homology also can utilize the known program of the Computing for sequences match to obtain as NCBI Blast.

Structural domain: the fundamental structural unit of tertiary protein structure has certain function usually.

IMGT numbering: a kind of standardized antibody aminoacid sequence method for numbering serial in IMGT database (The International ImMunoGeneTics Datbase).Concrete method for numbering serial can reference (Ehrenman, F., Q.Kaas, et al. (2010). " IMGT ∕ 3D structure-DB and IMGT ∕ DomainGapAlign:a databaseand a tool for immunoglobulins or antibodies, T cell receptors, MHC, IgSF and MhcSF. " Nucleic Acids Res 38 (Database issue): D301-307. Lefranc, M.P., C.Pommie, et al. (2003). " IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Igsuperfamily V-like domains " Dev comp Immunol 27 (1): the description 55-77.).

Codon (codon): be called again three disjunctor codons (triplet code), refer to corresponding to certain amino acid whose nucleotide triplet.Determine that in the process of translating this seed amino acid inserts the position of polypeptide chain in growth.

The accompanying drawing explanation

Fig. 1 amino acid numbering and structural domain schematic diagram.

The indirect phage-ELISA method of Fig. 2 is measured phage in conjunction with activity and specificity.Ordinate zou means ELISA reader mensuration 450nm place light absorption value, X-coordinate means according to table 1 application of sample, coated different thalline, and large intestine means intestinal bacteria, the sramana means Salmonellas, the wax sample means Bacillus cereus, singly increases expression and singly increases listeria spp, and Ge Shi means the Ge Shi listeria spp, Ying Nuo means listeria innocua, Weir means the Weir listeria spp, and sheep means the sheep listeria spp, and Xi Er means the Xi Er listeria spp.

Fig. 3 phagemid pHEN-L5-78 structure iron.

Fig. 4 expression plasmid PET25-L5-78 structure iron.

Fig. 5 is that L5-78 single domain heavy chain antibody is expressed and Western Blot evaluation figure, left side swimming lane 1 is the molecular weight of albumen standard, swimming lane 2 is for not adding the BL21-PET-25b-L5-78 recombinant bacterium lysate that IPTG induces, and swimming lane 3 is the BL21-PET-25b-L5-78 recombinant bacterium lysate of inducing through IPTG.The right is for take the Western Blot evaluation figure that anti-His label enzyme labelled antibody is probe.

Embodiment

Below by preparation, analysis and the application of single domain heavy chain antibody (polypeptide), the present invention will be further described, and these specific embodiments should not be interpreted as limiting range of application of the present invention by any way.

Elutriation and the evaluation of the anti-Listeria monocytogenes single domain of embodiment 1 heavy chain antibody

The method that adopts the solid phase elutriation from the natural antibody phage display library of hunchbacked source elutriation for the single domain heavy chain antibody of Listeria monocytogenes.The cultivation of Listeria monocytogenes is carried out with reference to GB GB4789.30-2010, and the Listeria monocytogenes of cultivation is used aseptic phosphate buffer solution (PBS, pH7.4) to be diluted to 2 * 10 ⁹cFU ∕ mL, add it in enzyme plate hole, 100 μ L ∕ holes, and 4 ℃ of coated spending the night, first run elutriation is coated with 3 holes, and later elutriation is coated with 1 hole, the sucking-off coating buffer, PBS washes plate 3 times.In several elutriation processes of taking turns, using 3%BSA or 3%OVA alternately as encapsulant, 37 ℃ of sealing 2 h, PBS washes plate 3 times, adds phage antibody library 100 μ L(approximately containing 2 * 10 ¹¹pFU), hatch 1.5h for 37 ℃, the first run is only used the PBS washing, and each wheel of back is used PBST (containing 1%Tween-20) to wash plate 3 times (increasing by 1 time by wheel), then washes plate 4 times (increasing by 2 times by wheel) with PBS.With 100 μ L glycine-hydrochloric acid elutriant (Gly-HCl, pH 2.2) phage of elution of bound, with the Tris-HCl(pH 9.1 of 20 μ L) in and eluate, get 10 μ L for titer determination, all the other eluates are increased, and amplified production is used for to the next round elutriation.

After five take turns elutriation, adopt helper phage KM13 to be rescued the mono-clonal of random choose, obtain respectively showing the phage particle of antibody variable region, then measure the combination active (Fig. 2) of phage particle by indirect phage-ELISA method.

Table 1 is phage-ELISA application of sample table indirectly

Figure 2013104309700100002DEST_PATH_IMAGE001

Send order-checking company to carry out sequencing the ELISA positive colony, obtain the DNA sequence dna of Insert Fragment, wherein the L5-78 sequence is as follows:

CCATGGCCCAGTTGCAGCTCGTGGAGTCCGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGACGCACCTTCAGTAGGTATGCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTAGCCGCTATTAGCCGGAGTGGTGTTAATACGCGCTATGAAGACTCCGTGAAGGGCCGATCAACCATCTCCAGAGACAACGCCAAGAGGTCGGTGTTTCTGCAAATGGACAGTCTGAAACGTGACGACACGGCCGTTTATTACTGTGCAGCCCGACGTGGGCCGGGTACTTCTGTTTTGAGTGATGATTATGACTACTGGGGTCAGGGGACCCAGGTCACCGTCTCCTCAGAACCCAAGACACCAAAACCACAA GCGGCCGC

(underscore means the restriction enzyme enzyme recognition site).

According to codon, its corresponding aminoacid sequence is as SEQ ID NO.:1.

The expression of single domain heavy chain antibody in intestinal bacteria of embodiment 2 anti-Listeria monocytogenes

The encode acquisition of DNA fragmentation of anti-Listeria monocytogenes: 1. use restriction enzyme Not I, single endonuclease digestion phagemid pHEN-L5-78(Fig. 3), and use agarose gel electrophoresis to reclaim, then use restriction enzyme Nco I to carry out incomplete digestion to reclaiming fragment, and reclaim the purpose fragment by agarose gel electrophoresis.2. according to sequence information provided by the invention, by the chemosynthesis of biotechnology service company; 3. design Auele Specific Primer, by round pcr from alpaca ( lama pacos) source cDNA library in increase.

By the gene fragment clone of the L5-78 double digestion that obtains to expression vector PET-25b, after sequence verification, called after PET25-L5-78 (Fig. 4).

Recombinant plasmid PET25-L5-78 is transformed in e. coli bl21, and picking list bacterium colony carries out abduction delivering.By the access of single bacterium colony, containing in the test tube of 5 mL liquid LB substratum, 37 ℃, 180 rmp ∕ min shaking culture spend the night; Inoculum size with 1% is transferred to it in LB liquid nutrient medium of 150 mL, after 37 ℃, 180 rmp ∕ min shaking culture are about 0.5 to OD, adds the IPTG that final concentration is 0.6 mM, and 30 ℃, 180 rmp ∕ min are induced and spent the night.

Bacterium liquid, by 6000 rmp ∕ min, obtains thalline in centrifugal 5 minutes, and thalline is used aseptic PBS washing 3 times, and carry out resuspended thalline with the aseptic PBS of 15 mL, ultrasonication thalline on ice, the ultrasonication condition is 200 W, broken 2 s, 3 s intermittently, totally 40 circulations are carried out centrifugally under 4 ℃ to cell pyrolysis liquid, centrifugal condition is 12000 rmp ∕ min, time is 10min, goes supernatant to carry out SDS-PAGE electrophoretic analysis and Western blot analysis (Fig. 5).

By optimizing abduction delivering condition (as Host Strains, expression vector, induction time, inducing temperature and IPTG concentration etc.), can further improve the expression amount of target protein (single domain heavy chain antibody), for a large amount of single domain heavy chain antibodies that prepare anti-Listeria monocytogenes provide approach.

Embodiment 3 Listeria monocytogenes ELISA detect

Principle based on indirect enzyme-linked immunosorbent assay, set up the detection method of Listeria monocytogenes.Detect the processing of sample and carry out sample collecting according to standard GB/T 4789.30-2010 and increase bacterium cultivating, get 1 mL enrichment liquid in the sterilizing small test tube, heating 15 min in boiling water.Remaining enrichment liquid, in 4 ℃ of preservations, is confirmed for use in the positive.Recombinate the preparation of anti-Listeria monocytogenes single domain heavy chain antibody with reference to application example 2.With negative control OD ₄₅₀2.1 times of positive decision contents of conduct of value.Colouring reagents is 3,3', and 5,5'-tetramethyl benzidine (TMB) can be bought by biological reagent company.

In enzyme plate, according to the coated rabbit anti-listeria polyclonal antibody in 100 μ L./holes, 4 ℃ are spent the night, the sucking-off coating buffer, and PBS washes plate 3 times, adds 3% skimming milk, 37 ℃ of sealing 2 h, PBS washes plate 3 times; Then by the sample after above-mentioned thermal treatment with after 1 times of PBS dilution, 100 μ L ∕ holes, hatch 1 h for 37 ℃, PBS washes plate 3 times, usings the dilution of enrichment liquid as negative control; Add anti-Listeria monocytogenes single domain heavy chain antibody, 100 μ L ∕ holes, hatch 1 h for 37 ℃, and PBS washes plate 3 times; Add the anti-His monoclonal antibody of HRP mark of 1:3000 dilution, 100 μ L ∕ holes, hatch 1 h for 37 ℃, and PBS washes plate 3 times; 37 ℃, TMB lucifuge 5 min that develop the color, stop buffer (2 M H ₂sO ₄) 50 μ L ∕ holes, naked eyes judgement or by the microplate reader number of degrees.

SEQUENCE LISTING

<110 > University Of Nanchang

<120 > for the single domain heavy chain antibody L5-78 of Listeria monocytogenes

<130> 2013

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 124

<212> PRT

<213 > artificial sequence

<400> 1

Gln Leu Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Arg Tyr

20 25 30

Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val

35 40 45

Ala Ala Ile Ser Arg Ser Gly Val Asn Thr Arg Tyr Glu Asp Ser Val

50 55 60

Lys Gly Arg Ser Thr Ile Ser Arg Asp Asn Ala Lys Arg Ser Val Phe

65 70 75 80

Leu Gln Met Asp Ser Leu Lys Arg Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Ala Arg Arg Gly Pro Gly Thr Ser Val Leu Ser Asp Asp Tyr Asp

100 105 110

Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 2

<211> 398

<212> DNA

<213 > artificial sequence

<400> 2

cccagttgca gctcgtggag tccgggggag gattggtgca ggctgggggc tctctgagac 60

tctcctgtgc agcctctgga cgcaccttca gtaggtatgc catgggctgg ttccgccagg 120

ctccagggaa ggagcgtgag tttgtagccg ctattagccg gagtggtgtt aatacgcgct 180

atgaagactc cgtgaagggc cgatcaacca tctccagaga caacgccaag aggtcggtgt 240

ttctgcaaat ggacagtctg aaacgtgacg acacggccgt ttattactgt gcagcccgac 300

gtgggccggg tacttctgtt ttgagtgatg attatgacta ctggggtcag gggacccagg 360

tcaccgtctc ctcagaaccc aagacaccaa aaccacaa 398

Claims

1. for the single domain heavy chain antibody of Listeria monocytogenes, there is the aminoacid sequence shown in SEQ ID NO.:1.

2. a nucleic acid molecule, aminoacid sequence described in claim 1 is characterized in that encoding.

3. nucleic acid molecule as claimed in claim 2, its feature has the sequence as SEQ ID NO.:2.

4. a carrier that comprises nucleotide sequence claimed in claim 2.

5. a host cell that comprises carrier claimed in claim 4.

6. the application in immunodetection, thalline or antigen enrichment and purification method for Listeria monocytogenes single domain heavy chain antibody claimed in claim 1.