CN103436534A - Application of chicken growth related gene FOXO3 serving as molecular marker - Google Patents

Abstract

The invention belongs to the technical field of poultry molecular marker preparation, and particularly provides an application of a chicken growth trait related FOXO3 gene G6716193A locus serving as a molecular marker in chicken production performance study. A nucleotide sequence of a gene segment is shown as a sequence table SEQNO: (Sequence Number) 1, wherein mutation from G to A exists at a 102bp part of the sequence table SEQNO: 1; the locus is significantly related (P less than 0.05) or extremely significantly related (P less than 0.01) to a plurality of growth traits of chicken; an AG gene is a protogene; heterosis is embodied sufficiently; and an allele A is a preponderant allele. The invention further discloses an upstream and downstream primer sequence for amplifying the gene and detecting G/A base mutation deletion at the 102bp part of the sequence table SEQNO: 1. The application provides a new marker for chicken molecular marker-assisted selection.

Description

Chicken growth related gene FOXO3 is as the application of molecule marker

Technical field

The present invention relates to poultry molecule marker preparing technical field, more specifically, relate to the application of chicken growth related gene FOXO3 as molecule marker.

Background technology

Very abundant of China's local variety broiler chicken resource, but with external commercial variety, to compare production performance not good, and the breeding problem has become the bottleneck that the efficient poultry of restriction is produced, and growth traits is significant for production and the breeding of chicken.Because growth traits is quantitative character, controlled by the minor-polygene system, be dynamic change in growing, its genetic progress is slow.Therefore marker assisted selection is to improve the effective way of chicken growth traits genetic progress, but prerequisite is to locate and the closely linked mark of this proterties.DNA analysis is applied to as main research means in the breeding of broiler chicken, main purpose is by finding and the closely-related genetic marker of growth of meat chicken proterties on the DNA molecular level, for early stage seed selection, thereby accelerates breeding process.

The growth traits of chicken is the proterties of a complexity, very easily is subject to the impact of environment.Along with deepening continuously to the chicken increment study, identified in a large number and the relevant gene that grows, growth hormone releasing hormone (GHRH), Somatostatin (SS), tethelin (GH), growth hormone receptor (GHR), rhIGF-1 (IGFs), IGF-1 (IGFR), igf binding protein (IGFBPs), muscle regulatory factor (MyoD) etc.Simultaneously, the variation of the gene of these and growth correlation may cause the difference of growth.

Insulin/insulin-like growth factor (INS/IGF-1) path i.e. (INS/IGF-1-PI3K-Akt-FoxO) path is an important path that affects animal growth, and the FOXO3 gene is a key gene on this path.Research finds, in C2C12 clone, the expression that suppresses FOXO3 by RNAi can increase the expression of myosin, and FOXO3 can control the myocyte by regulation and control MyoD and breaks up (Hu et al., 2008; Wang Minghui, 2011).IGF-1 is the target gene of miRNA-1, miRNA-1 can regulate and control the expression of IGF-1, and, in the research of (2009) such as Leonardo Elia, IGF-1 can regulate by the FOXO3a in path again the expression of miRNA-1, thereby forms a feedback regulation loop.Wang Minghui (2011) utilizes SNaPshot technology somatotype in Ph D dissertation, dependency between pig gene pleiomorphism and polymorphic site and Growth Traits is studied, found that the FOXO3 gene pairs reaches 60kg body weight number of days, to reach 100kg body weight number of days, weightening finish, daily ingestion amount and day weight gain closely related.These reports have all convincingly demonstrated the FOXO3 gene the muscle development of animal and the middle performer key player that grows.

Yet the research of FOXO3 gene on chicken also rarely has report, up to now, there is no the molecule marker of relevant chicken FOXO3 gene as the chicken growth traits.

Summary of the invention

The invention provides the application of chicken growth traits genes involved FOXO3 as molecule marker, the nucleotide sequence of described molecule marker, as shown in sequence table SEQ NO:1, wherein has 1 G/A sudden change at the 102bp place of sequence table SEQ NO:1.

Described molecule marker is the genetic marker with the growth of meat chicken proterties.

The described early stage seed selection that is applied as broiler chicken.

A kind of FOXO3 gene fragment relevant to the chicken growth traits as the molecule marker application is provided again, the nucleotide sequence of described molecule marker is as shown in sequence table SEQ NO:1, and the DNA sequence dna of forward and reverse primer pair of the G/A of 102bp place sudden change that wherein detects sequence table SEQ NO:1 is as follows:

Forward primer 5' is SEQ NO:2 to 3',

Reverse primer 5' is SEQ NO:3 to 3'.

A kind of selection of broiler chicken is provided according to demand again, comprises the following steps:

S1. the DNA extraction of chicken to be detected,

S2. the acquisition of purpose fragment and order-checking: utilize SEQNO:2 and SEQNO:3, by round pcr, the DNA of the chicken to be measured of increasing, carry out sequencing and typing by the product of acquisition.

S3. according to the result of sequencing and typing, the chicken to be detected that selection is judged to be heterozygote is the broiler chicken of wanting required for the present invention.

In order to understand better the present invention, below the present invention program's association reaction formula is done to further explaination, it can not be as the restriction of protection domain of the present invention.

The present invention is by having prepared a growth of meat chicken trait related gene FOXO3 as molecule marker, and its nucleotide sequence, as shown in sequence table SEQ NO:1, wherein has 1 G/A sudden change at the 102nd place of sequence table SEQ NO:1.

As follows with the DNA sequence dna of forward and reverse primer of the 102nd G/A of the place sudden change that detects sequence table SEQ NO:1 for the FOXO3 gene that increases: forward primer: 5'ccagccttcccatttccatca3'; Reverse primer: 5'cgggagttctgggcggacac3'.

Concrete steps of the present invention are as follows:

1) extract the chicken genomic dna from detected chicken group blood sample; ;

2) according to UCSC database chicken FOXO3 genome sequence ( http:// genome.ucsc.edu/cgi-bin/hgBlat), this site is positioned at genome 66716193place, so the G/A in this site sudden change is designated as G66716193A, utilize the forward and reverse primer of biology primer-design software GeneTool design packet containing this site, synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.The nucleotide sequence of described primer is as follows:

Forward primer: 5'ccccagaagtgaaagga3'

Reverse primer: 5'gaaacagaggtgccaaa3';

3) PCR reaction amplification program is: 94 ℃ of sex change 3min, and 72 ℃ of extension 10min of 32 circulations (94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min), obtain pcr amplification product;

The variation in this site can not be distinguished genotype by suitable restriction enzyme identification cutting, therefore adopt method somatotype in detected chicken group of sequencing and typing.

The broiler chicken selected by molecule marker of the present invention, growth traits is improved, and can be used as kind of chicken and uses.

The accompanying drawing explanation

Fig. 1 is techniqueflow chart of the present invention.

Fig. 2 is that the somatotype result is showed.

Embodiment

Embodiment 1(Preparation Example)

1, the extraction of the collection of chicken blood sample and DNA:

After tested chicken group's pedigree situation and growth traits have been measured, adopt disposable syringe to extract about 1mL blood in vein from chicken wings, injection is through autoclaving and the approximately aseptic EDTA(Ethylenediaminetetraaceticacid of 200 μ L2% is housed, EDTA) in the 1.5mL centrifuge tube of antithrombotics, shake up gently, record wing number ,-80 ℃ save backup.

The extracting of genomic dna adopts phenol-chloroform extraction method (this pool F difficult to understand etc., 1998):

(1) get whole blood 30 μ L and be placed in the 1.5mL centrifuge tube, add respectively 470 μ L1 * SET damping fluid, 12.5 μ L20%SDS and 6 μ L10mg/mL Proteinase Ks, be put in 55 ℃ of water-baths after mixing and spend the night;

(2) take out sample in the 1.5mL centrifuge tube, add the saturated phenol of 500 μ L, jog 20min, the centrifugal 10min of 10,000rpm;

(3) get supernatant, again add the saturated phenol of 500 μ L, jog 20min, the centrifugal 10min of 10,000rpm;

(4) get supernatant, add 500 μ L chloroform-primary isoamyl alcohol (23:1) jog 20min, the centrifugal 10min of 10,000rpm;

(5) get supernatant, add 1mL ice dehydrated alcohol (20 ℃), oscillate to precipitate DNA, after the centrifugal 10min of 10,000rpm, pour out ethanol;

(6) clean DNA once with 1mL75% ethanol, outwell ethanol, be placed in 50 ℃ of loft drier and dry; (7) after the DNA complete drying, add the distilled water after 300 μ L sterilizings to dissolve, spend the night with dissolving DNA in 50 ℃ of water-baths;

(8) deposit in-20 ℃ of refrigerators and save backup.

2, the acquisition of purpose fragment and sequencing and typing

(1) amplification is containing the nucleotide fragments in site to be measured

According to chicken FOXO3 genome sequence, design packet, containing the primer of site sequence to be measured, is utilized round pcr, the tested chicken group's that increases DNA, and the product of acquisition, entrust the order-checking of Shanghai Mei Ji biotech firm.

3, genotype is judged and association analysis

Judge the genotype of this site in detecting colony according to the result of order-checking.Result as shown in Figure 2, if this sample is homozygous words, just only has a product peak: G peak or A peak.If heterozygosis so just there will be 2 peaks: G peak and A peak.

Embodiment 2(Application Example)

FOXO3 gene polymorphic site different genotype and chicken growth traits have been carried out to the detection application of association analysis.The association analysis result is as shown in table 1.Can draw G66716193A site and chicken 7,14,21,35 in table, 42,49,56,70,77,84 age in days body weight, 70 age in days path lengths, the wide and 4-8 in 70 age in days footpaths age in week, average all gains in weight were significantly relevant (P<0.05) or utmost point significant correlation (P<0.01).Wherein heterozygote genotype AG is obviously heavy than homozygote frequency of genotypes AA and GG in the body weight in each age in days stage, 4-8 during age in week average gain in weight weekly also many, path length and footpath are wide also long wider than homozygote genotype, so the AG genotype is preponderant genotype.Compare AA genotype and GG genotype, proterties difference is not very remarkable, but on the whole, the AA genotype shows slightly advantage than GG genotype, so allelotrope A is advantage allelotrope.

Table 1 FOXO3 gene G66716193A site and chicken growth traits correlation analysis

Annotate: () interior numeral number of individuals; Colleague's data, different capitalizations mean difference extremely significantly (P<0.01); Different lowercase alphabet differentials different significantly (P<0.05), identical capitalization or identical lowercase alphabet differential are different not remarkable.

<110 > Agricultural University Of South China

<120 > chicken growth related gene FOXO3 is as the application of molecule marker

<130>

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 1057

<212> DNA

<213> FOXO3

<400> 1

ccagccttcc catttccatc acccaagaac ccacggtgat gtccaggagg gcccagcatt 60

ttgattcatg tcattttctt gtgatgttgg tgtcgtgatc gggatttggg gtagcaaaag 120

gaatgctggt cttgacatgt tgttttcttc ctttcctgca gaattcaatc cggcataact 180

tgtcgctcca cagccgattc atcagggtgc agaacgaagg cactgggaag agctcctggt 240

ggatgatcaa tccagacggt ggaaaagttg gcaaggcgcc ccggagacgc gccgtgtcca 300

tggacaacag caacaagtac acaaagagca gggggcgggc ggcgaagaaa aaggcagccc 360

tgcagactgc ccaggaggcg agcgaggaca gcccttcgca gctctccaag tggccgggga 420

gcccgacttc ccgcagcagt gacgagctgg atgcctggac agattttcgc tcccggacaa 480

attcgaacgc cagtacaata agtggccgct tgtcaccgat tttggcgagc accgagctgg 540

atgatgttca agatgacgac gctccacttt ctcccatgct gtacagtagt ccttcgagct 600

tgtccccctc ggtaaacaaa ccgtgcactg tggagttgcc taggttgact gatatggctg 660

ggacaatgaa tttgaacgat ggactgacag ataacctcat ggatgacctc ttggacaata 720

taacactccc ttcctcccag cagtcgccca caggagggat gatgcagaga agctccagtt 780

ttccgtatgg ttccaaaggt tcagggctgg gctccccctc gagtagtttc aacaacgctg 840

tgtttgggcc atcgtccctg aattccctcc gccagtcgcc catgcagact attcaggaga 900

acaagcaggc taccttttct tccatttctc attacaacaa ccagacgctg caggatctgc 960

tcgcctcgga tgcacttagt cacagcgatg tcatgatgac acagtctgac ccgcttatgt 1020

cccaggccag cacagctgtg tccgcccaga actcccg 1057

<210> 2

<211> 21

<212> DNA

<213 > forward primer

<400> 2

ccagccttcc catttccatc a 21

<210> 3

<211> 20

<212> DNA

<213 > reverse primer

<400> 3

cgggagttct gggcggacac 20

Claims (5)

1. chicken growth traits genes involved FOXO3, as the application of molecule marker, is characterized in that, the nucleotide sequence of described molecule marker, as shown in SEQ NO:1, wherein has the heterozygote of 1 G/A at the 102bp place of SEQ NO:1.

2. application according to claim 1, is characterized in that, described molecule marker is the genetic marker with the growth of meat chicken proterties.

3. application according to claim 2, is characterized in that, the described early stage seed selection that is applied as broiler chicken.

4. the FOXO3 gene fragment relevant to the chicken growth traits as molecule marker application, its nucleotide sequence is as shown in sequence table SEQ NO:1, and the DNA sequence dna of forward and reverse primer pair of the G/A of 102bp place sudden change that wherein detects sequence table SEQ NO:1 is as follows:

Forward primer 5' is SEQ NO:2 to 3',

Reverse primer 5' is SEQ NO:3 to 3'.

5. the selection of a broiler chicken, is characterized in that, comprises the following steps:

S1. the DNA extraction of chicken to be detected,

S2. the acquisition of purpose fragment and order-checking: utilize SEQNO:2 and SEQNO:3, by round pcr, the DNA of the chicken to be measured of increasing, carry out sequencing and typing by the product of acquisition;

S3. according to the result of sequencing and typing, the chicken to be detected that selection is judged to be heterozygote is the broiler chicken of wanting required for the present invention.

Images