CN106084060A - The nano antibody of resisting emesis Venom antigens antibody immune complex and application thereof - Google Patents
The nano antibody of resisting emesis Venom antigens antibody immune complex and application thereof Download PDFInfo
- Publication number
- CN106084060A CN106084060A CN201610512993.XA CN201610512993A CN106084060A CN 106084060 A CN106084060 A CN 106084060A CN 201610512993 A CN201610512993 A CN 201610512993A CN 106084060 A CN106084060 A CN 106084060A
- Authority
- CN
- China
- Prior art keywords
- antibody
- nano antibody
- don
- nano
- phage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/44—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Nanotechnology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Composite Materials (AREA)
- Condensed Matter Physics & Semiconductors (AREA)
- General Physics & Mathematics (AREA)
- Materials Engineering (AREA)
- Crystallography & Structural Chemistry (AREA)
- Immunology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to biological technical field, it is specifically related to nano antibody (the Variable domain of heavy chain of heavychain antibody of resisting emesis Venom antigens antibody immune complex (Immunocomplex), VHH) prepare and apply, its aminoacid sequence SEQ ID NO.:1.Nano antibody of the present invention can specific binding vomitoxin antigenantibody complex, can substitute for traditional antibody, and be applied to the non-competitive immune analysis of vomitoxin.Aminoacid sequence provided by the present invention can be transformed by random or site-directed mutagenesis technique as precursor, it is possible to obtains the more preferable mutant of character, is used for developing being further used for industry, the protein of field of food safety or polypeptide.
Description
Technical field
The present invention relates to single domain heavy chain antibody technology (being also called nano antibody technology), and genetic engineering antibody technology,
Belonging to biological technical field, the nanometer being specifically related to resisting emesis Venom antigens-antibody immune complex (Immunocomplex) resists
Body (Variable domain of heavy chain of heavychain antibody, VHH) is prepared and applies.
Background technology
Immune analysis method can be divided into competition and non-competitive two kinds of forms.Non-competitive immunoassay is with its sensitivity
High, step is simply widely used in the analysis of the macromolecular substances containing multiple epitopes such as microorganism, virus, albumen.
For small-molecule substance, owing to small-molecule substance molecular weight is too small, be difficult to by two antibody in combination with, therefore develop base
Noncompetitive pattern in double antibodies sandwich just seems the most difficult for the immunoassay of small-molecule substance.But, the most also have
Researcher combines new model based on Novel immune recognition component and immunoassay, has developed the non-of a series of small-molecule substance
Competitive immunization analytical model, such as: based on the anti-unique non-competitive immunoassay of antibody, the isodigeranyl position of small-molecular peptides
Point complex transfer immunity analytic process, non-competitive immune complex detection technique, chemically based modification is haptenic non-competing
Type analysis, special separate apparatus, distinct antibodies immunoassay etc., sending out for the non-competitive immune analysis method of small-molecule substance
Exhibition provides useful exploration.
Deoxynivalenol (Deoxynivalneol, DON) is the little molecule fungus of a kind of Trichothecenes
Toxin, has another name called vomitoxin, is widely present in the crops such as Fructus Hordei Vulgaris, Semen Tritici aestivi, Semen Maydis, Herba bromi japonici and goods thereof.DON has cell
Toxicity, fetal toxicity and immunotoxicity etc., slight poisoning can cause anorexia, vomit, suffer from diarrhoea, have a fever, blood pressure rises high symptom, sternly
The life of the mankind and animal can be threatened during weight.Due to high pollution rate and the high toxicity of DON, the DON in food is carried out quickly
Detection has important practical significance.In numerous DON detection methods, immunological detection method is simple to operate, special because of it
Property and sensitivity high, be widely used to the extensive examination of DON in food.DON belongs to small-molecule substance, it is impossible to
Time combined by two conventional antibodies, cause the immunological analysis method of current DON to be mostly based on competitive type immunoassay.So
And, be compared to competitive type immunoassay, non-competitive immune analysis method have operating procedure few, highly sensitive, detection model
Enclosing the advantages such as wide, the non-competitive immune analysis method hence setting up DON just has important practical significance.
Heavy chain antibody (Heavy-chain antibody) is a kind of natural deletions light chain, the antibody being only made up of heavy chain,
It is present in the animals such as camel, alpaca, shark and cartilaginous fish.Single domain heavy chain antibody, i.e. nano antibody (variable
Domain of heavy chain of heavy-chain antibody, VHH) refer to only by antibody heavy chain variable region
The genetic engineering antibody that (Variable region) forms.Compared with common antibody, it is little that nano antibody has molecular weight, water-soluble
Property is good, and stability advantages of higher is widely used to food scientific research at present, medical diagnosis, the field such as medicament research and development.Anti-
Antigen-antibody immune complex (immunocomplex), a kind of complex formed after referring to antigen and antibodies.
The present invention uses phage display nano antibody storehouse technology, with DON Ag-Ab immune complex as target molecule,
The nano antibody of elutriation anti-DON Ag-Ab immune complex from camel natural single domain heavy chain antibody storehouse, source, on this basis will
It is applied to the non-competitive immunoassay system of DON.Can be tied by specificity by the technology elutriation of phage display nano antibody storehouse
Closing the nano antibody of target molecule, this method avoid the animal immune process needed for conventional antibodies preparation, step is simple, convenient fast
Victory, the nano antibody that screening obtains can be applicable to the non-competitive immunoassay of DON.
Summary of the invention
It is an object of the present invention to provide a kind of anti-DON Ag-Ab immune complex nano antibody (include containing described in receive
The protein of all or part of functional area of meter Kang Ti or polypeptide) and aminoacid sequence, can be used for mycotoxin DON's
Detection is analyzed.
The nano antibody of anti-DON Ag-Ab immune complex provided by the present invention, has shown in SEQ ID NO.:1
Aminoacid sequence.
The IMGT numbering of its aminoacid sequence and the division of domain are as shown in Figure 1.
Nano antibody mentioned by the present invention includes four framework regions (Framework region, FR) and three complementations certainly
Determine district (Complementarity-determining region, CDR).Wherein, framework region (FR1-FR4) is respectively selected from SEQ
ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6 and SEQ ID NO.:8, complementary determining region (CDR1-CDR3) selects respectively
From SEQ ID NO.:3, SEQ ID NO.:5 and SEQ ID NO.:7.Framework region structure is the most conservative, mainly plays maintenance albumen
The effect of matter structure；Complementary determining region structure is the most diversified, the main identification being responsible for Ag-Ab immune complex.
The present invention provides a kind of protein or polypeptide, comprises SEQ ID NO.:2, SEQ ID NO.:4, SEQ ID NO.:6
With one or two and the above aminoacid sequence in SEQ ID NO.:8, and at least aminoacid sequence with one of them has
90% homology.
The present invention provides a kind of protein or polypeptide, comprises SEQ ID NO.:3, SEQ ID NO.:5 and SEQ ID NO.:
One or two and above aminoacid sequence in 7, and at least aminoacid sequence with one of them has 80% homology.
The invention provides a kind of nucleic acid molecules, it is characterized in that encoding SEQ ID NO.:1, by genetic codon can
To obtain the particular sequence of this nucleic acid molecules at any time.
Nano antibody provided by the present invention can be prepared by the way of Phage amplification in a large number.Phage amplification is
Referring to the phage that displaying has this nano antibody, by the way of biology expands, amount reproduction produces displaying this nano antibody
Bacteriophage particles.
Nano antibody provided by the present invention can have the phage of nano antibody by the displaying that Phage amplification obtains
Particle is directly used in analysis detection；
Nucleotide sequence provided by the present invention or partial sequence can carry out expressing with by suitable expression system
Obtain corresponding protein or polypeptide.These expression systems include antibacterial, yeast, filamentous fungi, zooblast, and insecticide is thin
Born of the same parents, plant cell, or Cell free expression system.
Nano antibody provided by the present invention can apply to immunology detection analysis.The type of immunology detection includes enzyme
The immune credits based on Ag-Ab specific reaction such as connection immunoadsorption detection, colloidal gold immunochromatographimethod, immunodotting hybridization
Analysis detection type.
Aminoacid sequence provided by the present invention can be transformed by random or site-directed mutagenesis technique as precursor,
More enough acquisition character water solublity, stability, affinity and specificity etc.) more preferable mutant, it is used for developing being further used for
The protein of DON immunoassay or polypeptide.
Some terms described in the present invention have a following implication:
Homology: describe the similarity degree of two or more aminoacid sequence, first aminoacid sequence and second ammonia
Percent homology between base acid sequence can be by [with relevant position in the second aminoacid sequence in the first aminoacid sequence
The quantity of the identical amino acid residue of amino acid residue at place] it is multiplied by again divided by [aminoacid sum in first aminoacid sequence]
[100%] calculate, wherein certain the amino acid whose disappearance in the second aminoacid sequence, insert, replace or add (with the first ammonia
Base acid is compared) it is considered as to have difference.It addition, percent homology can also utilize the known computer for sequence alignment
Operation program (such as: NCBI Blast) obtains.
Domain: the fundamental structural unit of tertiary protein structure, is generally of certain function.
IMGT numbers: in IMGT data base (The International ImMunoGeneTics Database)
Plant the most standardized antibody amino acids sequence method for numbering serial.Concrete method for numbering serial be referred to document (Ehrenmann, F.,
Q.Kaas,et al.(2010)."IMGT/3Dstructure-DB and IMGT/DomainGapAlign:a database
and a tool for immunoglobulins or antibodies,T cell receptors,MHC,IgSF and
MhcSF."Nucleic Acids Res 38(Database issue):D301-307.Lefranc,M.P.,C.Pommie,et
al.(2003)."IMGT unique numbering for immunoglobulin and T cell receptor
variable domains and Ig superfamily V-like domains."Dev Comp Immunol 27(1):
Description in 55-77.).
Codon (codon): also known as triplet code (triplet code), refers to corresponding to certain amino acid whose nucleotide
Triplet.The position of polypeptide chain in this kind of aminoacid insertion growth is determined during translation.
Accompanying drawing explanation
Fig. 1 is amino acid number and the domain schematic diagram of nano antibody.
Fig. 2 is non-competitive elisa assay DON curve based on phage display nano antibody.Detection range be 0～
500ng/mL。
Detailed description of the invention
Below by nano antibody elutriation, analyze and apply, the invention will be further described, and these are embodied as
It is not construed in any way as limiting the range of application of the present invention.
The affine elutriation of embodiment 1 anti-DON Ag-Ab immune complex nano antibody and qualification thereof
The method elutriation from the native heavy antibody library of camel source using the affine elutriation of solid phase is immune for DON Ag-Ab
The nano antibody of complex.Use affinity column purification anti-DON monoclonal antibody ascites, obtain anti-DON monoclonal antibody；Use PBS
Anti-DON monoclonal antibody is diluted to final concentration 30 μ g/mL by (pH 7.4), joins in two ELISA Plate holes, and 4 DEG C were coated
Night；Sucking-off is coated liquid, after washing 5 times with PBST (10mM PBS, 1.5%Tween-20 (v/v)), addition 5%BSA-PBS (or
3%OVA-PBS) close 2h for 37 DEG C；Sucking confining liquid, wash 50 times with PBST, it is natural that hole (A hole) adds 100 μ L camel sources
Single domain heavy chain antibody storehouse (titre about 1.0 × 1011Cfu), another hole (B hole) adds the DON standard substance of 100 μ L 100ng/mL
To form DON antigen-antibody complex, hatch 2h for 37 DEG C；Phage unconjugated in A hole is transferred to be formed DON antigen-anti-
In the B hole of nanocrystal composition, hatch 1h for 37 DEG C；Discard unconjugated phage in B hole, wash 10 times with PBST, add 100 μ L's
After Glycine-HCl (0.2M, pH 2.2) eluting 8min, neutralize with 15 μ L Tris-HCl (1M, pH 9.1) immediately.Take 10 μ L
Wash-out bacteriophage measures titre, for next round elutriation after remaining eluate amplification.Elutriation in second, third and fourth round
Cheng Zhong, alternately closes with 3%BSA and 3%OVA, and other step is ibid.
