CN106008711B - Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex - Google Patents

Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex Download PDF

Info

Publication number
CN106008711B
CN106008711B CN201610513032.0A CN201610513032A CN106008711B CN 106008711 B CN106008711 B CN 106008711B CN 201610513032 A CN201610513032 A CN 201610513032A CN 106008711 B CN106008711 B CN 106008711B
Authority
CN
China
Prior art keywords
heavy chain
single domain
chain antibody
domain heavy
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610513032.0A
Other languages
Chinese (zh)
Other versions
CN106008711A (en
Inventor
何庆华
许杨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanchang University
Original Assignee
Nanchang University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanchang University filed Critical Nanchang University
Priority to CN201610513032.0A priority Critical patent/CN106008711B/en
Publication of CN106008711A publication Critical patent/CN106008711A/en
Application granted granted Critical
Publication of CN106008711B publication Critical patent/CN106008711B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/14—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from fungi, algea or lichens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/567—Framework region [FR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention belongs to field of biotechnology, more particularly to single domain heavy chain antibody (the Variable domain of heavy chain of heavychain antibody that can specifically bind vomitoxin Ag-Ab immune complex (Immunocomplex), VHH it) prepares and its applies, amino acid sequence SEQ ID NO.:1.Single domain heavy chain antibody of the present invention can specifically bind vomitoxin Ag-Ab immune complex, can replace traditional antibody, and be applied to the non-competitive immune analysis of DON.Amino acid sequence provided by the present invention can be used as precursor, is transformed by random or site-directed mutagenesis technique, can obtain the better mutant of property, for developing the protein or polypeptide that are further used for industry, field of food safety.

Description

Specifically bind the single domain heavy chain antibody of vomitoxin Ag-Ab immune complex And its application
Technical field
The present invention relates to single domain heavy chain antibody technology (also known as nano antibody technology) and genetic engineering antibody technology, Belong to field of biotechnology, and in particular to vomitoxin antigen-antibody complex (Immunocomplex) can be specifically bound Single domain heavy chain antibody (Variable domain of heavy chain of heavychain antibody, VHH) preparation and It is applied.
Background technique
Immunoassay method can be divided into competition and non-competitive two kinds of forms.Non-competitive immunoassay is with its sensitivity High, step is simply widely used in the analysis of the macromolecular substances containing multiple epitopes such as microorganism, virus, albumen. For small-molecule substance, since small-molecule substance molecular weight is too small, be not easy by two antibody in combination with, therefore develop base Just seem very difficult in the immunoassay that the noncompetitive pattern of double antibodies sandwich is used for small-molecule substance.However, also having in recent years Researcher is based on novel immune recognition component and immunoassay combines new model, has developed a series of the non-of small-molecule substances Competitive immunization analytical model, such as: the isodigeranyl position of non-competitive immunoassay, small-molecular peptides based on anti-unique antibody Point compound transfer immunity analytic approach, non-competitive immune complex detection technique, based on the non-competing of chemical modification haptens Type analysis, special separate apparatus, distinct antibodies immunoassay etc. are the hair of the non-competitive immunoassay method of small-molecule substance Exhibition provides beneficial exploration.
Deoxynivalenol (Deoxynivalneol, DON) is a kind of small molecule fungi of Trichothecenes Toxin also known as vomitoxin are widely present in the crops such as barley, wheat, corn, oat and its product.DON has cell Toxicity, embryotoxicity and immunotoxicity etc., slight poisoning can cause the symptoms such as anorexia, vomiting, diarrhea, fever, blood pressure raising, sternly The life of the mankind and animal can be threatened when weight.Due to the high pollution rate and high toxicity of DON, the DON in food is carried out quick Detection has important practical significance.In numerous DON detection methods, immunological detection method is easy to operate, special because of its The features such as property and high sensitivity, it is widely used to the extensive screening of DON in food.DON belongs to small-molecule substance, Bu Nengtong When combined by two conventional antibodies, cause the immunological analysis method of current DON to be mostly based on competitive type immunoassay.So And it is compared to competitive type immunoassay, non-competitive immunoassay method has few operating procedure, high sensitivity, detection model The advantages such as wide are enclosed, therefore the non-competitive immunoassay method for establishing DON just has important practical significance.
Heavy chain antibody (Heavy-chain antibody) is a kind of natural deletions light chain, the antibody being only made of heavy chain, It is present in the animals such as camel, alpaca, shark and cartilaginous fish.Single domain heavy chain antibody, i.e. nano antibody (Variable Domain of heavy chain of heavy-chain antibody, VHH) refer to only by antibody heavy chain variable region The genetic engineering antibody of (Variable region) composition.Compared with common antibody, nano antibody has molecular weight small, water-soluble The advantages that property is good, and stability is high, is widely used to food scientific research at present, medical diagnosis, the fields such as medicament research and development.It is anti- Antigen-antibody immune complex (Immunocomplex), a kind of compound formed after referring to antigen in conjunction with antibody.
The present invention uses display technique of bacteriophage, natural from hunchbacked source using DON Ag-Ab immune complex as target molecule Elutriation can specifically bind the single domain heavy chain antibody of DON Ag-Ab immune complex in single domain heavy chain antibody library, basic herein On be applied to the non-competitive immunoassay system of DON.Target point can be specifically bound by display technique of bacteriophage elutriation The single domain heavy chain antibody of son, this method avoid animal immune processes needed for conventional antibodies preparation, and step is simple, convenient fast Victory, the single domain heavy chain antibody screened can be applied to the non-competitive immunoassay of DON.
Summary of the invention
It is an object of the present invention to provide the single domain heavy chain antibodies that one kind can specifically bind DON Ag-Ab immune complex (protein or polypeptide including containing the single domain heavy chain antibody all or part functional area) and its amino acid sequence, can be with It is used for the detection and analysis of mycotoxin DON.
The single domain heavy chain antibody provided by the present invention for specifically binding DON Ag-Ab immune complex, has Amino acid sequence shown in SEQ ID NO.:1.
The IMGT number of its amino acid sequence and the division of structural domain are as shown in Figure 1.
Single domain heavy chain antibody mentioned by the present invention includes that four framework regions (Framework region, FR) and three are mutual It mends and determines area (Complementarity-determining region, CDR).Wherein, framework region (FR1-FR4) is respectively selected from SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 and SEQ ID NO.:8, complementary determining region (CDR1-CDR3) point It Xuan Zi not SEQ ID NO.:3, SEQ ID NO.:5 and SEQ ID NO.:7.Frame plot structure is relatively conservative, mainly plays maintenance The effect of protein structure；Complementary determining region structure is relatively diversified, is mainly responsible for the identification of Ag-Ab immune complex.
The present invention provides a kind of protein or polypeptide, includes SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 With the amino acid sequence of one or two of SEQ ID NO.:8 or more, and at least have with the amino acid sequence of one of them 90% homology.
The present invention provides a kind of protein or polypeptide, includes SEQ ID NO.:3, SEQ ID NO.:5 and SEQ ID NO.: One or two of 7 or more amino acid sequence, and at least have 80% homology with the amino acid sequence of one of them.
The present invention provides a kind of nucleic acid molecules, it is characterized in that coding SEQ ID NO.:1, by genetic codon can To obtain the particular sequence of the nucleic acid molecules at any time.
Single domain heavy chain antibody provided by the present invention can largely be prepared by way of Phage amplification.Bacteriophage is expanded Increase and refer to and will show the bacteriophage for having the single domain heavy chain antibody, by way of biology amplification, mass propagation production shows there is this The bacteriophage particles of single domain heavy chain antibody.
Single domain heavy chain antibody provided by the present invention can have single domain heavy chain antibody by the displaying that Phage amplification obtains Bacteriophage particles be directly used in analysis detection.
Nucleotide sequence provided by the present invention or partial sequence can be expressed by suitable expression system have been obtained To corresponding protein or polypeptide.These expression systems include bacterium, saccharomycete, filamentous fungi, zooblast, insect cell, Plant cell or Cell free expression system.
Single domain heavy chain antibody provided by the present invention can be applied to immunology detection analysis.The type packet of immunology detection It is immune based on Ag-Ab specific reaction to include MBP enzyme linked immuno-adsorbent assay, colloidal gold immunochromatographimethod, immunodotting hybridization etc. Detection type is analysed in credit.
Amino acid sequence provided by the present invention can be used as precursor, is transformed by random or site-directed mutagenesis technique, More enough acquisition property water solubilitys, stability, affinity and specificity etc.) better mutant, it is further used for for developing The protein or polypeptide of DON immunoassay.
Some terms described in the present invention have following meaning:
Homology: the similarity degree of two or more amino acid sequences, first amino acid sequence and second ammonia are described Percent homology between base acid sequence can by [in the first amino acid sequence with corresponding position in the second amino acid sequence The quantity of the identical amino acid residue of the amino acid residue at place] divided by [in first amino acid sequence amino acid sum] multiplied by [100%] it calculates, wherein the missing of some amino acid in the second amino acid sequence, insertion, replacement or addition are (with the first ammonia Base acid is compared) it is considered as having difference.In addition, percent homology also can use the known computer for sequence alignment Operation program (such as: NCBI Blast) obtains.
Structural domain: the fundamental structural unit of tertiary protein structure usually has the function of certain.
IMGT number: one in IMGT database (The International ImMunoGeneTics Database) Plant normalised antibody amino acids sequence method for numbering serial.Specific method for numbering serial can with bibliography (Ehrenmann, F., Q.Kaas,et al.(2010)."IMGT/3Dstructure-DB and IMGT/DomainGapAlign:a database and a tool for immunoglobulins or antibodies,T cell receptors,MHC,IgSF and MhcSF."Nucleic Acids Res 38(Database issue):D301-307.Lefranc,M.P.,C.Pommie,et al.(2003)."IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains."Dev Comp Immunol 27(1): Description in 55-77.).
Codon (codon): also known as triplet code (triplet code), refer to the nucleotide corresponding to certain amino acid Triplet.The position of polypeptide chain in this kind of amino acid insertion growth is determined during translation.
Detailed description of the invention
Fig. 1 is the amino acid number and structural domain schematic diagram of single domain heavy chain antibody antibody.
Fig. 2 is the non-competitive elisa assay DON curve based on phage display single domain heavy chain antibody.Detection range is 0 ~500ng/mL.
Specific embodiment
Below by the elutriation, analysis and application of single domain heavy chain antibody, the invention will be further described, these are specific Implementation is not construed in any way as limiting application range of the invention.
The affine elutriation and its identification of the specific binding DON Ag-Ab immune complex single domain heavy chain antibody of embodiment 1
Using the method for the affine elutriation of solid phase, elutriation is immune for DON Ag-Ab from hunchbacked source native heavy antibody library The single domain heavy chain antibody of compound.Using the anti-DON mouse monoclonal antibody ascites of affine column purification, it is anti-to obtain anti-DON monoclonal Body；Anti- DON monoclonal antibody is diluted to 50 μ g/mL of final concentration with PBS (pH 7.4), coated elisa plate hole, 4 DEG C were coated with Night.After second day is washed 15 times with PBST (10mM PBS, 0.1%Tween-20 (v/v)), 1% gelatin, 37 DEG C of closing 1h are added； Confining liquid is drawn, is washed 5 times with PBST, the DON standard items (20ng/mL) of 100 μ L, 37 DEG C of incubation 1h, to be formed are added in hole DON Ag-Ab immune complex；Then it is washed 5 times with PBST, it is natural that 100 μ L camel sources are added in the hole for forming compound Single domain heavy chain antibody library (titre about 2.0 × 1011Cfu), 37 DEG C of incubation 1h；It is washed 5 times with PBST, sterile ddH2O is washed 7 times, After Glycine-HCl (0.2M, pH 2.2) the elution 8min of 100 μ L is added, immediately with 15 μ L Tris-HCl (1M, pH 9.1) It neutralizes；The bacteriophage being not associated in hole is drawn, takes 10 μ L to be used to measure titre, remaining grows to logarithmic phase for infecting 25mL E.coli TG1 bacterial strain expanded.It is remained unchanged in the panning process conditional of second, third and fourth round, step is same On.
After four-wheel elutriation, the monoclonal selected at random is rescued using helper phage KM13, is respectively obtained Show the phage particle of antibody variable region, then active with the combination of non-competing phage-ELISA method measurement phage particle, it is real Setting ground control is tested, specific load procedure is shown in Table 1.
The non-competing phage-ELISA of table 1 is loaded table
It send sequencing company to carry out sequencing ELISA positive colony, obtains the DNA sequence dna of Insert Fragment, wherein single domain Heavy chain antibody sequence is as follows:
CCATGGCCCAGTTGCAGCTCGTGGAGTCGGGTGGAGGATTGGTGCAGGCTGGGGACTCTCTGAGACTCT CCTGTGCAGCCTCTGGACGCACCTTCAGTGGCGTCGTTATGGGCTGGTTCCGCCAGGCTCTAGGGAAGGAGCGTAAC TTTGTAGCGTCTATTAGCCGGAGTAGTGCATACACAAACTATGCAGACTCCGTGAAGGACCGATTCACCATCTCGAG AGACAACGCCAAGAATACGGTGTATCTGCAAATGAACAACCTGAAACCTGAGGACACGGCCCTTTATTACTGTGCAG CCGCCAACTACAGTACGACCAGAGCATCCGCGTATCGTTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGAA CCCAAGACACCAAAACCACAAGCGGCCGC
(underscore indicates restriction enzyme enzyme recognition site)
According to codon, corresponding amino acid series such as SEQ ID NO.:1.
The amplification of the specific binding DON antigen-antibody complex single domain heavy chain antibody phasmid of embodiment 2
There is the bacteriophage of positive single domain heavy chain antibody to be added to 20mL in the culture for being inoculated with E.coli TG1 displaying, 30 DEG C of 220rpm shaken cultivation 6h；Culture is transferred in another centrifuge tube, supernatant is transferred to by 4 DEG C, 8000rpm centrifugation 15min In one fresh centrifuge tube, the PEG/NaCl of 1/6 volume is added, after 4 DEG C of standings 4h, 4 DEG C, 8000rpm centrifugation 10min, in abandoning Clearly；Bacteriophage is resuspended in 1mL PBS, and the PEG/NaCl of 1/6 volume is added, after 4 DEG C of standings 1h, 4 DEG C of 10000rpm centrifugation 10min, Supernatant is abandoned, 500 μ L PBS are added and are resuspended, as Phage amplification liquid.
Embodiment 3 specifically binds expression of the DON antigenantibody complex single domain heavy chain antibody in Escherichia coli.
Using restriction enzyme NotI/NcoI, incomplete digestion, Ago-Gel recycling are carried out to phasmid pHEN1 Target fragment.
By the gene fragment clone of obtained single domain heavy chain antibody double digestion to expression vector pET-25b, through sequence verification Afterwards, it is named as pET25b-DON.
Recombinant plasmid pET25b-DON is converted into Escherichia coli Rosetta, and carries out inducing expression.Picking single colonie It is seeded in 5mL liquid LB/Amp culture medium, in 37 DEG C, 200rpm shaking table shake culture 10h；By above-mentioned culture solution with 1% Inoculum concentration is inoculated in 50mL LB liquid medium, 37 DEG C, 200rpm shake culture to OD be 0.5 after, be added it is final concentration of 0.05mM IPTG, in 30 DEG C, 180rpm shaking table Fiber differentiation 8h.
After Induced cultures are centrifuged 10min by 8000rpm, thallus and ultrasonication, ultrasonic item is resuspended with 15mL PBS Part is 220W, is crushed 2s, interval 3s, totally 60 circulations；By broken thallus on 4 DEG C, 8000rpm centrifugation 15min, collection Clearly and carry out the soluble single domain heavy chain antibody of affinity column purifying acquisition.
It, can be into one by optimizing inducing expression condition (such as host strain, expression vector, IPTG concentration and inducing temperature) Step improves the expression quantity of single domain heavy chain antibody, specifically binds DON antigen-antibody complex single domain heavy chain antibody for a large amount of preparations Provide approach.
The foundation of non-competitive elisa assay DON curve of the embodiment 4 based on phage display single domain heavy chain antibody
Anti- DON monoclonal antibody is diluted to 10 μ g/mL with PBS (pH 7.4) and is added in ELISA Plate hole, 100 holes μ L/, 4 DEG C of coatings are overnight；Coating buffer is discarded, is washed 3 times with 0.05%PBST, 3% skimmed milk of 300 μ L is added, 37 DEG C of closings 2 are small When；Confining liquid is abandoned, with 0.05%PBST board-washing 3 times, every hole is added a series of DON standard items of various concentrations, 100 holes μ L/, and 37 DEG C be incubated for 1 hour, formed DON antigen-antibody complex；Liquid in hole is abandoned, after 0.05%PBST board-washing 3 times, every hole investment 100 μ L show the bacteriophage (1.0 × 10 for having single domain heavy chain antibody9Cfu)/solubility expression single domain heavy chain antibody (10 μ g/ ML), it is incubated for 1 hour for 37 DEG C；The histidine tag two of anti-M13 bacteriophage secondary antibody/anti-VHH of 1:5000 dilution HRP label is added Anti-, 37 DEG C are incubated for 1 hour.Then it is developed the color with tmb substrate, reads OD450.Using DON log concentration as abscissa, OD450It is sat to be vertical Mark establishes the non-competitive elisa assay DON curve (Fig. 2) based on phage display single domain heavy chain antibody.The result shows that washing in a pan It selects the single domain heavy chain antibody obtained that there is DON antigen-antibody complex and combines activity and responsiveness.

Claims (3)

1. a kind of single domain heavy chain antibody for specifically binding vomitoxin Ag-Ab immune complex, has SEQ ID NO.: 1 Shown in amino acid sequence.
2. a kind of nucleic acid molecules, it is characterized in that amino acid sequence described in coding claim 1.
3. the preparation method of single domain heavy chain antibody described in claim 1, it is characterised in that: pass through Phage amplification or gene work It is prepared by the mode of journey recombinant expression；The Phage amplification, which refers to, to show the bacteriophage for having the single domain heavy chain antibody, leads to The mode of biology amplification is crossed, breeding production shows the bacteriophage particles for having the single domain heavy chain antibody；The genetic engineering recombinates table The mode reached, which refers to, to encode the gene of the single domain heavy chain antibody, by being cloned into expression vector, with the shape of protein expression Formula carries out the preparation of the single domain heavy chain antibody.
CN201610513032.0A 2016-07-04 2016-07-04 Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex Active CN106008711B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610513032.0A CN106008711B (en) 2016-07-04 2016-07-04 Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610513032.0A CN106008711B (en) 2016-07-04 2016-07-04 Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex

Publications (2)

Publication Number Publication Date
CN106008711A CN106008711A (en) 2016-10-12
CN106008711B true CN106008711B (en) 2019-06-18

Family

ID=57105013

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610513032.0A Active CN106008711B (en) 2016-07-04 2016-07-04 Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex

Country Status (1)

Country Link
CN (1) CN106008711B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109762064B (en) * 2019-01-25 2022-12-02 南昌大学 Single-domain heavy chain antibody Nb71 for vibrio fluvialis

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104592389A (en) * 2014-12-19 2015-05-06 南昌大学 Nano antibody of anti-deoxynivalenol antibody

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104592389A (en) * 2014-12-19 2015-05-06 南昌大学 Nano antibody of anti-deoxynivalenol antibody

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
抗DON单域重链抗体序列分析及三维建模与对接;涂追 等;《江苏农业学报》;20110831;第27卷(第4期);第894页左栏第2段、第896页图3 *

Also Published As

Publication number Publication date
CN106008711A (en) 2016-10-12

Similar Documents

Publication Publication Date Title
CN103497252B (en) For the single domain heavy chain antibody L5-78 of Listeria monocytogenes
CN104592389B (en) The nano antibody of anti-deoxynivalenol antibody
CN103204937A (en) Single-domain heavy chain antibody T10 aiming at immune globulin Fc segment
CN105198990B (en) Antibody and the preparation method and application thereof for the detection of Bt Cry1 toxoid wide spectrums
CN107602701A (en) Zearalenone green immunization analysis method based on antiidiotype nano antibody
CN106084060B (en) Emesis Venom antigens-antibody immune complex nano antibody and its application
CN104926940A (en) Human-derived insecticidal protein and preparation method and application thereof
CN106008711B (en) Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex
CN113173973A (en) Zearalenone mimic epitope and application thereof
CN105968205B (en) A kind of nano antibody of anti-prostate-specific membrane antigen
CN112625133A (en) CDK2 nano antibody and application thereof
CN106084061B (en) Emesis Venom antigens-antibody immune complex single domain heavy chain antibody and its application
CN102321177B (en) Anti-melamine single-chain antibody and application thereof
CN106117363B (en) Nano antibody and its application of vomitoxin Ag-Ab immune complex can be specifically bound
CN104311643B (en) Nano antibody-based deoxynivalenol mimic antigen and application thereof
CN106841607A (en) Acute Hepatopancreatic necrosis syndrome dedicated test kit and preparation method thereof
CN110317241A (en) The peptide molecule of anti-Cry1Da albumen and its application
CN103497251B (en) For the single domain heavy chain antibody L5-79 of Listeria monocytogenes
CN104804070B (en) Peptide molecule and its application of zearalenone can be specifically bound
CN105315346B (en) Peptide molecule and its application of deoxynivalenol can be specifically bound
CN101186644B (en) H3 type flu virus hemagglutinin space conformation simulation antigen epitope and application thereof
CN109762065A (en) For the single domain heavy chain antibody Nb72 of vibrio fluvialis
CN100519759C (en) A process for preparation of an agglutination reagent for rapid detection of typhoid
CN116987194B (en) Anti-idiotype nano antibody of mimic epitope peptide of human ST2 antigen and application thereof
CN109824776B (en) Single-domain heavy chain antibody Nb73 for vibrio fluvialis

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant