CN103451265A - Method for capturing single molecular template DNA by microporous array solid-liquid phase under action of electric field - Google Patents
Method for capturing single molecular template DNA by microporous array solid-liquid phase under action of electric field Download PDFInfo
- Publication number
- CN103451265A CN103451265A CN2012101754083A CN201210175408A CN103451265A CN 103451265 A CN103451265 A CN 103451265A CN 2012101754083 A CN2012101754083 A CN 2012101754083A CN 201210175408 A CN201210175408 A CN 201210175408A CN 103451265 A CN103451265 A CN 103451265A
- Authority
- CN
- China
- Prior art keywords
- dna
- dna fragment
- template dna
- template
- pcr amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for capturing a single molecular template DNA by a microporous array solid-liquid phase under action of an electric field. The method is characterized in that 1, a DNA electrochemical transducer having a microporous array is constructed, wherein a SiO2 insulating layer on a microporous side wall of the microporous array fixes a P1 joint DNA fragment by carboxyl coupling; 2, the tail end of a single chain of a template DNA is connected to a P1 joint complementary DNA fragment complementary with the P1 joint DNA fragment and PCR amplification of the template DNA is carried out; and 3, through the action of the electric field, the template DNA subjected to PCR amplification is fed into micropores and is subjected to complementary pairing connection with the P1 joint DNA fragment fixed to the side wall of the microporous array so that single molecular template DNA capture is finished. The method avoids the step of pouring water into oil to obtain a microcapsule reactor, avoids bead application and enrichment steps, reduces experiment reagents and an experiment cost, and realizes a micropore effective utilization rate of about 80%.
Description
Technical field
The invention belongs to the gene sequencing technical field, be specifically related to catch with the microwell array solid liquid phase under a kind of electric field action the method for unit molecule template DNA.
Background technology
High throughput sequencing technologies is the DNA sequencing technology that latest developments are got up.With respect to 96 road kapillary order-checkings of tradition order-checking, high-flux sequence is once tested and can be read hundreds of thousands of to several ten million bar sequences.Read length according to the platform difference from 25bp to 500bp.Different order-checking platforms, in once testing, can read the base data that 1G does not wait to 30G, and huge like this order-checking ability is that traditional sequenator can not be compared.And the core that realizes high-flux sequence is how in a system, to catch efficiently the unit molecule template, make it to form independently divided one by one microreactor.
Current capture technique mainly contains two kinds: liquid phase-microballon or magnetic bead-emulsion-based PCR (In-solution capture emulsion PCR) technology and biochip hybridization (Chip-hybridization capture) technology, and its concrete grammar comprises:
(1) hybrid capture method based on chip, in the method, at first genomic dna is interrupted, and then with the sequence capturing chip hybridization customized, what do not hybridize being washed off.The target group of enrichment are subsequently by wash-out amplification, then with the order-checking of high-flux sequence instrument.Several large advantage of this method: 1, orientation is caught genome target district (the current chip piece appointment genome area of the longest 5MB of catching; 2, data are reliable; 3, as long as you select the sequence capturing chip that the zone of wanting to catch will design and synthesize a customization, easy to use laborsaving.But this method randomness is very strong, can not guarantee that captive different DNA fragmentation ratio is with consistent in original solution, the requirement of genomic dna is many, inapplicable for rare precious genome, and its specificity is not as good as the in-solution method.
(2) basic procedure of the hybrid capture method based on in-solution is that genomic dna interrupts, and then selected sizeable library and RNA bait are hatched altogether and formed the RNA-DNA heterozygote in 24 hours, the more laggard performing PCR amplification of wash-out magnetic bead, is finally checked order.Several large advantage of this method: 1) splendid specificity: the sequence of reading up to 90% derives from RNA " bait " and catches, in it and the target sequence overlap fully surpass 50%; 2) outstanding homogeneity: to the genome larger sequence fragment, at least with acquisition sequence, overlap RNA over half " bait " and surpass 80%, even to the exon sequence of small segment, this numeral also surpasses 60%; 3) remarkable circulation ratio: the variance rate between 2 groups of technology revision tests is less than 10-5; 4) can accurately detect SNP.In sum, the specificity, accuracy, circulation ratio of the parallel target sequencing technologies of high-throughput based on the liquid phase sequence capturing and application prospect have widely been verified in the experimental result perfection.But, because bait used is RNA, so need very high operational requirement, reagent or utensil all need to use without the RNA enzyme.And operation steps is more numerous and diverse.
At present in the new-generation sequencing technology, tetra-sodium sequencing system and the SOLiD sequencing system of ABI and the Ion Torrent of the third generation as s-generation Roche, what use is in-Solution hybrid capture unit molecule, then carries out supernatant liquid PCR (emulsion PCR) and carries out clonal expansion.What the Solexa sequencing system of Illumina was used is that chip hybridization is caught.
The Ion Torrent sequencing system of the tetra-sodium sequencing system of Roche and Life Technologies comprises: 1) first genome is carried out to ultrasonication and be broken into short approximately 50-500bp fragment, then by two ends connection universal joint P1 and the P2 of fragment.2) select up to a million primer P1 of microballoon covalent attachment of suitable size on its surface, in-solution catches template DNA to a bead with microballoon, utilize the single template of emulsion pcr amplification, same template is increased on a microballoon to up to a million template clones.3) microballoon that carries template is carried out to enrichment.The microballoon that 4) will carry template joins the microwell array of instrument.The utilization ratio of micropore is 50% left and right like this because carry the microballoon of template have two kinds a kind of be the microballoon that carries single template; The microballoon of the single template of a kind of right and wrong, only have the microballoon of single template to meet the order-checking requirement.
The SOLiD sequencing system of ABI comprises: 1) at first carry out the physics fragmentation of genomic dna, form the DNA fragmentation of short approximately 50-200bp.2) by short DNA fragmentation two ends connection universal joint A and B.3) In-solution catches with the microballoon that is connected to the joint complementary DNA, accomplishes that a microballoon captures a single template DNA fragment as far as possible.The template that 4) will be connected with universal joint is increased (emulsion PCR) in emulsion system, makes same template increase into up to a million template clones on a microballoon.5), after 3 ' of the template dna molecule on microballon end is modified, microballoon is attached to surface of glass slide by 3 ' end covalency and carries out sequencing reaction.
The Solexa sequencing system of Illumina is at first genomic dna to be carried out to the fragmentation processing, reclaims fragment DNA(100-200bp) carry out the universal joint connection.Again it is treated as to the strand state, then by the strand primer base complementrity with chip surface, be fixed on chip, near random and another primer of the other end carries out complementation, form bridge architecture and carry out bridge-type amplification (bridge amplification), utilize this mode, after carrying out the amplification of about 30 circulations, each molecule can amplify more than 1000 times, also becomes mono-clonal DNA bunch.In follow-up sequencing reaction, four kinds of fluorescently-labeled dyestuffs check order while synthesizing, and in each circulation, fluorescently-labeled dNTP is reversible terminator, only allows to mix single base, and main is exactly because 3 ' C-terminal has the cutting position that can be identified.In synthetic process, the introducing of each base can walk abreast and discharge pyrophosphate salt, and can offer biological luminescent protein and luminous as energy.
The committed step of above-mentioned sequence measurement success is exactly after capturing single template molecule, carry out PCR (emulsion PCR) in the supernatant liquid formed at water-oil and reach the unit molecule clonal expansion, make a template molecule become nearly 1,000,000 with equimolecular molecular clustering.The method that the microresponse device of formation PCR is taked at present is to increase the ratio that a microballoon is caught a DNA single molecule after making template DNA be diluted to finite concentration, but this method is the highest, and to only have the microballon of 30% left and right be the microballon that contains single template clone, 70% microballon is arranged or do not have template in conjunction with or the single template clone of right and wrong.The greatest problem that this operation is encountered is how to guarantee that the site on a microballoon or chip only captures a single molecule, and how to guarantee between each microballoon to separate formation microreactor independently one by one in solution.And existing method is random operation, the success of experiment is with certain blindness and very large with experimenter's operating skill relation.And the step of emulsion-based PCR itself is just very loaded down with trivial details, needs very high operational requirement.The present invention therefore.
Summary of the invention
The object of the invention is to provide a kind of method of catching the unit molecule template under electric field action with the microwell array solid liquid phase, has solved unit molecule template in prior art and has defied capture, and formed the difficult problem of the microresponse device of PCR.
In order to solve these problems of the prior art, technical scheme provided by the invention is:
Catch the method for unit molecule template DNA under a kind of electric field action with the microwell array solid liquid phase, it is characterized in that said method comprising the steps of:
(1) build the DNA electrochemical sensor with microwell array, the SiO on the micropore sidewall of described microwell array
2insulation layer passes through fixedly P1 linker DNA fragment of carboxyl coupling;
(2) the strand end at template DNA is connected with the P1 joint complementary DNA fragment of matching with P1 linker DNA fragment complementation, and template DNA is carried out to pcr amplification;
(3) template DNA after pcr amplification is entered in micropore, with P1 linker DNA fragment on the sidewall that is fixed on microwell array, carry out complementary pairing to be connected by electric field action, complete catching of unit molecule template DNA.
Preferably, in described method steps (1), P1 linker DNA fragment has the continuous nucleotide sequence of SEQ No:1 ~ 3; P1 joint complementary DNA fragment has the continuous nucleotide sequence of SEQ No:4 ~ 6.
Preferably, in described method, another end of strand of template DNA also is connected with the P2 linker DNA fragment for the pcr amplification template DNA; Described P2 linker DNA fragment has the continuous nucleotide sequence of SEQ No:7 ~ 9.
Preferably, in described method, the pcr amplification of template DNA is to carry out before the microwell array stream that joins the DNA electrochemical sensor is indoor; Perhaps template DNA and PCR reaction system are together joined to the indoor pcr amplification that carries out of microwell array stream that microwell array that the template DNA with P1 joint complementary DNA fragment first joins the DNA electrochemical sensor flows indoor DNA electrochemical sensor.
Preferably, the PCR reaction system comprises PCR damping fluid, dNTPs, TaqDNA polysaccharase, template DNA and, as the P2 linker DNA fragment of pcr amplification primer, described PCR reaction system final concentration consists of in described method steps (3):
PCR damping fluid final concentration 1～10 *;
dNTPs 0.01～1.5mM；
The primer sequence final concentration is 0.01～2 μ M;
Template DNA 0.01～10ng/ μ L;
TaqDNA polysaccharase 0.01～1.0U/ μ L.
Preferably, the preparation method of described method steps (2) template DNA comprises the following steps:
1) will interrupt at random for the goal gene group of making template DNA rear employing the first primer and carry out pcr amplification for the first time; Described the first primer one end is connected with the P1 joint complementary DNA fragment of end mark vitamin H, and with the oligonucleotide single stranded sequence of the complementary combination of goal gene regional sequence;
2) use and to catch component the goal gene regional sequence carried out after unidirectional pcr amplification is for the first time caught; The described component of catching comprises avidin and the solid phase carrier of being combined with avidin, and described avidin combines with the vitamin H on goal gene regional sequence after described unidirectional pcr amplification for the first time;
3) use second the primer pair avidin in conjunction with after the goal gene regional sequence carry out unidirectional pcr amplification for the second time; Described the second primer one end is connected with P2 linker DNA fragment, and with the complementary combination of described goal gene regional sequence, and carry out the amplification opposite direction of pcr amplification with the first primer;
4) will be for the second time goal gene regional sequence after unidirectional pcr amplification remove the avidin biotin composite, obtain single-stranded DNA banks with P1 joint complementary DNA fragment and P2 linker DNA fragment as template DNA or form double-stranded template DNA.
Preferably, in described method, avidin is selected from white of an egg affinity element, streptavidin, yolk affinity element and class affinity element.
Preferably, in described method, solid phase carrier is magnetic microsphere.
Preferably, described in described method steps (1), the DNA electrochemical sensor comprises the CMOS substrate, on described CMOS substrate, deposits silicon nitride layer, on described silicon nitride layer, covers silicon dioxide insulating layer; Described silicon dioxide insulating layer is the microwell array with microvoid structure, SiO on described micropore sidewall
2insulation layer passes through fixedly P1 linker DNA fragment of carboxyl coupling.
Preferably, described method SiO
2the micropore sidewall of insulation layer adopts carbonylation process to carry out carboxylated processing, then makes amidized P1 linker DNA fragment and SiO
2the carboxyl of surface of insulating layer carries out the bonding coupling to be fixed; The reagent that carbonylation process adopts is succinic acid, and the temperature of carbonylation process is controlled at 75 ℃; Linked reaction be take the activating reagent that 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) is carboxyl.
P1 joint and P2 joint
P1 joint complementary DNA fragment in template DNA be with micropore in P1 linker DNA fragment be complementary pairing, be referred to as traditionally the P1 joint, after the P1 joint is splitted into to two strands, article one, be fixed in micropore, article one, with template DNA, be combined, can carry out complementary pairing like this, thereby realize catching of unit molecule template DNA.As an example, can be following a kind of matching method:
The continuous nucleotide sequence that 5 '-NH2-GAGGATCCAGAATTCTCGAGTT-3 ' is the P1 linker DNA fragment (the P1 linker DNA fragment after amination is processed) in micropore; And the continuous nucleotide sequence of a strand of template DNA is: 3 ' CTCCTAGGTCTTAAGAGCTCAA ... GACTCGCCCGACCGTTCCG-5 ' (the first strand); The nucleotides sequence of another strand is classified as:
5 ' GAGGATCCAGAATTCTCGAGTT.............GCCTTGCCAGCCCGCTCAG-3 ' (the second strand).Confirmable is the P1 joint complementary DNA fragment (3 '-CTCCTAGGTCTTAAGAGCTCAA) of the first strand and the P1 linker DNA fragment complementation in micropore.In the template DNA chain, have a strand be with micropore in the linker DNA fragment of planting be complementary, therefore require in the template DNA treating processes to need to prepare special template DNA the first strand can with micropore in the pairing of joint P1 linker DNA fragment.
Preferably, P1 linker DNA fragment is to be selected from following continuous nucleotide sequence:
Preferably, P1 joint complementary DNA fragment is to be selected from following continuous nucleotide sequence:
Preferably, P2 linker DNA fragment is to be selected from following continuous nucleotide sequence:
Preferably, P2 joint complementary DNA fragment is to be selected from following continuous nucleotide sequence:
Above the P1 joint sequence and the P2 joint sequence can be random coupling, as the joint at the two ends of template.It is complementary double-stranded that the P1 joint is actually, and these two complementary two strandss are taken apart, and a chain is fixing in micropore, and chain is at an end of template, and designing like this is the needs (complementary pairing) of catching for unicity.
Therefore, when actually operating, there is the template DNA of P1 and P2 joint at the two ends that only need prepare.Then template DNA and PCR Related Component (enzyme, dNTP, P2 primer, damping fluid) etc. is mixed, or first add template and add again the PCR Related Component.In the stream chamber that finally composition that mixes or template is joined to array, by electric field action, make template enter micropore, itself and P1 pairing can be completed.
The structure of DNA electrochemical sensor
The DNA electrochemical sensor comprises the CMOS substrate, on described CMOS substrate, deposits silicon nitride layer, on described silicon nitride layer, covers silicon dioxide insulating layer; Described silicon dioxide insulating layer is the microwell array with microvoid structure, SiO on described micropore sidewall
2insulation layer passes through fixedly P1 linker DNA fragment of carboxyl coupling.Preferably, the thickness of described silicon nitride layer is the 100-300 nanometer.Described SiO
2the thickness of insulation layer is the 1-10 micron.
Described DNA electrochemical sensor can be built as follows: (1) adopts low-pressure chemical vapor phase deposition method formation of deposits silicon nitride layer on the CMOS substrate, and according on the described silicon nitride layer of being arranged in of microwell array, covering positive photoresist, develop and dissolve the photoresist material exposed by positive glue, then adopt low-pressure chemical vapor phase deposition method growth SiO
2insulation layer; (2) carry out peeling off of positive photoresist, and expose the silicon nitride layer as substrate, on silicon nitride layer, form microvoid structure; (3) by SiO
2the micropore sidewall of insulation layer adopts carbonylation process to carry out carboxylated processing, then makes amidized P1 linker DNA fragment and SiO
2the carboxyl of surface of insulating layer carries out the bonding coupling and forms sensor.The reagent that wherein carbonylation process adopts is succinic acid, and the temperature of carbonylation process is controlled at 75 ℃.Wherein linked reaction be take the activating reagent that 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) is carboxyl.
The method that adopts low-pressure chemical vapor phase deposition method formation of deposits silicon nitride layer on the CMOS substrate in described method steps (1) be take dichloro-dihydro silicon and ammonia as reaction raw materials at pressure in 0.1 ~ 10 holder scope, deposit the acquisition silicon nitride layer under the condition that temperature is 700-800 ℃.The method that covers positive photoresist in described method steps (1) on described silicon nitride layer is the spin coating method.In described method steps (1), the conditions of exposure of positive photoresist is that light wavelength is 248nm, and light source is the argon fluoride LASER Light Source; Exposure dose is 100mJ/cm
2, after exposure, the positive glue developer for positive photoresist used that develops is Tetramethylammonium hydroxide, the equivalent concentration of described Tetramethylammonium hydroxide is 0.2-0.3.The reagent that in described method steps (3), carbonylation process adopts is succinic acid, and the temperature of carbonylation process is controlled at 75 ℃.Take the activating reagent that 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) is carboxyl in described method steps (3) in linked reaction.In described method steps (3), amidized P1 linker DNA fragment has the continuous nucleotide sequence of the SEQ No:1 that amination processes ~ 3.
Typically, amidized P1 linker DNA fragment sequence is selected from following any one:
This DNA electrochemical sensor structure is on the basis of MOSFET structure, builds 1,000,000 microwell arrays, and the structure of micropore is the three-decker of sandwich style, and in middle layer, carries out carboxylated.It can be prepared in accordance with the following steps: (1) uses the LPCVD(low-pressure chemical vapor phase deposition on the basis of CMOS) method grows the Si of one deck 100-300 nanometer
3n
4.(2) at Si
3n
4on will form micropore bottom part with positive photoresist, cover, to form the place growth SiO of micropore sidewall like that
2about 1-10 micron.(3) by UV-light, positive photoresist is peeled off, can be exposed like this Si of bottom
3n
4layer.(4) with carbonylation process by SiO
2carry out carboxylated (5) by amidized primer and SiO
2carboxyl carry out bonding.
The preparation of the template DNA of joint is carried at two ends
Concrete grammar can comprise the following steps:
(1) genome to be captured is interrupted at random to rear employing the first primer and carry out pcr amplification for the first time; Described the first primer one end is connected with the P1 joint complementary DNA fragment that is marked with vitamin H, and with the oligonucleotide single stranded sequence of the complementary combination of goal gene regional sequence to be captured;
(2) use and to catch component the goal gene regional sequence carried out after unidirectional pcr amplification is for the first time caught; The described component of catching comprises avidin and the solid phase carrier of being combined with avidin; Described avidin combines with the vitamin H on goal gene regional sequence after described unidirectional pcr amplification for the first time;
(3) use second the primer pair avidin in conjunction with after the goal gene regional sequence carry out unidirectional pcr amplification for the second time; Described the second primer one end is connected with P2 linker DNA fragment, and with the complementary combination of described goal gene regional sequence, and carry out the opposite direction of pcr amplification with the first primer;
(4) will be for the second time goal gene regional sequence after unidirectional pcr amplification remove the avidin biotin composite, obtain the single-stranded DNA banks of two ends linker DNA fragment, can be used as template DNA.
Preferably, in described method, solid phase carrier is microballoon.Preferably, in described method, solid phase carrier is magnetic microsphere.Preferably, the first primer described in described method is by P1 joint complementary DNA fragment, ACTG base group with for specific amplification goal gene target sequence, and the Auele Specific Primer of at least 15 continuous nucleotide sequences that contain goal gene is formed by connecting; Described the second primer is by P2 linker DNA fragment, ACTG base group with for specific amplification goal gene target sequence, and the Auele Specific Primer of at least 15 continuous nucleotide sequences that contain goal gene is formed by connecting.
Preferably, the first primer described in described method carries out a PCR reaction system of pcr amplification for the first time and comprises PCR damping fluid, dNTPs, MgCl
2, TaqDNA polysaccharase, goal gene regional sequence to be captured be as template DNA, a described PCR reaction system final concentration consists of:
PCR damping fluid final concentration 1～10 *;
dNTPs 0.01～1.5mM；
The primer sequence final concentration is 0.01～2 μ M;
Template DNA 0.01～10ng/ μ L;
TaqDNA polysaccharase 0.01～1.0U/ μ L;
MgCl
2final concentration is 0.5～5mM.
Preferably, the second primer described in described method carries out the 2nd PCR reaction system of pcr amplification for the second time and comprises PCR damping fluid, dNTPs, MgCl
2, TaqDNA polysaccharase, goal gene regional sequence to be captured be as template DNA, described the 2nd PCR reaction system final concentration consists of:
PCR damping fluid final concentration 1～10 *;
dNTPs 0.01～1.5mM；
The primer sequence final concentration is 0.01～2 μ M;
Template DNA 0.01～10ng/ μ L;
TaqDNA polysaccharase 0.01～1.0U/ μ L;
MgCl
2final concentration is 0.5～5mM.
Preferably, in described method steps (1), genome to be captured extracts from be selected from human or animal or microbial population.
The present invention's genome sample to be captured is from including but not limited to human or animal's blood tissues, its hetero-organization and excremental genome and transcribing group; Human or animal's oral cavity, skin and stomach microorganism species genome; Genome of microbial population etc. in the ecotopes such as soil, water, the woods, meadow.As example, as cast, pathology flesh tissue, the section of freezing pathology, the section of paraffin pathology of peripheral blood cells, peripheral blood serum or blood plasma, body fluid, cavity.
As shown in Figure 1, while carrying out template DNA, at first genome is interrupted at random with Ultrasonic Cell Disruptor; Single primer is added in broken genome and carries out unidirectional pcr amplification.Single primer is held with the linker DNA that is connected to vitamin H and is connected 5 ' by the DNA special primer; To carry the strand purpose sheet segment DNA of vitamin H (Bio-) is caught with Streptavidin MagneSphere; With Auele Specific Primer, the DNA caught is carried out to unidirectional pcr amplification for the second time; Remove the strand with vitamin H, obtain the single-stranded DNA banks (library DNA identical sequence molecule also can be the molecule of different series) of two ends with identical or different DNA joint.
As used herein, term " avidin " comprises white of an egg affinity element (Avidin, A), streptavidin (Streptavidin, SA), yolk affinity element and class affinity element etc.This term also comprises the avidin of wild-type, saltant type and derivative type.
As used herein, term " vitamin H " (biontin, B) is distributed widely in the animal and plant tissue, extracts molecular weight 244.31Kd the normal yolk higher from content and hepatic tissue.Biotin molecule has two ring texturees, and wherein the I ring is the imidazolone ring, is the main position of being combined with avidin; The II ring, for thiphene ring, has a valeric acid side chain on C2, its terminal carboxyl(group) is the macromolecular only structure of binding antibody and other biological, and after chemically modified, vitamin H can become the derivative with the various active group---the activation vitamin H.
As used herein, the general selection of term " solid phase carrier " can be in conjunction with as macro-molecular proteins such as avidin or Streptavidins; Must keep active after the biomacromolecule immobilization, and carry out for being conducive to sufficient reacting, preferably its active group orientating reaction solution.
The linker DNA fragment can connect into by the mode of pcr amplification the goal gene DNA fragmentation; The mode that also can connect by ligase enzyme connects into goal gene DNA.As, P1 joint complementary DNA fragment: 5 '-/BioTEG/GAGGATCCAGAATTCTCGAGTT-3 '; P2 linker DNA fragment: 5 '-CTCGAGAATTCTGGATCCTC-3 '.Catch primer and comprise the first primer and the second primer, form by the Auele Specific Primer (specific primer) of linker DNA fragment+ACTG base group+coordinate with genomic DNA fragment to be amplified.The structure of the first primer is P1 joint+ACTG+specific primer; The structure of the second primer is P2 joint+ACTG+specific primer; In two primers, Auele Specific Primer is according to the different genes that will catch and difference.
Described Auele Specific Primer (specific primer), for for specific amplification goal gene target sequence, at least 15 continuous nucleotide sequences that contain goal gene; As the Auele Specific Primer that carries out 1-5 exon of pcr amplification von Willebrand disease gene has the continuous nucleotide sequence of SEQ No:5 ~ 14.
To catch design of primers and become three parts: shank, middle portion and end part; Its each several part effect difference.Wherein middle portion is ACTG base group, and middle portion adds ACTG, its objective is in order to be corrected by these four known bases when order-checking starts; 4 base sequence arbitrary arrangements of ACTG.Auele Specific Primer requires to be designed to identical or close annealing temperature, so length is unfixing.Auele Specific Primer is designed according to the heterogeneic difference that will catch.
Joint and Auele Specific Primer are according to the general primer principle of design:
(1) length: 15-30bp, generally be not more than 38, otherwise the suitableeest elongating temperature of PCR can surpass the best use of temperature (74 degree) of Taq enzyme, thereby reduce the specificity of product.
(2) G ten C content: should be between 45% one 55%, the renaturation temperature in pcr amplification is generally that the Tm value of hanging down Tm value primer deducts 5-10 degree.
(3) randomness of base distribution: should avoid occurring continuously the single base more than 4.Especially should 3 ' not bring out now continuous G or the C that surpasses 3 at it, otherwise can make primer cause in G ten C enrichment sequence area mistakes.
(4) primer self: can not contain self complementary sequence, otherwise can form hair clip sample secondary structure.
(5) between primer: do not have between two primers more than complementation or the homology base of 4, not so can form primer dimer, especially should avoid the complementation of 3 ' end overlapping.
(6) specificity: should be less than 70% with the homology of non-specific amplification sequence, or be less than the complementary base of continuous 8.
(7) 3 ' of primer end: 3 ' end of primer affects the effect of extension of Taq enzyme to a great extent, and 3 ' end mispairing should not occur.3 ' end base of primer is preferably selected A, G, C, and avoids as much as possible selecting T, especially should avoid occurring continuously the T more than 2.
(8) avoid the secondary structure district of primer: the reason that some primer is invalid is the impact of primer iteron secondary structure.
Principle of work
P1 directly is fixed on the sidewall of micropore (the described method of the Chinese patent application that fixing method can adopt number of patent application to be 201210103139.X), the template DNA that carries P1 and P2 joint that then will prepare, carry the described method of Chinese patent application that the single-stranded DNA banks of P1 and P2 joint can adopt number of patent application to be 201210103311.1, then the enzyme used with carrying out PCR, the P2 joint is as the pcr amplification primer, dNTP and damping fluid mix the rear microwell array top that directly adds, utilization DNA profiling in this solution is electronegative, forming negative potential above the array chamber and forming positive electrode below the array chamber, increasing a template molecule enters a micropore template can be matched with the P1 primer.The effect by electric field in the chamber that becomes a mandarin that perhaps template first added first adds in micropore template, and template is carried out complementary pairing with the P1 primer be fixed on micropore, and then PCR involved enzyme, primer P2, dNTP and damping fluid are added to micropore.In the direct like this micropore of the order-checking at sequencing device, template is carried out to pcr amplification, each micropore is as the microresponse device of PCR, save the microballon application of emulsion-based PCR and the step of enrichment microballon, not only saved reagent but also reduced experimental procedure and the experimental implementation requirement.When being diluted to optimum concn, template have the micropore of nearly 80% left and right only to contain a template molecule.
The microwell array that template DNA in described method after pcr amplification and PCR reaction system together join the DNA electrochemical sensor flows indoor; It is indoor that the template DNA that perhaps has a P1 joint complementary DNA fragment first joins the microwell array stream of DNA electrochemical sensor, and on the sidewall of microwell array, P1 linker DNA fragment adds the PCR reaction system to carry out pcr amplification after catching template DNA again.
With respect to scheme of the prior art, advantage of the present invention is:
The catching method of unit molecule template DNA of the present invention has saved water filling and has formed the step of micro-capsule reactor to oil, and has reduced application and the enriching step of microballon, has saved and has tested reagent used and experimental cost, makes the effective rate of utilization of micropore reach 80% left and right.
The accompanying drawing explanation
Below in conjunction with drawings and Examples, the invention will be further described:
Fig. 1 catches the Method And Principle figure of unit molecule template with the microwell array solid liquid phase under embodiment of the present invention electric field action, wherein to flow to Inbound be the direction that template DNA and PCR reaction system enter to liquid, and microwell array flows the approach axis of indoor template DNA.
The preparation flow figure that Fig. 2 is the two ends template DNA that carries the linker DNA fragment.
Embodiment
Below in conjunction with specific embodiment, such scheme is described further.Should be understood that these embodiment are not limited to limit the scope of the invention for the present invention is described.The implementation condition adopted in embodiment can be done further adjustment according to the condition of concrete producer, and not marked implementation condition is generally the condition in normal experiment.
Embodiment 1
1, the template that P1 and P2 joint are carried in preparation
The human gene group DNA, initial amount 3g, be diluted to 30ng/ μ L with 1 * low TE Buffer.Adopt Covaris S2 ultrasonic apparatus to carry out ultrasonic fragmentation, press the value of standard setting Covaris system, 6 circulation * 60s, bath temperature: 5 ℃, dutycycle: 20%, intensity: 5, pattern: Frequency sweeping.Get the Soniprep 150 ultrasonic apparatus fragmentations for same sample of equal-volume and concentration, parameter adopts default setting.Get fragmentation DNA 1 μ L, quantitative with Qubit Flurometer (Invitrogen), 2% agarose gel electrophoresis.
Get respectively DNA, 8 μ L dNTPs, 2 μ L End Polishing enzyme I (10U/ μ L, Agilent), the 16 μ L End Polishing enzyme II (5U/ μ L, Agilent) of 100 μ L fragmentations, add water to cumulative volume 200 μ L.Hatch 30min for 25 ℃.With axygen PCR purification kit purify DNA.Joint 1 (P1 5 '-CCTCTCTATGGGCAGTCGGTGAT-3 ') 50 μ mol/L and joint 2 (P25 '-CCATCTCATCCCTGCGTGTCTCCGACTCAG) each 26 μ L of 50 μ mol/L, the DNA 48 μ L of end-filling, T4DNA ligase enzyme 10 μ L (50U), add water to cumulative volume 200 μ L, incubated at room 15min.Product purification.
Adopt prefabricated 2%Size Select glue.DNA fragmentation after the connection purifying divides 3 parts of each 20 μ L to add the loading hole, the 50bp ladder of 0.2 μ g for the molecular weight contrast, no sample hole and recovery holes are filled up with 20 μ L, 25 μ L water respectively, the about 12min of electrophoresis, and sucking-off enters the DNA fragmentation between the 50-500bp of sample recovery holes.
2, template is mixed with the PCR composition:
Cumulative volume can suitably be amplified to 200 μ L according to ratio, and the number ratio of the number of the template molecule in system and micropore is approximately between 0.1-10:1.
3, added electric field between convection chamber top and micropore
The micropore bottom is added to positive voltage, at the top of stream chamber, add negative voltage, thereby produce electric field.The size of voltage is between 100mV-200mV.When the solution that contains template joins in the stream chamber with liquid-transfering gun, during the liquid-transfering gun liquid feeding, the rifle head will keep vertically and as far as possible avoiding adding bubble.Because so template can enter in micropore when template is passed through micropore with negative charge, with the P1 primer pairing combination in micropore.At first be by the full whole stream of template solution stream chamber, template is uniformly distributed in the stream chamber, because the space size that the height of stream chamber is 10-300 μ m, with respect to micropore height 1-5 μ m, its space is very large, therefore stream full solution afterwards in whole stream chamber stops flowing, after template is evenly distributed, add the voltage of 100-200mV, template can enter micropore uniformly, if it is suitable to dilute, it is single enters porosity and has reached 80%.
The preparation that embodiment carries the template DNA of linker DNA fragment in 2 two ends
One, the extraction of genomic dna and purifying
1, add 400 μ l Lysis Solution and 20 μ l Proteinase K solution in 200 μ l whole bloods, mix and obtain the homogeneous suspension.
2, hatch 10min in 56 ℃ of water-baths.
3, add 200 μ l dehydrated alcohols and mix.
4, the cleavage mixture of preparation is transferred to Gene JET Genomic DNA Purification Column.The centrifugal 1min of 6000g, discard waste liquid.Gene JET Genomic DNA Purification Column is transferred to the collection tube that 2ml is new.
5, add 500 μ l Wash buffer I, after the centrifugal 1min of 8000g discards waste liquid, purification column is put back to collection tube.
6, add 500 μ l Wash buffer II to Gene JET Genomic DNA Purification Column, the centrifugal 3min of 12000g.
7, by the centrifugal 1min of the sub-12000g of void column.
8, Gene JET Genomic DNA Purification Column transfers to the EP pipe of new 1.5ml.
9, add the distilled water of 100 μ l or the Elution buffer center to Gene JET Genomic DNA Purification Column, incubated at room 2min, the centrifugal 1min of 8000g.
10, discard purification column, the DNA of purifying or immediately for downstream experiment or be stored in-20 ℃.
Two, genomic dna purity detecting (Nanodrop)
1, double-click the Nanodrop icon on computer screen, start software.
2, select required measurement pattern, can eject the prompting of initialize instrument on screen. toward the distilled water that adds 2 microlitres in the well of instrument, the upper cover that closes makes to form fluid column, then clicks and determines with the beginning initialize, can hear the sound of magnetic valve folding.
3, after five or six seconds, the information on screen disappears, and means that initialize completes. and with lens wiping paper, distilled water is wiped clean, added the Buffer of 2-3 microlitre, upper cover click Blank. closes
4, after Blank completes, with lens wiping paper, Buffer is wiped clean and can start loading, click Measure and start to measure.
Three, the fragmentation of genomic dna (fragmentization)
Genome DNA sample obtains from different sources, from the bacterium to the Mammals.When the nanodrop of OD260/280 detected value at 1.8-2.0, the about 0.3 μ g/ μ l of concentration.The power setting of Ultrasonic Cell Disruptor is become to 200W, broken 5 seconds, stop broken number of times 200 times 5 seconds.
Four, design of primers
Joint A:5 '-/BioTEG/GAGGATCCAGAATTCTCGAGTT-3 ';
Joint B:5 '-CTCGAGAATTCTGGATCCTC-3 '.
Five, unidirectional PCR reaction for the first time
Reaction system is as follows:
Temperature of reaction:
Six, product purification
Product is purified with the PCR purification kit
The bin ding buffer that test kit is provided directly adds reaction tubes to stop the extension of 72 ℃, in order to prevent the nonspecific reaction after solution cools off, occurs.Product is eluted in the elutriant of 30 μ l.
Seven, magnetic capture
(1) get 25 μ l M-270 Streptavidin MagneSpheres, by 500 μ l 2 * Binding and wash buffer washed twice, then use 25 μ l 2 * Binding and wash buffer resuspended.
(2) primer extension product of getting 25 μ l purifying joins in Streptavidin MagneSphere.
(3) at ambient temperature, vibrations mix 30min to mixture, so that magnetic bead can be good at the heteroduplex in conjunction with biotinylated primer extension thing and DNA profiling.
(4) product is transferred to the centrifuge tube of new 1.5ml, with 500 μ l 1 * Binding and wash buffer washing 5 times.
Eight, primer extension reaction for the second time
Reaction system is as follows:
Temperature of reaction:
Nine, the acquisition of strand target dna
(1) magnetic bead is resuspended in 500 μ l hot wash buffer (1 * PCR buffer, 2.5mM MgCl2,0.1%Tween-20(v/v)), and above-mentioned solution is transferred to new 1.5ml EP pipe.
(2) mixture is hatched 2min in 65 ℃ of constant-temperature metal baths (or higher than 5 ℃ of Tm values of capture primer) concussion, and the EP pipe is on the magnet collector time, rapidly supernatant liquor is removed clean, in case cooling.(this step is to remove those that do not extend and background fragments capture primer non-specific binding)
(3) precipitation is resuspended in to the EB buffer of 30 μ l, it is transferred to the EP pipe (this step contributes to reduce carrying of non-specific library fragment) of new 1.5ml.Hatch 3min for 95 ℃ on the PCR instrument, and remove supernatant on MPC (Magnetic particle collector), carefully stay magnetic bead.
Form template DNA by the strand target dna, as shown in Figure 2, A is the P1 joint to process, and B is the P2 joint.
Embodiment 3DNA electrochemical sensor prepares example
One, the Si that grows on the CMOS structure
3n
4
Can obtain with LPCVD (low-pressure chemical vapor phase deposition) Si that good covering power and high homogeneity are just arranged
3n
4film.In decompression and temperature under the condition of 700-800 ℃, use dichloro-dihydro silicon (SiCl
2h
2) and ammonia (NH
3) LPCVD deposit making Si
3n
4.Reaction equation is as follows:
3 SiCl
2h
2(gaseous state)+4NH
3→ Si
3n
4(solid-state)+6HCl (gaseous state)+6H
2(gaseous state);
Form the silicon nitride layer of thick about 100-300nm.
Two, use the spin coating method at Si
3n
4upper berth one deck positivity chemistry amplifies deep ultraviolet light-sensitive lacquer (CADUV glue)
(1) drip glue.When silicon chip is static or rotation very slowly the time, photoresist material minute is dropped on silicon chip.
(2) rotation spreads out.The high rotating speed (rpm) that rotates to that accelerates fast silicon chip makes photoresist material be stretched over whole silicon chip surface.The thickness of photoresist material is proportional to 1/ (RPM)
1/2.
(3) rotation is got rid of.Get rid of unnecessary photoresist material, obtain uniform photoresist material glued membrane tectum on silicon chip.
(4) solvent evaporates.Continue the silicon chip of rotation one gluing with fixed rotating speed, until solvent evaporates, the photoresist material glued membrane is almost dry.
Three, the exposure of photoresist material and development
In exposure process, the light sent from light source is by the mask of aiming at.On version, opaque and transparent region is arranged, these zones have formed the figure that will transfer to silicon chip surface.The purpose of exposure is exactly to be copied into accurately the final image on photoresist material to figure on version.Light wavelength used is 248nm, and light source is argon fluoride (ArF) LASER Light Source.Exposure dose is 100mJ/cm
2.
Thereby positive glue develops, the chemical reaction comprised between developing solution and photoresist material dissolves the photoresist material exposed.Developer for positive photoresist used is Tetramethylammonium hydroxide (TMAH).When the equivalent concentration of TMAH developing solution is 0.2-0.3, selectivity ratios is better and make the photoresist material contrast gradient high.The tensio-active agent of ppm is added in the TMAH developing solution usually, has reduced any residual of photoresist material surface.The cleaning of TMAH developing solution only needs deionization (DI) water.
Four, SiO
2growth
Adopt the LPCVD method to prepare SiO
2way be under low pressure 650-750 ℃, thermolysis TEOS, can add O
2.Because gas molecule is fast in surperficial velocity of diffusion, this method can be made the SiO of excellent in uniformity
2.Carry (for example, with N by current-carrying gas bubbling mode usually in liquid TEOS source
2, O
2perhaps He).Liquid source is heated by the independently temperature source of himself.The concentration that enters the liquid source of reactor is subject to the control of speed and the liquid source temperature of current-carrying gas.Also can adopt at a lower temperature the method LPCVD deposit SiO of (approximately 450 ℃) silicyl oxide
2.
Five, photoresist material peels off
Remove photoresist and react in plasma environment and remove photoresist material by Sauerstoffatom and photoresist material.Atomic oxygen (O) produces by microwave or RF Energy Decomposition oxygen molecule.Usually add N
2or H
2improve and remove photoresist performance and strengthen the removal to residual polyalcohol.Thereby that typical resist remover gas use is O
2/ N
2.Because the basal component of photoresist material is hydrocarbon polymer.Sauerstoffatom reacts with photoresist material very soon and generates the main resultant such as volatile carbon monoxide, carbonic acid gas and water.These resultants are taken away by vacuum system.
Six, micropore sidewall SiO
2carboxylated
Get the acetonitrile of 50ml in beaker, then get the 3g succinic acid, join in the flask that fills the 50ml acetonitrile, continuously stirring, reflux to 60 ℃, until succinic acid dissolves fully.Under vacuum condition, the solution in beaker is poured in microwell array, reflux and be warming up to 75 ℃, the concussion insulation is 24 hours continuously.Product is cooled to 65 ℃, after hot suction filtration, the mixed solution centrifuge washing of use dehydrated alcohol and deionized water 3 times, 120 ℃ of vacuum-dryings, obtain carboxylated SiO
2.
Seven, the coupling of DNA probe and carboxyl
Under 10mg/mL 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) exists, 5 '-NH2 end DNA probe (synthetic by Jin Sirui) 0.5 μ M and micropore surface carboxyl generation linked reaction, make DNA probe carry out combination by chemical bond at micropore surface.Coupling method is to add 100 μ L0.1mol/L 2-morpholino ethylsulfonic acid (MES pH 4.6) buffered soln, appropriate DNA probe solution and 3.6 μ L 10mg/mL newly to prepare the EDC aqueous solution, in the dark uses impeller reaction 1h after whirlpool mixes.Then every 0.5h adds the EDC aqueous solution of the new preparation of 1.8 μ L 100mg/mL.Reaction total time is 2h.Finish to add 1.00mL 0.02%Tween 20 after reaction, mix rear centrifugal settling, discard supernatant liquid (to there is no fluorescently-labeled DNA probe).Add again 1.00mL 0.1%SDS solution washing micropore and discard centrifugal clear liquid, 4 ℃ of storages.
5 '-NH wherein
2the continuous nucleotide sequence of end DNA probe (synthetic by Jin Sirui) is selected from: 5 '-NH
2-GAGGATCCAGAATTCTCGAGTT-3 '; Or 5 '-NH
2-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3 '; Or 5 '-NH
2-CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT-3 '
Above-mentioned example is only explanation technical conceive of the present invention and characteristics, and its purpose is to allow the person skilled in the art can understand content of the present invention and implement according to this, can not limit the scope of the invention with this.All equivalent transformations that spirit is done according to the present invention or modification, within all should being encompassed in protection scope of the present invention.
Claims (10)
1. catch the method for unit molecule template DNA under an electric field action with the microwell array solid liquid phase, it is characterized in that said method comprising the steps of:
(1) build the DNA electrochemical sensor with microwell array, the SiO on the micropore sidewall of described microwell array
2insulation layer passes through fixedly P1 linker DNA fragment of carboxyl coupling;
(2) the strand end at template DNA is connected with the P1 joint complementary DNA fragment of matching with P1 linker DNA fragment complementation, and template DNA is carried out to pcr amplification;
(3) template DNA after pcr amplification is entered in micropore, with P1 linker DNA fragment on the sidewall that is fixed on microwell array, carry out complementary pairing to be connected by electric field action, complete catching of unit molecule template DNA.
2. method according to claim 1, is characterized in that in described method steps (1), P1 linker DNA fragment has the continuous nucleotide sequence of SEQ No:1 ~ 3; P1 joint complementary DNA fragment has the continuous nucleotide sequence of SEQ No:4 ~ 6.
3. method according to claim 1, is characterized in that another end of strand of template DNA in described method also is connected with the P2 linker DNA fragment for the pcr amplification template DNA; Described P2 linker DNA fragment has the continuous nucleotide sequence of SEQ No:7 ~ 9.
4. method according to claim 3, the pcr amplification that it is characterized in that template DNA in described method is to carry out before the microwell array stream that joins the DNA electrochemical sensor is indoor; Perhaps template DNA and PCR reaction system are together joined to the indoor pcr amplification that carries out of microwell array stream that microwell array that the template DNA with P1 joint complementary DNA fragment first joins the DNA electrochemical sensor flows indoor DNA electrochemical sensor.
5. method according to claim 3, it is characterized in that PCR reaction system in described method steps (3) comprises PCR damping fluid, dNTPs, TaqDNA polysaccharase, template DNA and, as the P2 linker DNA fragment of pcr amplification primer, described PCR reaction system final concentration consists of:
PCR damping fluid final concentration 1～10 *;
dNTPs 0.01～1.5mM；
The primer sequence final concentration is 0.01～2 μ M;
Template DNA 0.01～10ng/ μ L;
TaqDNA polysaccharase 0.01～1.0U/ μ L.
6. method according to claim 3 is characterized in that the preparation method of described method steps (2) template DNA comprises the following steps:
1) will interrupt at random for the goal gene group of making template DNA rear employing the first primer and carry out pcr amplification for the first time; Described the first primer one end is connected with the P1 joint complementary DNA fragment of end mark vitamin H, and with the oligonucleotide single stranded sequence of the complementary combination of goal gene regional sequence;
2) use and to catch component the goal gene regional sequence carried out after unidirectional pcr amplification is for the first time caught; The described component of catching comprises avidin and the solid phase carrier of being combined with avidin, and described avidin combines with the vitamin H on goal gene regional sequence after described unidirectional pcr amplification for the first time;
3) use second the primer pair avidin in conjunction with after the goal gene regional sequence carry out unidirectional pcr amplification for the second time; Described the second primer one end is connected with P2 linker DNA fragment, and with the complementary combination of described goal gene regional sequence, and carry out the amplification opposite direction of pcr amplification with the first primer;
4) will be for the second time goal gene regional sequence after unidirectional pcr amplification remove the avidin biotin composite, obtain single-stranded DNA banks with P1 joint complementary DNA fragment and P2 linker DNA fragment as template DNA or form double-stranded template DNA.
7. method according to claim 6, is characterized in that in described method, avidin is selected from white of an egg affinity element, streptavidin, yolk affinity element and class affinity element.
8. method according to claim 6, is characterized in that in described method, solid phase carrier is magnetic microsphere.
9. method according to claim 1, is characterized in that described in described method steps (1), the DNA electrochemical sensor comprises the CMOS substrate, on described CMOS substrate, deposits silicon nitride layer, on described silicon nitride layer, covers silicon dioxide insulating layer; Described silicon dioxide insulating layer is the microwell array with microvoid structure, SiO on described micropore sidewall
2insulation layer passes through fixedly P1 linker DNA fragment of carboxyl coupling.
10. method according to claim 9, is characterized in that described method SiO
2the micropore sidewall of insulation layer adopts carbonylation process to carry out carboxylated processing, then makes amidized P1 linker DNA fragment and SiO
2the carboxyl of surface of insulating layer carries out the bonding coupling to be fixed; The reagent that carbonylation process adopts is succinic acid, and the temperature of carbonylation process is controlled at 75 ℃; Linked reaction be take the activating reagent that 1-ethyl-3-(3-dimethyl aminopropyl)-carbodiimide (EDC) is carboxyl.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101754083A CN103451265A (en) | 2012-05-31 | 2012-05-31 | Method for capturing single molecular template DNA by microporous array solid-liquid phase under action of electric field |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101754083A CN103451265A (en) | 2012-05-31 | 2012-05-31 | Method for capturing single molecular template DNA by microporous array solid-liquid phase under action of electric field |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103451265A true CN103451265A (en) | 2013-12-18 |
Family
ID=49734101
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101754083A Pending CN103451265A (en) | 2012-05-31 | 2012-05-31 | Method for capturing single molecular template DNA by microporous array solid-liquid phase under action of electric field |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103451265A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107002140A (en) * | 2014-09-26 | 2017-08-01 | 双孔人公司 | The target sequence detected by the nanoaperture of synthesising probing needle is detected |
| CN113262730A (en) * | 2021-03-29 | 2021-08-17 | 上海迪赢生物科技有限公司 | High-throughput automatic gene synthesis device based on cluster array |
| US11435338B2 (en) | 2016-10-24 | 2022-09-06 | Ontera Inc. | Fractional abundance of polynucleotide sequences in a sample |
| US11486873B2 (en) | 2016-03-31 | 2022-11-01 | Ontera Inc. | Multipore determination of fractional abundance of polynucleotide sequences in a sample |
-
2012
- 2012-05-31 CN CN2012101754083A patent/CN103451265A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| ANRAN GAO ET AL.: "Silicon-nanowire-based CMOS-compatible field-effect transistor nanosensors for ultrasensitive electrical detection of nucleic acids", 《NANO LETTERS》 * |
| YANG-KYU CHOI ET AL.: "Sub-Lithographic Patterning Technology for Nanowire Model Catalysts and DNA Label-Free Hybridization Detection", 《PROCEEDINGS OF SPIE》 * |
| 刘博等: "应用于染色体步移的PCR扩增技术的研究进展", 《遗传》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107002140A (en) * | 2014-09-26 | 2017-08-01 | 双孔人公司 | The target sequence detected by the nanoaperture of synthesising probing needle is detected |
| US11486873B2 (en) | 2016-03-31 | 2022-11-01 | Ontera Inc. | Multipore determination of fractional abundance of polynucleotide sequences in a sample |
| US11435338B2 (en) | 2016-10-24 | 2022-09-06 | Ontera Inc. | Fractional abundance of polynucleotide sequences in a sample |
| CN113262730A (en) * | 2021-03-29 | 2021-08-17 | 上海迪赢生物科技有限公司 | High-throughput automatic gene synthesis device based on cluster array |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sun et al. | Principles and innovative technologies for decrypting noncoding RNAs: from discovery and functional prediction to clinical application | |
| CN105358709B (en) | System and method for detecting genome copy numbers variation | |
| CN107257862B (en) | Sequencing from multiple primers to increase data rate and density | |
| JP2005514005A5 (en) | ||
| EP2250288A2 (en) | System and method for improved processing of nucleic acids for production of sequencable libraries | |
| WO2001092572A1 (en) | Kit and method for determining hla type | |
| JP2008532477A5 (en) | ||
| CN105734679B (en) | Nucleic acid target sequence captures the preparation method of sequencing library | |
| JP6479759B2 (en) | Nucleic acid amplification method on solid support | |
| JP2001501470A (en) | Use of modular oligonucleotides as probes or primers in nucleic acid based assays | |
| CN107893100A (en) | A kind of unicellular mRNA reverse transcriptions and the method for amplification | |
| CN110914449A (en) | Construction of sequencing libraries | |
| WO2016038670A1 (en) | Cell analysis system and cell analysis method using same | |
| JP2015516814A (en) | Enrichment and sequencing of targeted DNA | |
| CN104232802B (en) | Detect the test kit of avian infectious laryngotracheitis virus, newcastle disease virus and avian infectious bronchitis virus | |
| CN103451265A (en) | Method for capturing single molecular template DNA by microporous array solid-liquid phase under action of electric field | |
| EP3292217B1 (en) | Formation of hairpins in situ using force-induced strand invasion | |
| CN104789687A (en) | Probe preparation method for multi-gene capture sequencing | |
| JP2016512437A (en) | Multiple methylation specific amplification systems and methods | |
| CN114958997A (en) | Method for detecting chaperone gene | |
| WO2020227953A1 (en) | Single-channel sequencing method based on self-luminescence | |
| JP2006514826A (en) | Lab-on-a-chip system for analyzing nucleic acids | |
| CN103276099B (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN110157808A (en) | A kind of application of non-coding RNA relevant to larynx squamous carcinoma occurrence and development | |
| JP2022513574A (en) | How to sequence a polynucleotide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: ZHANG YINGPIN Free format text: FORMER OWNER: KAIJING BIOLOGICAL TECHNOLOGY (SUZHOU) CO., LTD. Effective date: 20140114 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 215123 SUZHOU, JIANGSU PROVINCE TO: 650200 KUNMING, YUNNAN PROVINCE |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20140114 Address after: 650200, No. 2, unit 5, 31 Tung Wan, Guandu District, Yunnan, Kunming Applicant after: Zhang Yingpin Address before: Linquan Street Industrial Park of Suzhou city in Jiangsu province 215123 No. 399 southeast Hospital No. 1 503 Applicant before: Kaijing Biological Technology (Suzhou) Co., Ltd. |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131218 |