After four-wheel elutriation, use helper phage KM13 that the monoclonal of random choose is rescued, respectively obtain
Show the phage particle of antibody variable region, then the combination activity with non-competing phage-ELISA method mensuration phage particle, real
Testing setting ground control, concrete load procedure is shown in Table 1.
The non-competing phage-ELISA of table 1 is loaded table
Send order-checking company to carry out sequencing ELISA positive colony, obtain the DNA sequence of Insert Fragment, wherein nanometer
The coded sequence of antibody is as follows:
CCATGGCCCAGGTGCAGCTCGTGGAGTCAGGCGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCT
CCTGTGTAGCCTCTGGACGCGCCTTTCGTAGATATACCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAG
TTTGTAGCAACAATTAACTGGAGTGGTCGTAATACAGCGTATGCCGACTCCGTGAAGGGCCGATTCACCATCTCCAG
AGACAGCCGCAAAAACACCGCGTATCTCCAAATGAACAGCCTGAAACCTGAAGATACGGCCGTTTATTATTGTGCAC
AATCGCGAGCGATTACAGGTGGCACAGTTCCCGCCGGTTATAACATCTGGGGCCAGGGGACCCAGGTCACCGTCTCC
TCAGAACCCAAGACACCAAAACCACAAGCGGCCGC
(underscore represents restriction enzyme enzyme recognition site)
According to codon, corresponding amino acid series such as SEQ ID NO.:1.
The amplification of embodiment 2 anti-DON antigen-antibody complex nano antibody phasmid
The phage addition that displaying has positive nano antibody is inoculated with in the culture of E.coli TG1 to 20mL, 30 DEG C
220rpm shaken cultivation 6h；Culture is proceeded in another centrifuge tube, 4 DEG C, 8000rpm be centrifuged 15min, supernatant is proceeded to one new
In fresh centrifuge tube, add the PEG/NaCl of 1/6 volume, after 4 DEG C stand 4h, 4 DEG C, 8000rpm be centrifuged 10min, abandon supernatant；
The resuspended phage of 1mL PBS, adds the PEG/NaCl of 1/6 volume, and after 4 DEG C stand 1h, 4 DEG C of 10000rpm are centrifuged 10min, abandon
Clearly, add 500 μ L PBS and carry out resuspended, be Phage amplification liquid.
The expression in escherichia coli of the embodiment 3 anti-DON antigenantibody complex nano antibody.
Using restricted enzyme NotI/NcoI, phasmid pHEN1 carries out incomplete digestion, agarose gel reclaims
Purpose fragment.
By the gene fragment clone of nano antibody double digestion that obtains to expression vector pET-25b.
By in recombinant plasmid transformed to escherichia coli Rosetta, and carry out abduction delivering.By list colony inoculation to 5mL liquid
In body LB/Amp culture medium, in 37 DEG C, 200rpm shaking table concussion cultivation 10h；Above-mentioned culture fluid is inoculated in the inoculum concentration of 1%
In 50mL LB liquid medium, 37 DEG C, 200rpm concussion cultivate be 0.5 to OD after, add final concentration of 0.05mM IPTG, in
30 DEG C, 180rpm shaking table inducing culture 8h.
After Induced cultures is centrifuged 10min by 8000rpm, with the resuspended thalline of 15mL PBS ultrasonication, ultrasonic bar
Part is 220W, broken 2s, intermittently 3s, totally 50 circulations；Will broken after thalline in 4 DEG C, 8000rpm be centrifuged 15min, in collection
Clear and carry out affinity column purification and obtain solubility nano antibody.
By optimizing abduction delivering condition (such as Host Strains, expression vector, IPTG concentration and inducing temperature etc.), one can be entered
Step improves the expression of nano antibody, provides way for preparing specific binding DON antigen-antibody complex nano antibody in a large number
Footpath.
The foundation of embodiment 4 non-competitive elisa assay DON curve based on phage display nano antibody
With PBS (pH 7.4), anti-DON monoclonal antibody it is diluted to 10 μ g/mL and adds in ELISA Plate hole, 100 μ L/ holes,
4 DEG C are coated overnight；Discarding and be coated liquid, wash 3 times with 0.05%PBST, add 3% skimmed milk of 300 μ L, 37 DEG C of closings 2 are little
Time；Abandon confining liquid, wash plate 3 times with 0.05%PBST, the DON standard substance of a series of variable concentrations of every hole addition, 100 μ L/ holes, 37
DEG C hatch 1 hour, form DON Ag-Ab immune complex；Abandon liquid in hole, after washing plate 3 times with 0.05%PBST, every hole
Put into 100 μ L and show the phage (1.0 × 10 having nano antibody9Cfu)/solubility expression nano antibody (10 μ g/mL), 37 DEG C
Hatch 1 hour；The anti-M13 phage two that adds 1:5000 dilution HRP labelling is anti-/ anti-histidine-tagged two resists, and 37 DEG C to hatch 1 little
Time.Then develop the color with tmb substrate, read OD450.With DON log concentration as abscissa, OD450For vertical coordinate, set up based on phagocytosis
Non-competitive elisa assay DON curve (Fig. 2) of body display nano antibody.Result shows, the nano antibody pair that elutriation obtains
DON antigen-antibody complex has combination activity and responsiveness.
Claims (3)
1. a nano antibody for resisting emesis Venom antigens-antibody immune complex, has the amino shown in SEQ ID NO.:1
Acid sequence.
2. a nucleic acid molecules, it is characterized in that encoding described in claim 1 aminoacid sequence.
The application of nano antibody the most according to claim 1, it is characterised in that recombinated by Phage amplification or genetic engineering
The mode expressed is prepared in a large number；Described Phage amplification refers to the phage that displaying has this nano antibody, by biology
The mode of amplification, amount reproduction produces shows the bacteriophage particles having this nano antibody；The side that described genetic engineering is recombinant expressed
Formula refers to the gene by encoding this nano antibody, by being cloned into expression vector, carries out this nanometer with the form of protein expression and resists
A large amount of preparations of body.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610512993.XA CN106084060B (en) | 2016-07-04 | 2016-07-04 | Emesis Venom antigens-antibody immune complex nano antibody and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610512993.XA CN106084060B (en) | 2016-07-04 | 2016-07-04 | Emesis Venom antigens-antibody immune complex nano antibody and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106084060A true CN106084060A (en) | 2016-11-09 |
| CN106084060B CN106084060B (en) | 2019-06-18 |
Family
ID=57211940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610512993.XA Active CN106084060B (en) | 2016-07-04 | 2016-07-04 | Emesis Venom antigens-antibody immune complex nano antibody and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106084060B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762065A (en) * | 2019-01-25 | 2019-05-17 | 南昌大学 | For the single domain heavy chain antibody Nb72 of vibrio fluvialis |
| CN113637071A (en) * | 2021-09-17 | 2021-11-12 | 中国计量大学 | Nano antibody aiming at Cry3Bb protein and preparation and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104592389A (en) * | 2014-12-19 | 2015-05-06 | 南昌大学 | Nano antibody of anti-deoxynivalenol antibody |
-
2016
- 2016-07-04 CN CN201610512993.XA patent/CN106084060B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104592389A (en) * | 2014-12-19 | 2015-05-06 | 南昌大学 | Nano antibody of anti-deoxynivalenol antibody |
Non-Patent Citations (1)
| Title |
|---|
| 涂追 等: "抗DON单域重链抗体序列分析及三维建模与对接", 《江苏农业学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109762065A (en) * | 2019-01-25 | 2019-05-17 | 南昌大学 | For the single domain heavy chain antibody Nb72 of vibrio fluvialis |
| CN109762065B (en) * | 2019-01-25 | 2022-12-06 | 南昌大学 | Single-domain heavy chain antibody Nb72 for vibrio fluvialis |
| CN113637071A (en) * | 2021-09-17 | 2021-11-12 | 中国计量大学 | Nano antibody aiming at Cry3Bb protein and preparation and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106084060B (en) | 2019-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103497252B (en) | For the single domain heavy chain antibody L5-78 of Listeria monocytogenes | |
| CN103204937A (en) | Single-domain heavy chain antibody T10 aiming at immune globulin Fc segment | |
| CN105968204A (en) | Single-domain heavy chain antibody for anti-prostate specific membrane antigen | |
| CN111732664B (en) | Novel coronavirus recombinant protein, rabbit-human chimeric antibody, preparation method and application thereof | |
| CN105037544A (en) | AFP nanometer antibody A83 based on AFP antigen | |
| CN105793709B (en) | For using haptens and method of the antibody as the immunizing dose of reference antibody with reference to the haptens, and the device for the immunizing dose using the reference antibody | |
| CN105968201A (en) | Single-domain heavy-chain antibody aiming at prostate specific membrane antigen | |
| CN105699653A (en) | Ultra-sensitive superparamagnetic nano immunization microsphere and GP73 antigen detection method | |
| CN105242043B (en) | A kind of several species general ELISA kit of antidiastole mouth disease virus infection | |
| CN106084060A (en) | The nano antibody of resisting emesis Venom antigens antibody immune complex and application thereof | |
| CN105968203A (en) | Single-domain heavy chain antibody for anti-prostate specific membrane antigen extracellular region | |
| CN105037545A (en) | AFP nanometer antibody A80 based on AFP antigen | |
| CN105968205B (en) | A kind of nano antibody of anti-prostate-specific membrane antigen | |
| CN106008711B (en) | Specifically bind single domain heavy chain antibody and its application of vomitoxin Ag-Ab immune complex | |
| CN106117363A (en) | Can the nano antibody of specific binding vomitoxin antigenantibody complex and application thereof | |
| CN106084061A (en) | The single domain heavy chain antibody of resisting emesis Venom antigens antibody immune complex and application thereof | |
| CN106478777B (en) | Staphylococcus aureus FnBPA A albumen mimic epitope peptide, mimic epitope peptide combinations and its application with immune protective | |
| CN103497251B (en) | For the single domain heavy chain antibody L5-79 of Listeria monocytogenes | |
| CN105315346B (en) | Peptide molecule and its application of deoxynivalenol can be specifically bound | |
| CN104459127A (en) | Biocarrier and application of biocarrier in detection | |
| CN104311643A (en) | Nano antibody-based deoxynivalenol mimic antigen and application thereof | |
| CN101186644B (en) | H3 type flu virus hemagglutinin space conformation simulation antigen epitope and application thereof | |
| CN111763263A (en) | Preparation method and detection kit of clostridium difficile antigen and polyclonal antibody | |
| CN105396557A (en) | Affinity adsorption material based on nanometer antibody capable of specially recognizing aflatoxin | |
| Bengurić et al. | Phage displayed peptides and anti-idiotype antibodies recognised by a monoclonal antibody directed against a diagnostic antigen of Mycoplasma capricolum subsp. capripneumoniae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |