CN103436634A - Primers for detecting odontoglossum ringspot viruses as well as kit and detection method - Google Patents
Primers for detecting odontoglossum ringspot viruses as well as kit and detection method Download PDFInfo
- Publication number
- CN103436634A CN103436634A CN2013103446842A CN201310344684A CN103436634A CN 103436634 A CN103436634 A CN 103436634A CN 2013103446842 A CN2013103446842 A CN 2013103446842A CN 201310344684 A CN201310344684 A CN 201310344684A CN 103436634 A CN103436634 A CN 103436634A
- Authority
- CN
- China
- Prior art keywords
- magnetic bead
- primer
- solution
- nanometer magnetic
- inner primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primers for detecting odontoglossum ringspot viruses as well as a kit and a detection method, wherein the following primers are included: the forward direction outer primer F3: 5'-GGCTTATTTAAGCTCGGCT-3'; the reverse direction outer primer B3: 5'-ACGAGTATCAAAAGTACCCATT-3'; the forward inner primer FIP: 5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'; the reverse direction inner primer BIP: 5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'; the kit and the detection method comprise the primers; by using the primers and the detection method, the odontoglossum ringspot virus detection has the advantages of high speed, simplicity, convenience, efficiency, high accuracy, strong specificity and high sensitivity.
Description
Technical field
The present invention relates to a kind of primer for detection of odontoglossum ring spot virus, test kit and detection method, belong to biological technical field.
Background technology
Orchid is the flowers that are world known, deeply be subject to liking of the people of the world, China has hundreds of millions of orchid seedlings to pass in and out every year, yet because orchid is very easy to carry virus, particularly hold most portative gladiolus mosaic virus Cymbidium mosaic virus (CymMV) and odontoglossum ring spot virus Odontoglossum ringspot virus (ORSV), and detoxification is also very difficult at present, seriously restricted the restriction of the continuable sound development of China's orchid industry and external technology barriers, therefore, have the pass in and out quarantine of plant virus of practical reinforcement only, constantly research and develop new detection method, improve constantly the virus that the orchid seedling of passing in and out is carried and carry out high detectivity accurately, early viral plant is cleaned it out, can fundamentally guarantee a large amount of productions of nontoxic seedling, could further promote the development of China's orchid industry.
The diagnosis of the viroses of plant and cause of disease are identified, it is the basis of being familiar with virus disease, preventing and treating virus disease, it is also an important content of plant virus means of taxonomic research, the substance that plant virus detects comprises several aspects such as viral biological characteristics, morphological feature, physicochemical property, genome structure, antigenic characteristic, relates to the multiple means such as biology mensuration, determination of serology, Physiology and biochemistry mensuration, electron microscopy, Protocols in Molecular Biology.At present, the Main Means of the detection technique of China's entry and exit plant quarantine employing mainly: the on-the-spot quarantine in port, growth season Isolation Quarantine, plant indicator check, serologic test, molecular biology check.The subject matter that these means exist is: 1: sense cycle is long, does not meet the spirit of " speed speeds passenger flow " of State Council's proposition; 2: false positive reaction easily occurs; 3: the detection method very complicated is unfavorable for grass-roots unit's practical application; 4: main detection reagent or rule of origin are in offshore company, and not only purchase price is high, and the time of ordering is long, and these all can not adapt to the needs of China's rapid economic development.Therefore, set up new inspection and quarantine technique means fast and effectively extremely urgent.
To viral major technique detection method, be that Enzyme-linked Immunosorbent Assay (ELISA) detects and inverse transcription polymerase chain reaction (RT-PCR) detects at present.ELISA can be qualitative, the virus in the quantitative assay sample, is one of best means that realize current identifying virus.But, serological reaction must possess efficient antiserum(antisera), the serology detection is low to some viral levels in addition and sample that contain the interference measurement material can not be made mensuration accurately, false-positive result easily appears, and there is long problem detection time, can not meet the requirement of current port rapid detection; The RT-PCR technology is one of most widely used molecular biology new technology, utilizes the RT-PCR technology to compare the ELISA detection to viral detection and has highly sensitive characteristics, and detectable minimum viral level reaches the fg level.Constantly derive at present many new technology on the RT-PCR technical foundation, real-time fluorescence RT-PCR technology for example, biochip technology etc., its range of application is constantly enlarged, specificity and susceptibility also improve constantly, but there is the loaded down with trivial details and easy degraded of RNA extracting in these Protocols in Molecular Biologies, the PCR reaction easily is subject to the interference of polyphenol in the host, polysaccharide material, has limited quick, easy, the efficient detection of viral diseases of plants sample.
Nanometer biotechnology is theory and the method for using nanotechnology, on the basis of traditional biological and Modern Molecular Biotechnology, carries out biological study.Nanometer magnetic bead has significant application value in the compartment analysis of biological sample: (1) efficiently concentrating: the nanometer magnetic bead specific surface area is large, and significantly increasing reaction interface can the efficiently concentrating biological sample; (2) manipulative capability: nanometer magnetic bead has the superparamagnetic effect, and externally-applied magnetic field can be moved it fast and separate; (3) scalar nature: biomolecule labeling method is simple, reliable; (4) human-body safety: but to the nontoxic biological metabolism of human body, biodegradable, good biocompatibility.In a word, magnetic bio separates the superparamagnetism of magnetic carrier and the biologic specificity characteristics of affinity ligand of having concurrently, fast and convenient and the affine highly selective double dominant of separating that integrates magnetic resolution, separation and purification at nucleic acid, the enrichment of RNA, DNA molecular, the purifying of albumen, there is application the aspects such as separation of virus, cell.
About nanometer magnetic bead (magnetic nano particles, synthesizing MNP), start the research of Superparamagnetic Iron Oxide ultrafine particle abroad at the end of the eighties, bioseparation material based on nanometer magnetic bead has had market-oriented product abroad, nanometer magnetic bead detects and is applied at animal virus recently, the nanometer magnetic bead of antibody labeling is target acquisition virus from liquid phase, can detect in high sensitivity animal virus.
And the amplification of ring mediation nucleic acid isothermal is Loop-mediated isothermal amplification(LAMP) technology is the viral new detecting method just grown up recent years, for detecting, rapid gene provides a kind of new technological approaches, the feasibility that has there is successful Application, in food safety detection, epidemic virus, detect, clinical diagnosis, and application and the existing bibliographical information of research in the field such as aquaculture.It does not need expensive test set, only need an incubator to get final product, and its detection sensitivity is more taller than regular-PCR detection method, and is no more than one hour detection time, and result is directly estimated and got final product, and is particularly suitable for port one line and detects.
The reaction of ring matchmaker isothermal nucleic acid amplification utilizes 4 kinds of special primers to rely on a kind of high reactivity strand displacement archaeal dna polymerase to make strand displacement DNA synthesize in ceaselessly oneself's circulation, LAMP amplification minute two stages.
The 1st stage was that initial structure forms: when any one primer carries out the base pairing extension to the complementary portions of double-stranded DNA, another chain will dissociate, and becomes strand.At first the F2 sequence of the inner primers F IP in upstream is combined with template F2c, extends forward the startup strand displacement synthetic under the effect of strand displacement type archaeal dna polymerase.Outside primers F 3 is combined and extends with template F3c, displaces the complementary strand that complete FIP connects.F1c on the FIP Fl on strand therewith is complementary structure.Oneself's base pairing forms ring texture.Take this chain as template.Downstream primer BIP and B3 successively start and are similar to the synthetic of FIP and F3, form the strand of dumbbell shaped structure.Rapid Fl section of take the 3' end is starting point.With from as template, carry out the synthetic stem ring texture that extends to form of DNA.
The 2nd stage was the reaction amplification cycles: take the stem ring texture as template, FIP is combined with stem Huan F2c district.The begin chain displacement is synthetic, on the single-chain nucleic acid dissociateed, also can form ring texture.The B1 section of 3 ' end of take rapidly is starting point, with from as template.Carry out the synthetic extension of DNA and strand displacement. form the DNA of 2 new stem ring texturees different in size, the B2 on the BIP primer is hybrid with it.Start new round amplification.And product D NA length doubles.Add 2 Loop primer LF and LB in reaction system, they also are combined with the stem ring texture respectively, and to start strand displacement synthetic, goes round and begins again.The final product of amplification is the mixture with different number loop-stem structures, different lengths DNA.And the alternately inverted repeats that product D NA is the amplified target sequence.
The reaction of ring matchmaker isothermal nucleic acid amplification, be new ideas in biology field, and it can, under isothermal (60 ℃～65 ℃) condition, will only have the target nucleic acid of several copies to increase 10 in 30min～60min
9level.The one large characteristic of the method is to pass through byproduct of reaction---whether the generation of white magnesium pyrophosphate precipitation judges the existence of target gene.Due to six isolated areas of amplification procedure dependence identification target sequence of ring matchmaker isothermal nucleic acid amplification, so there are the characteristics such as high-level efficiency, high specific, hypersensitivity for the evaluation of microorganism.In addition, the amplification process of ring matchmaker isothermal nucleic acid amplification is to carry out under isothermal condition, ortho-water bath or have the equipment of stable thermal source just can meet to react requirement, testing cost is reduced greatly, PCR needs expensive PCR instrument to carry out the nucleic acid amplification of certain temperature procedure, thereby, ring matchmaker isothermal nucleic acid amplification than PCR to plant and instrument require low, testing cost is also lower, have more generalization, be expected as the conventional sense instrument.
Summary of the invention
The objective of the invention is in order to overcome weak point of the prior art, a kind of primer for detection of odontoglossum ring spot virus and the test kit that comprises this primer and detection method are provided, utilize that this primer and detection method detect that odontoglossum ring spot virus is quick, easy, efficient, accuracy is high, high specificity, susceptibility be high.
In order to achieve the above object, the present invention adopts following scheme:
A kind of primer for detection of odontoglossum ring spot virus is characterized in that:
Forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
A kind of test kit that detects odontoglossum ring spot virus is characterized in that this test kit includes:
Described primer comprises:
Forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
A kind of test kit that detects odontoglossum ring spot virus as above is characterized in that described reaction solution damping fluid 2X is composed of the following components:
A kind of test kit that detects odontoglossum ring spot virus as above, is characterized in that described enzyme solution is Bst archaeal dna polymerase and AMV reversed transcriptive enzyme mixed solution.
A kind of test kit that detects odontoglossum ring spot virus as above, is characterized in that described fluorescence dye contains fluorexon.
A kind of detection method of odontoglossum ring spot virus is characterized in that comprising the following steps:
A, employing nanometer magnetic bead extract the RNA of testing sample;
B, on ice, extract reaction solution in proportion damping fluid, primer, fluorescence dye, enzyme solution, positive control, deionized water and put into sterile tube and prepare premixed liquid;
C, the RNA of appropriate testing sample is added in the sterile tube in step B;
D, the test tube in step C is placed in thermostatted, under 63 ℃, keeps constant temperature 1 hour, then under 80 ℃, keep constant temperature to make enzyme-deactivating with termination reaction in 5 minutes;
E, use UV irradiation equipment are upwards irradiated from the test tube bottom, wear the ultraviolet protection glasses and see and look into from the test tube side, if the same with positive control, send green glow, be judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender;
Wherein said primer comprises:
Forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
The detection method of a kind of odontoglossum ring spot virus as above is characterized in that in steps A adopting nanometer magnetic bead to extract the concrete steps of testing sample RNA:
A, sample preparation: the band poison tissue of getting 0.1g adds the 1mL extraction buffer to be ground;
B, cleaning nanometer magnetic bead: take out immune nanometer magnetic bead in the PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, sucks ddH
2o;
C, combination: add the sample of 100 μ L in the PCR pipe, with the liquid-transfering gun suction, tell and mix sample and nanometer magnetic bead, adsorb under room temperature;
D, cleaning: remove supernatant under the effect of magnet, nanometer magnetic bead cleans 3 times;
E, cracking: add 50 μ L ddH
2o in the PCR pipe, after inhaling and to tell and mix nanometer magnetic bead with liquid-transfering gun, 95 ℃, 10min;
The f sampling: use the magnet adsorption nanometer magnetic bead, after solution clarification in the PCR pipe, supernatant is testing sample RNA.
The detection method of a kind of odontoglossum ring spot virus as above is characterized in that described immune nanometer magnetic bead makes by following technique:
1. the preparation of nanometer magnetic bead
Get respectively 5.2g FeCl
36H
2o, 2.7g FeSO
47H
2the concentrated hydrochloric acid of O, 0.85mL12.1moL/L is dissolved in 200mL water, ultrasonic deoxidation, after above solution is splashed into to 250mL, 0.75moL/L NaOH solution; Stir under 80 ℃, after reaction finishes, utilize magnetic separator that the gained precipitation is separated from reaction medium, then use washed with de-ionized water 3 times, dehydrated alcohol cleans 2 times, and is made into the Fe of 5g/mL
3o
4the magnetic nano-particle ethanol solution; Get 25mL Fe
3o
4the magnetic nano-particle ethanol solution, then be diluted to 150mL with dehydrated alcohol, sonic oscillation 30min; Drip 0.4mL APTES, under room temperature, stir 7h; React complete, Fe APTES modified with magnetic separator
3o
4magnetic nano-particle separates from reaction medium, and cleans 3 times with ethanol solution, finally is made into the amination Fe of 10.5mg/mL
3o
4the nanometer magnetic bead ethanol solution;
2. the preparation of immunomagnetic beads
Get 0.5mL amination Fe
3o
4the nanometer magnetic bead ethanol solution, clean 3 times with 1mL PBS, and magnetic separator is abandoned supernatant liquor; Add 5% (V/V) glutaraldehyde solution 2mL, the room temperature crosslinked 2h that vibrates, magnetic separates, and abandons supernatant liquor; After PBS washing 3 times abandoning supernatant liquor, adopt respectively the 0.5mL antiviral antibody to be coated with amination Fe
3o
4nanoparticle, fixedly 2h vibrates under room temperature; Magnetic separates, and washs respectively 3 times with PBS and ultrapure water, then uses the PBS constant volume, and 4 ℃ of Refrigerator stores are standby, obtain immunomagnetic beads.
The detection method of a kind of odontoglossum ring spot virus as above, the wavelength that it is characterized in that described UV irradiation equipment is 240-260nm, 350-370nm.
The detection method of a kind of odontoglossum ring spot virus as above is characterized in that described reaction solution damping fluid 2X is composed of the following components:
Described enzyme solution is Bst archaeal dna polymerase and AMV reversed transcriptive enzyme mixed solution; Described fluorescence dye contains fluorexon.
Some materials of using in the present invention:
1.1 strain
Gladiolus mosaic virus Cymbidium mosaic virus (CymMV) and odontoglossum ring spot virus Odontoglossum ringspot virus (ORSV) standard strain are purchased from U.S. AGDIA company.
1.2 main agents and consumptive material
(1) PCR reaction reagent: 10 * PCR buffer, dNTPs, MgCl2, Taq archaeal dna polymerase, precious biotechnology (Dalian) company limited;
(2) DNA Marker DL1000,6 * loading buffer, precious biotechnology (Dalian) company limited;
(3) LAMP reaction reagent;
(4) RNA amplification reaction reagent box Loopamp RNA Amplification kit,
bright Reported
fluorescence visual detection test kit,
fluorescence Detection Reagent,
bright Reported
reaction tube is all purchased in Peking blue spectrum bio tech ltd,
(5) Bst DNA polymerase large fragment, New England Biolabs company;
(6) trimethyl-glycine (Betaine), the good biological company limited of Guangzhou prestige;
DNTPs, MgCl2, precious biotechnology (Dalian) company limited;
(7) 50 * TAE damping fluids: 242g Tris and 37.2g Na2EDTA2H2O are dissolved in the 800mL deionized water, abundant stirring and dissolving, then add 57.lmL acetic acid, and stir, finally with deionized water, solution is settled to 1L, during use, dilution is 50 times;
(8) agarose, prompt doubly this biological company limited in Guangzhou;
(9) 70% ethanol;
(10) LAMP primer (forward outer primer F3, forward inner primer FIP, reverse inner primer BIP, reverse outer primer B3) and PCR primer (upstream primer, downstream primer), precious biotechnology (Dalian) company limited is synthetic;
(11) DNA extraction test kit (centrifugal column type), TIANGEN Biotech (Beijing) Co., Ltd..
(12) antiviral antibody single stage method RT-PCR test kit PrimeScriptTM One-Step Ver.2.0 is purchased from precious biotechnology (Dalian) company limited;
(13) nanometer magnetic bead (magnetic nano particles, MNP) test kit is purchased from Beijing Jenner Science and Technology Ltd.;
1.3 key instrument equipment
(1)-80 ℃ of deep freezers;
(2) the freezing desk centrifuge of Labofuge400R high speed;
(3) regular-PCR instrument and AB7500 quantitative real time PCR Instrument;
(4) French UVP gel imaging system;
(5) DYY-7 type electrophoresis apparatus, the biological Science and Technology Ltd. in Beijing 61;
(6) micropipet, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L;
(7) microwave oven;
(8) analytical balance, plum Teller-Tuo benefit Instrument Ltd.;
(9) autoclave sterilization pot;
(10) ultrapure water system, Milli-Q Academic, Millipore company;
(11) the Japanese Shimadzu UV-120-02 of company type visible-ultraviolet spectrophotometer;
(12) Bechtop;
(13) eddy mixer;
(14) enzyme connection detector.
(15) the real-time turbidimeter of LAMP, LA-320C, Japanese Rong Yan biotech firm;
(16) the BIOTEK enzyme joins the equipment such as detector.
Embodiment
Below in conjunction with embodiment, the present invention is described further:
Embodiment 1
Test kit of the present invention:
1. product specification: 45 times
2. characteristics:
Ring mediated isothermal amplification method (loop-mediated isothermal amplification, LAMP) be a kind of novel gene amplification method, only with a kind of enzyme, under constant temperature, increased, owing to using 4 primers can identifying 6 distinguished sequences of target DNA, so specificity is high, and amplification efficiency is very high, can increase in a large number in the short period of time, reaction result can be estimated judgement.
This test kit adopts the ring mediated isothermal amplification method, the simple and easy test kit that the Yeast Nucleic Acid (RNA) of take directly carries out the reverse transcription loop-mediated isothermal amplification as template, this test kit is used the enzyme solution that mixes reversed transcriptive enzyme and archaeal dna polymerase, only the reagent in testing sample and this test kit need be mixed as requested to being placed on (63 ℃) reaction regular hour at certain temperature and get final product (1 hour), can the naked eyes sight look into reaction result.
3. test kit component content:
1) .LAMP reaction solution damping fluid (0.6mL)
2). primer (250 μ L)
3). fluorescence dye (50 μ L)
4). enzyme solution (50 μ L)
5). positive control (50 μ L)
6). deionized water (1000 μ L)
4. working method:
1). the preparation of reagent:
A. get all ingredients of preserving under-20 ℃ and at room temperature thaw, be placed in immediately after thawing on ice and preserve;
B. the preparation of premixed liquid (carrying out on ice): get and detect required reacting weight, the premixed solution that is divided in respectively other preparation according to following table ratio (reaction) is prepared in the sterile tube of use:
Wherein:
Reaction buffer composition (2X):
Enzyme solution:
Bst archaeal dna polymerase and AMV reversed transcriptive enzyme mixed solution.
Fluorescence dye:
Contain fluorexon, initial with being combined with mn ion in the quenching of fluorescence state, carrying out along with the LAMP reaction, because thereby the byproduct of reaction pyrophosphate ion is captured the mn ion of being combined with fluorexon and is made fluorexon recover the free fluorescence that out sends, once, and the magnesium ion of fluorexon in reaction solution be combined, also can make fluorescence be enhanced.
Primer:
Odontoglossum ring spot virus ORSV LAMP amplification universal primer sequence: sequence direction 5 '-3 '
| F3 | GGCTTATTTAAGCTCGGCT |
| B3 | ACGAGTATCAAAAGTACCCATT |
| FIP（F1c＋F2） | AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG |
| BIP（B1c＋B2） | GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGAT |
| F2 | CCAATTCACTAATCAACCTTTG |
| F1c | AGCTTGTTGTGTTTGGAACTGA |
| B2 | GGATCTAATATAGGATCATAGCGAT |
| B1c | GCCGGTTCCTACTTTGACCAG |
C. flick after packing and hit test tube it is mixed, the instantaneous centrifugal several seconds makes solution concentrate on the test tube bottom;
2). application of sample: toward dividing the RNA5 μ L that adds respectively the detected sample prepared in the test tube installed, make total amount reach 25 μ L, the negative control reaction is used deionized water 5 μ L as sample, the positive control with this ORSV viral nucleic acid is used in the positive control reaction, then cover test tube cap and touch mixing, the instantaneous centrifugal reaction soln that makes concentrates on the test tube bottom;
3). amplification: test tube is placed in thermostatted, under 63 ℃, keeps constant temperature 1 hour, then under 80 ℃, keep constant temperature to make enzyme-deactivating with termination reaction in 5 minutes;
4). detect: use UV irradiation equipment (wavelength 240-260nm, 350-370nm) upwards to be irradiated from the test tube bottom, wear the ultraviolet protection glasses and see and look into from the test tube side.Send green glow if the same with positive control, be judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender.
Embodiment 2
The present invention detects the detection method of odontoglossum ring spot virus, comprises the following steps:
A, employing nanometer magnetic bead extract the RNA of testing sample;
Make immune nanometer magnetic bead by following technique:
1. the preparation of nanometer magnetic bead
Get respectively 5.2g FeCl
36H
2o, 2.7g FeSO
47H
2the concentrated hydrochloric acid of O, 0.85mL12.1moL/L is dissolved in 200mL water, ultrasonic deoxidation, after above solution is splashed into to 250mL, 0.75moL/L NaOH solution; Stir under 80 ℃, after reaction finishes, utilize magnetic separator that the gained precipitation is separated from reaction medium, then use washed with de-ionized water 3 times, dehydrated alcohol cleans 2 times, and is made into the Fe of 5g/mL
3o
4the magnetic nano-particle ethanol solution; Get 25mL Fe
3o
4the magnetic nano-particle ethanol solution, then be diluted to 150mL with dehydrated alcohol, sonic oscillation 30min; Drip 0.4mL APTES, under room temperature, stir 7h; React complete, Fe APTES modified with magnetic separator
3o
4magnetic nano-particle separates from reaction medium, and cleans 3 times with ethanol solution, finally is made into the amination Fe of 10.5mg/mL
3o
4the nanometer magnetic bead ethanol solution;
2. the preparation of immunomagnetic beads
Get 0.5mL amination Fe
3o
4the nanometer magnetic bead ethanol solution, clean 3 times with 1mL PBS, and magnetic separator is abandoned supernatant liquor; Add 5% (V/V) glutaraldehyde solution 2mL, the room temperature crosslinked 2h that vibrates, magnetic separates, and abandons supernatant liquor; After PBS washing 3 times abandoning supernatant liquor, adopt respectively the 0.5mL antiviral antibody to be coated with amination Fe
3o
4nanoparticle, fixedly 2h vibrates under room temperature; Magnetic separates, and washs respectively 3 times with PBS and ultrapure water, then uses the PBS constant volume, and 4 ℃ of Refrigerator stores are standby, obtain immunomagnetic beads.
Concrete extracting method:
A, sample preparation: the band poison tissue of getting 0.1g adds the 1mL extraction buffer to be ground;
B, cleaning nanometer magnetic bead: take out immune nanometer magnetic bead in the PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, sucks ddH
2o;
C, combination: add the sample of 100 μ L in the PCR pipe, with the liquid-transfering gun suction, tell and mix sample and nanometer magnetic bead, adsorb under room temperature;
D, cleaning: remove supernatant under the effect of magnet, nanometer magnetic bead cleans 3 times;
E, cracking: add 50 μ L ddH
2o in the PCR pipe, after inhaling and to tell and mix nanometer magnetic bead with liquid-transfering gun, 95 ℃, 10min;
The f sampling: use the magnet adsorption nanometer magnetic bead, after solution clarification in the PCR pipe, supernatant is testing sample RNA.
B, on ice, extract reaction solution damping fluid, primer, fluorescence dye, enzyme solution, positive control, deionized water in following ratio and put into sterile tube and prepare premixed liquid; Wherein premixed liquid primary first-order equation amount adds up to 20 μ L, comprising 12.5 μ L reaction buffers, and 1 μ L enzyme solution, 4 μ L primers, 1 μ L fluorescence dye, 1.5 μ L deionized waters.Wherein in 4 μ L primers, include 0.4 μ L forward outer primer F3, the reverse outer primer B3 of 0.4 μ L, 1.6 μ L forward inner primer FIP and the reverse inner primer BIP of μ L;
Wherein said forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
C, the RNA of appropriate testing sample is added in the sterile tube in step B; Concrete steps: toward dividing the RNA5 μ L that adds respectively the detected sample prepared in the test tube installed, make total amount reach 25 μ L, the negative control reaction is used deionized water 5 μ L as sample, the positive control with this CymMV viral nucleic acid is used in the positive control reaction, then cover test tube cap and touch mixing, the instantaneous centrifugal reaction soln that makes concentrates on the test tube bottom;
D, the test tube in step C is placed in thermostatted, under 63 ℃, keeps constant temperature 1 hour, then under 80 ℃, keep constant temperature to make enzyme-deactivating with termination reaction in 5 minutes;
E, use UV irradiation equipment are upwards irradiated from the test tube bottom, wear the ultraviolet protection glasses and see and look into from the test tube side, if the same with positive control, send green glow, be judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender; The wavelength of described UV irradiation equipment is 240-260nm, 350-370nm.
Claims (10)
1. the primer for detection of odontoglossum ring spot virus is characterized in that comprising:
Forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
2. a test kit that detects odontoglossum ring spot virus is characterized in that this test kit includes:
Described primer comprises:
Forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
3. a kind of test kit that detects odontoglossum ring spot virus according to claim 2 is characterized in that described reaction solution damping fluid 2X is composed of the following components:
4. according to the described a kind of test kit that detects odontoglossum ring spot virus of claim 2 or 3, it is characterized in that described enzyme solution is Bst archaeal dna polymerase and AMV reversed transcriptive enzyme mixed solution.
5. a kind of test kit that detects odontoglossum ring spot virus according to claim 4, is characterized in that described fluorescence dye contains fluorexon.
6. the detection method of an odontoglossum ring spot virus is characterized in that comprising the following steps:
A, employing nanometer magnetic bead extract the RNA of testing sample;
B, on ice, extract reaction solution in proportion damping fluid, primer, fluorescence dye, enzyme solution, positive control, deionized water and put into sterile tube and prepare premixed liquid;
C, the RNA of appropriate testing sample is added in the sterile tube in step B;
D, the test tube in step C is placed in thermostatted, under 63 ℃, keeps constant temperature 1 hour, then under 80 ℃, keep constant temperature to make enzyme-deactivating with termination reaction in 5 minutes;
E, use UV irradiation equipment are upwards irradiated from the test tube bottom, wear the ultraviolet protection glasses and see and look into from the test tube side, if the same with positive control, send green glow, be judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender;
Wherein said primer comprises:
Forward outer primer F3:5'-GGCTTATTTAAGCTCGGCT-3';
Reverse outer primer B3:5'-ACGAGTATCAAAAGTACCCATT-3';
Forward inner primer FIP and reverse inner primer BIP;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
5'-AGCTTGTTGTGTTTGGAACTGA-CCAATTCACTAATCAACCTTTG-3'；
F1c:5'-AGCTTGTTGTGTTTGGAACTGA-3' wherein;
F2：5'-CCAATTCACTAATCAACCTTTG-3'；
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
5'-GCCGGTTCCTACTTTGACCAG-GGATCTAATATAGGATCATAGCGA-3'；
B1c:5'-GCCGGTTCCTACTTTGACCAG-3' wherein;
B2:5'-GGATCTAATATAGGATCATAGCGAT-3'。
7. the detection method of a kind of odontoglossum ring spot virus according to claim 6 is characterized in that in steps A adopting nanometer magnetic bead to extract the concrete steps of testing sample RNA:
A, sample preparation: the band poison tissue of getting 0.1g adds the 1mL extraction buffer to be ground;
B, cleaning nanometer magnetic bead: take out immune nanometer magnetic bead in the PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, sucks ddH
2o;
C, combination: add the sample of 100 μ L in the PCR pipe, with the liquid-transfering gun suction, tell and mix sample and nanometer magnetic bead, adsorb under room temperature;
D, cleaning: remove supernatant under the effect of magnet, nanometer magnetic bead cleans 3 times;
E, cracking: add 50 μ L ddH
2o in the PCR pipe, after inhaling and to tell and mix nanometer magnetic bead with liquid-transfering gun, 95 ℃, 10min;
The f sampling: use the magnet adsorption nanometer magnetic bead, after solution clarification in the PCR pipe, supernatant is testing sample RNA.
8. the detection method of a kind of odontoglossum ring spot virus according to claim 7 is characterized in that described immune nanometer magnetic bead makes by following technique:
1. the preparation of nanometer magnetic bead
Get respectively 5.2g FeCl
36H
2o, 2.7g FeSO
47H
2the concentrated hydrochloric acid of O, 0.85mL12.1moL/L is dissolved in 200mL water, ultrasonic deoxidation, after above solution is splashed into to 250mL, 0.75moL/L NaOH solution; Stir under 80 ℃, after reaction finishes, utilize magnetic separator that the gained precipitation is separated from reaction medium, then use washed with de-ionized water 3 times, dehydrated alcohol cleans 2 times, and is made into the Fe of 5g/mL
3o
4the magnetic nano-particle ethanol solution; Get 25mL Fe
3o
4the magnetic nano-particle ethanol solution, then be diluted to 150mL with dehydrated alcohol, sonic oscillation 30min; Drip 0.4mL APTES, under room temperature, stir 7h; React complete, Fe APTES modified with magnetic separator
3o
4magnetic nano-particle separates from reaction medium, and cleans 3 times with ethanol solution, finally is made into the amination Fe of 10.5mg/mL
3o
4the nanometer magnetic bead ethanol solution;
2. the preparation of immunomagnetic beads
Get 0.5mL amination Fe
3o
4the nanometer magnetic bead ethanol solution, clean 3 times with 1mL PBS, and magnetic separator is abandoned supernatant liquor; Add 5% (V/V) glutaraldehyde solution 2mL, the room temperature crosslinked 2h that vibrates, magnetic separates, and abandons supernatant liquor; After PBS washing 3 times abandoning supernatant liquor, adopt respectively the 0.5mL antiviral antibody to be coated with amination Fe
3o
4nanoparticle, fixedly 2h vibrates under room temperature; Magnetic separates, and washs respectively 3 times with PBS and ultrapure water, then uses the PBS constant volume, and 4 ℃ of Refrigerator stores are standby, obtain immunomagnetic beads.
9. the detection method of a kind of odontoglossum ring spot virus according to claim 7, the wavelength that it is characterized in that described UV irradiation equipment is 240-260nm, 350-370nm.
10. the detection method of a kind of odontoglossum ring spot virus according to claim 7 is characterized in that described reaction solution damping fluid 2X is composed of the following components:
Described enzyme solution is Bst archaeal dna polymerase and AMV reversed transcriptive enzyme mixed solution; Described fluorescence dye contains fluorexon.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310344684.2A CN103436634B (en) | 2013-08-08 | 2013-08-08 | For detecting the primer of odontoglossum ring spot virus, test kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310344684.2A CN103436634B (en) | 2013-08-08 | 2013-08-08 | For detecting the primer of odontoglossum ring spot virus, test kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103436634A true CN103436634A (en) | 2013-12-11 |
| CN103436634B CN103436634B (en) | 2015-07-29 |
Family
ID=49690347
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310344684.2A Active CN103436634B (en) | 2013-08-08 | 2013-08-08 | For detecting the primer of odontoglossum ring spot virus, test kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103436634B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107132346A (en) * | 2017-05-23 | 2017-09-05 | 天津农学院 | A kind of ferroso-ferric oxide immune nanometer magnetic bead and its preparation method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101255460A (en) * | 2008-03-25 | 2008-09-03 | 山东出入境检验检疫局检验检疫技术中心 | Preparation and detection method of Bacterium typhosum rapid detection reagent kit |
-
2013
- 2013-08-08 CN CN201310344684.2A patent/CN103436634B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101255460A (en) * | 2008-03-25 | 2008-09-03 | 山东出入境检验检疫局检验检疫技术中心 | Preparation and detection method of Bacterium typhosum rapid detection reagent kit |
Non-Patent Citations (4)
| Title |
|---|
| 明艳林等: "RT-PCR检测齿兰环斑病毒技术的建立", 《福建农林大学学报》, vol. 32, no. 3, 30 September 2003 (2003-09-30) * |
| 秦文韬等: "环介导恒温扩增技术（LAMP）及其在植物病毒检测中的研究进展", 《中国农学通报》, vol. 29, no. 21, 25 July 2013 (2013-07-25) * |
| 胡寅等: "有机磷农药纳米磁珠酶联免疫分析方法研究", 《环境污染与防治》, vol. 32, no. 9, 15 September 2010 (2010-09-15) * |
| 陈定虎等: "运用纳米磁珠技术结合RT-PCR方法检测李痘病毒", 《植物检疫》, vol. 24, no. 3, 15 May 2010 (2010-05-15) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107132346A (en) * | 2017-05-23 | 2017-09-05 | 天津农学院 | A kind of ferroso-ferric oxide immune nanometer magnetic bead and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103436634B (en) | 2015-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN103451316B (en) | Primer and kit as well as method for detecting cymbidium mosaic virus | |
| CN105671210A (en) | LAMP technology-based primer, kit and detection method for detecting Plum pox virus | |
| Johnson et al. | Development of a magnetic capture hybridization real-time PCR assay for detection of tumorigenic Agrobacterium vitis in grapevines | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| CN103436608B (en) | Rapid detection method based on nucleic acid aptamers and kit | |
| CN103409555B (en) | Macrobrachium rosenbergii Nodavirus RT-LAMP-LFD detection method and detection kit thereof | |
| CN101660005A (en) | Rapid diagnostic kit based on loop-mediated isothermal amplification technique for hepatitis A virus genes and detection method thereof | |
| CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
| CN113999921B (en) | Method and kit for rapidly and visually detecting shigella flexneri | |
| CN102094090A (en) | Cholera toxin virulence gene detection kit and detection method thereof | |
| CN104611324A (en) | Whole blood sample fast pyrolysis kit and detection method thereof | |
| CN103436635B (en) | Primers for detecting plum pox viruses as well as kit and detection method | |
| CN103276091A (en) | Kit for detecting proviral DNA (Deoxyribonucleic Acid) of HIV (Human Immunodeficiency Virus) | |
| CN104946798A (en) | Primer and method for detecting tobacco mosaic virus LAMP | |
| CN103436634B (en) | For detecting the primer of odontoglossum ring spot virus, test kit and detection method | |
| CN104593495A (en) | PCR method and kit for detecting internal amplification control of salmonella in foods | |
| CN102337355B (en) | Herpes virus type I PCR (polymerase chain reaction) fluorescence quantitative rapid test kit and method | |
| CN101555529A (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| Bai et al. | Exploring magnetic capture to improve the detection of human norovirus in strawberries | |
| CN102827948A (en) | Method and kit for detection of foodborne viruses through flow cytometry based on amplification of magnetic primer | |
| CN102140516B (en) | Primer for detecting CAMV35S genes, relevant kit and detecting method | |
| CN104278024A (en) | Primer composition for identification of human adenovirus type 55 and application thereof | |
| CN109439730B (en) | Single-stranded nucleic acid multiplex detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |